ID: 950243125

View in Genome Browser
Species Human (GRCh38)
Location 3:11389546-11389568
Sequence ATTTTCCCGTTTTAGTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950243125_950243126 -10 Left 950243125 3:11389546-11389568 CCATCATACTAAAACGGGAAAAT 0: 1
1: 0
2: 0
3: 19
4: 228
Right 950243126 3:11389559-11389581 ACGGGAAAATACCGCCTGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 35
950243125_950243127 -9 Left 950243125 3:11389546-11389568 CCATCATACTAAAACGGGAAAAT 0: 1
1: 0
2: 0
3: 19
4: 228
Right 950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950243125 Original CRISPR ATTTTCCCGTTTTAGTATGA TGG (reversed) Intronic
900790907 1:4680050-4680072 ATGTTTCCGTTTGAGTCTGAAGG + Intronic
906262201 1:44402488-44402510 ATTTAGCCATTTTAGTATGGTGG - Intergenic
907557539 1:55357821-55357843 AGTTTCCAGTTTTAGTATGTGGG - Intergenic
907869241 1:58427955-58427977 ATTTTTCAGTTTCATTATGAAGG - Intronic
908906077 1:69011455-69011477 ATTTTCTGGTTTTGATATGAGGG + Intergenic
909308908 1:74120434-74120456 ATTTTCCGGTTTTATTAACAAGG + Intronic
909790871 1:79676609-79676631 ATTTTCTCATTTTGGTATTAGGG + Intergenic
910731489 1:90402217-90402239 ATTATTACATTTTAGTATGAAGG - Intergenic
911018542 1:93362131-93362153 ATTTTGCAGTTTTAGTAAAAGGG + Exonic
911496812 1:98641766-98641788 TTTTTCCGGTTTTTGTATCAGGG - Intergenic
912670186 1:111618060-111618082 TTTTTCTCATTTTAGTATGCTGG - Intronic
913444857 1:118940218-118940240 ATTTTCCCCTGTTAGTACAAGGG + Intronic
915673812 1:157512677-157512699 ATTTTTCAGTTTGAGTCTGAAGG - Intergenic
916947664 1:169745006-169745028 ATTGTCCAGTTTTGGTATGAAGG - Intronic
918947445 1:191086249-191086271 CTTTTCTAGTTTTAGTATCAGGG - Intergenic
920442697 1:205991716-205991738 AGTTTCTCTTTTTAGTGTGATGG - Intronic
921382673 1:214541148-214541170 ATGTTCCCTTTTTATTATTAGGG - Intronic
923850874 1:237792866-237792888 ATTTTATTGTTTTATTATGAGGG + Intronic
924244433 1:242069611-242069633 ATTTTCCCTTAGTAATATGAGGG + Intergenic
924369103 1:243328445-243328467 ATTTTCATATTTTAGTAGGACGG + Intronic
924910295 1:248503920-248503942 ATTTTACTTGTTTAGTATGATGG - Intergenic
924913805 1:248544118-248544140 ATTTTACTTGTTTAGTATGATGG + Intergenic
1062853219 10:761488-761510 ATTTTCCTGTGTTTTTATGATGG - Intergenic
1063736555 10:8761986-8762008 ATTTTCCTGTTTTAGCCAGATGG - Intergenic
1064730821 10:18329066-18329088 ATTTTCTCGTTTTCGTTTGTAGG + Intronic
1064897050 10:20249124-20249146 ATTTTTCTGTTTTATTATGATGG + Intronic
1065341349 10:24709432-24709454 CTTTTCCAGTTTTGGTATCAGGG - Intronic
1065458203 10:25929873-25929895 ATTTGCCGGAGTTAGTATGATGG - Intergenic
1065465158 10:26012138-26012160 CTTTTCCCCATTCAGTATGATGG - Intronic
1067990369 10:51205305-51205327 ATTTTTCCGTTTTTGTGAGATGG + Intronic
1068144250 10:53045849-53045871 ATTTTCCCATATTACTTTGAAGG - Intergenic
1068633726 10:59325356-59325378 ATTTTACCCCTTTTGTATGAAGG - Intronic
1070851561 10:79566740-79566762 ATTTTCTCCATTCAGTATGATGG + Intergenic
1070854768 10:79598503-79598525 ATTTTCCCCATTCAGTATGATGG - Intergenic
1070894471 10:79971336-79971358 CTTTTCATGTTTTGGTATGAGGG + Intronic
1074294710 10:112174112-112174134 ATGTTCCCATTAAAGTATGAGGG + Intronic
1077294265 11:1817326-1817348 TTTTTCCAGTTTTTGTATGGTGG - Intergenic
1078109088 11:8377510-8377532 CTTTTCCCCATTCAGTATGATGG - Intergenic
1078938488 11:15974285-15974307 ATTTTCCTGTTTGAGTGAGATGG - Intronic
1079544542 11:21616835-21616857 ATTTTCCATTTTTAATAGGATGG - Intergenic
1080085819 11:28280441-28280463 CTTTTCACATTTTACTATGATGG + Intronic
1087357287 11:97110680-97110702 TTCTTCCTGTTTTAGAATGAAGG - Intergenic
1089150094 11:116357729-116357751 ATATTCCCATTTTAGCATAAAGG + Intergenic
1090887524 11:130892360-130892382 ATTTGCCCATTTTATAATGAAGG - Intronic
1091575708 12:1732805-1732827 ATTTTCTCATTTTAATATTAGGG - Intronic
1093136071 12:15452508-15452530 CTTTCCCCGTTTTGGTATTAGGG - Intronic
1093540480 12:20277428-20277450 ATTTTCTCGTTTTAAAATTAGGG + Intergenic
1093844186 12:23948859-23948881 ATTTTCCCCTTTTGCTATGATGG - Intronic
1095728666 12:45480366-45480388 CTTTTCCCCTTTTAGTAAGATGG + Intergenic
1105509301 13:21037948-21037970 ATCTTCCCTTTTCAGAATGAGGG + Intronic
1108938358 13:55915448-55915470 ATTTTCCACTTTTATTATGATGG + Intergenic
1110511989 13:76361576-76361598 ATTTTCCCAATTTAATTTGATGG - Intergenic
1110585164 13:77181807-77181829 ATCTTCCCGATTGCGTATGATGG - Exonic
1111487233 13:88919691-88919713 ATTTTCCCTTTTTAGTATCCAGG + Intergenic
1111523567 13:89437082-89437104 ATTTTCCCGTTTTATCAGGAGGG - Intergenic
1113220120 13:108090878-108090900 TTTTTCACCTATTAGTATGAAGG - Intergenic
1114368814 14:22061982-22062004 ATGTTCAGGTTTTTGTATGAAGG + Intergenic
1115407231 14:33031329-33031351 ATTATCCAGTTTTATGATGAGGG + Intronic
1117979841 14:61331671-61331693 ATTTCCCCGTTATATTGTGAGGG + Intronic
1119019733 14:71098903-71098925 CTTTTCCCCATTCAGTATGAGGG + Intronic
1119144040 14:72294220-72294242 ATTTTCCTGTATTAGGATAAGGG + Intronic
1119579984 14:75769626-75769648 ATCTTCAAGTTTTAGTATAAAGG + Intronic
1119920771 14:78444118-78444140 ATTTTCCCACTTTAGTGGGAAGG + Intronic
1122277194 14:100598586-100598608 GTTTTCCAGTTTTGGTATCAGGG + Intergenic
1123773335 15:23551834-23551856 TTTTTCCTGTTTTAGTTTTAAGG + Intergenic
1130334194 15:82944767-82944789 TATTTCCTGTTTTAGTATGAAGG - Intronic
1132615270 16:838161-838183 TTTTTCTGGTTTTAGTATTACGG + Intergenic
1134572984 16:15307420-15307442 ATTTTGACGTTTCAGTTTGAAGG - Intergenic
1134733947 16:16484883-16484905 TGTTTACTGTTTTAGTATGACGG + Intergenic
1134933554 16:18227399-18227421 TGTTTACTGTTTTAGTATGACGG - Intergenic
1134938035 16:18263288-18263310 ATTTTGACGTTTCAGTTTGAAGG - Intergenic
1137535331 16:49318090-49318112 TTTGTCCAGTTTTAGTATTAAGG + Intergenic
1138923656 16:61564741-61564763 ATGCTCACGTTTTATTATGAAGG + Intergenic
1138969545 16:62128303-62128325 ATTTTCCACTTTTAATATAATGG - Intergenic
1141173046 16:81703237-81703259 ATTTTCCAGATTTAGTGTGTGGG + Intronic
1141298179 16:82789515-82789537 GTTTTCCAGTTTTATAATGAGGG + Intronic
1141732940 16:85834449-85834471 GTTTTCTTGTTTTAATATGATGG - Intergenic
1142053136 16:87973588-87973610 ATTTTCTATTTTTAGTAAGACGG - Intronic
1142945060 17:3419701-3419723 ATTTTCCCATTTTTCTCTGAGGG - Intergenic
1145357551 17:22175447-22175469 ATTTCTCCTTTTTTGTATGATGG - Intergenic
1147030748 17:37633717-37633739 TTTTTCCTTTTTTAGTGTGAAGG - Intronic
1147277310 17:39329449-39329471 ATTTTCCCCCTTTACTATAAAGG + Intronic
1147517016 17:41128512-41128534 ATTTTCTGGTTTTGGTATTAGGG - Intergenic
1149240760 17:54645945-54645967 ATTGTCCGGTTTTGGTATCAGGG - Intergenic
1149314264 17:55423476-55423498 ATTTTCCCGATTTAGTGTTGAGG - Intergenic
1150923701 17:69510439-69510461 ATTTTCTAGTTTTAGTATTAAGG + Intronic
1152060786 17:78073329-78073351 ATTTTCCCGTTATGTTTTGAGGG + Intronic
1155374608 18:25142085-25142107 ATGTTCCCTTTTTGGTGTGATGG - Intronic
1157133603 18:45032458-45032480 AATTTCACCTTTTAGGATGAAGG - Intronic
1159500917 18:69268391-69268413 ATTTTCCTTATTTATTATGACGG + Intergenic
1159760315 18:72417764-72417786 ATGTTCGTGTTTTAGTATAAAGG - Intergenic
1161439741 19:4284131-4284153 ATTTTGCATTTTTAGTAAGACGG - Intronic
1163136047 19:15312105-15312127 ATTTTCCCATGTTAGTATTGAGG - Intronic
1167962717 19:53120328-53120350 ATTTACACGTTTTCGTATTAAGG - Intronic
925685331 2:6465904-6465926 ATTCTCCCTTTTTATAATGATGG + Intergenic
928952722 2:36828101-36828123 TTTTTCTTGTTTTGGTATGATGG + Intergenic
929232360 2:39572855-39572877 ATTTTCCTGTTTTAGCAGTAAGG + Intergenic
930161352 2:48160073-48160095 ATTTTCCCCATTCAGTATGATGG - Intergenic
931521517 2:63102664-63102686 ATTGTCTGGTTTTAGTATCAGGG + Intergenic
938562102 2:132482246-132482268 ATTTTCCCTTTTCAGCCTGATGG + Intronic
938632524 2:133183278-133183300 TTTATCTCGTTTTAGTATCAGGG - Intronic
938749225 2:134312849-134312871 ATTATCCCGTTTTAGAAAAAAGG - Intronic
939455365 2:142427618-142427640 ATTTTCTCTTTTTAGGATGTAGG + Intergenic
939704499 2:145435789-145435811 ATTTTTCCGATTTATTAAGATGG + Intergenic
939907364 2:147933337-147933359 ATTTTAGCATTTTTGTATGAGGG + Exonic
941343242 2:164334665-164334687 ATGGAACCGTTTTAGTATGATGG + Intergenic
942395012 2:175537790-175537812 TTTTTCCTGTTTTAGTTTCACGG - Intergenic
942941573 2:181624804-181624826 ATTTTCCCATTTCAGTAAGTGGG - Intronic
943581554 2:189689505-189689527 ATTTTCCTTTTTTATCATGAAGG + Exonic
943940080 2:193981872-193981894 ATTTTCTGGTTTTACTATTAGGG - Intergenic
944332109 2:198482005-198482027 ATTTTGCCTTTTTTGTATGTAGG - Intronic
944769880 2:202903323-202903345 TTTTTCCCCATTTAGTATGGGGG - Intronic
945210078 2:207374072-207374094 TTTGTCCCGTTTTGGTATTAAGG - Intergenic
945341035 2:208654373-208654395 ATTTTCAGGTTTTGGTATCAAGG - Intronic
945777481 2:214125258-214125280 ATGTTCTCTTTTTAGTCTGAGGG + Intronic
947759123 2:232590462-232590484 ACATTCCCGCTTTAGGATGATGG - Intergenic
1174416511 20:50370927-50370949 AATTTCCCTTATTAGTATTAAGG - Intergenic
1175013165 20:55760639-55760661 TTTTTCCCCTTTTTCTATGAAGG + Intergenic
1177715044 21:24829004-24829026 ATTATTTCATTTTAGTATGAAGG + Intergenic
1178760967 21:35402631-35402653 ATTTCTCCTTGTTAGTATGATGG + Intronic
949280307 3:2338904-2338926 TCTTTCCCTTGTTAGTATGATGG - Intronic
950243125 3:11389546-11389568 ATTTTCCCGTTTTAGTATGATGG - Intronic
951967451 3:28402567-28402589 TTTTTCTCGTTTTGGTATTAGGG - Intronic
956298543 3:67742135-67742157 TTTTTCTGGTTTTGGTATGAGGG + Intergenic
957378833 3:79397051-79397073 TTTTTCACGTTTTAGTATCCAGG - Intronic
959298603 3:104571074-104571096 ATTGTACCTTTTTATTATGATGG - Intergenic
959842020 3:110988057-110988079 TTTTTCCAGTTTTGGTATCATGG - Intergenic
959853969 3:111125922-111125944 TTTCTCCCGTTTTATTATGTTGG + Intronic
960748814 3:120922566-120922588 ATTTTCCCTGTTCAGTATGATGG + Intronic
960929797 3:122835288-122835310 TTTTTCCGGTTTTGGTATCAGGG - Intronic
961200368 3:125040749-125040771 AAATTCCCCTTTGAGTATGATGG + Intronic
961707052 3:128795345-128795367 CTTTTCCCCCTTTAGTTTGAAGG + Exonic
962772127 3:138622166-138622188 ATTTTTCTGTTTTATTATGTAGG + Exonic
962777616 3:138677724-138677746 ATTTTGTAGTTTTAGTAAGACGG - Intronic
963887175 3:150595898-150595920 ATTTTCCCAAGTTAGTATAATGG + Intronic
965073062 3:163940737-163940759 ATTTTCCCGCTTTAGACTAATGG + Intergenic
965173981 3:165306555-165306577 TTTTTCCAGTTTTAGTGTCAGGG - Intergenic
965867594 3:173224492-173224514 ATTTTCTAGTTTTATTATCAAGG - Intergenic
966112769 3:176423314-176423336 TTTTTCTGGTTTTAGTATCAAGG - Intergenic
969684532 4:8663608-8663630 ATTTTCACGTTTTGAAATGAAGG - Intergenic
970058047 4:11997598-11997620 ATTTTCACTATTGAGTATGATGG - Intergenic
970153984 4:13122557-13122579 ATTCTACCATTTTACTATGATGG + Intergenic
972072810 4:35042751-35042773 ATTTTCAAGTTTTAGAATTAGGG + Intergenic
975053925 4:69903591-69903613 TTTTTCTGGTTTTAGTATCAGGG - Intergenic
976375656 4:84342446-84342468 TTTTTCCCGTGCTAGTATAAGGG + Intergenic
977278122 4:95004516-95004538 ATTTTCCTGCTTTAGTGTAAAGG + Intronic
977710857 4:100123500-100123522 ATATTCCAGTTTGAGTCTGAAGG + Intergenic
979043352 4:115829617-115829639 ATTGTCTCATTTTACTATGATGG + Intergenic
979084688 4:116392008-116392030 TTTTTCTGGTTTTAGTATCAGGG + Intergenic
980552752 4:134361455-134361477 ATTTTTCAGTTTTAGAATAATGG - Intergenic
980574720 4:134670254-134670276 ATTTTCACGTTTGAATCTGAAGG + Intergenic
980684860 4:136214083-136214105 CTTTTCCCCATTTACTATGATGG + Intergenic
980727527 4:136784383-136784405 ATGTTCACTTTTGAGTATGATGG - Intergenic
981239204 4:142454736-142454758 ATTTTCCCAATTTATTATAAGGG - Intronic
982028091 4:151272263-151272285 ATTTTCCCATTGTACCATGAAGG - Intronic
983752642 4:171295855-171295877 AGTTTCCCTATTTAATATGAGGG - Intergenic
984812288 4:183806189-183806211 ATTTTCCCAATTTATTGTGAAGG + Intergenic
986513704 5:8538244-8538266 ATTTTCCTGATTTTGTATCAGGG - Intergenic
990125634 5:52514221-52514243 TTTTTCCAGTTTTGGTATCAGGG - Intergenic
991064863 5:62413938-62413960 ATTTTCCCTTTTGGTTATGATGG + Intronic
992275783 5:75116735-75116757 ATTTTTCAGTTTTAATGTGATGG + Intronic
992497946 5:77311480-77311502 ATCTTCATGTTTTACTATGAGGG - Intronic
992933514 5:81676592-81676614 ATTTTCCTGGTTTAGCAGGAGGG - Intronic
993104928 5:83589564-83589586 ATTTTCCAGTTTTAGCACAATGG - Intergenic
994872416 5:105369108-105369130 ATTTTCTCGTTTTATTCTGCTGG - Intergenic
995087803 5:108135283-108135305 GTTTTCCCCTTTAAATATGAAGG - Intronic
997060306 5:130493113-130493135 ATTTTCTGGTTTTGGTATTAAGG - Intergenic
998926960 5:147137083-147137105 ATTTTGTAGTTTTAGTAGGACGG + Intergenic
999528938 5:152440563-152440585 ATTTTGCAGTTTTAGTAAAAGGG - Intergenic
1000759121 5:165199642-165199664 ATTTTTAAGTTTTATTATGAGGG + Intergenic
1003637879 6:7850442-7850464 ATCTTCCTGTTTTAGTAAGGAGG - Intronic
1004586020 6:17001139-17001161 ACATTTCCGTTTTACTATGATGG - Intergenic
1006482710 6:34310708-34310730 TTTGTCCTGTTTTGGTATGAGGG - Intronic
1007297821 6:40840382-40840404 ATTGTCTGGTTTTAGTATCAAGG + Intergenic
1007891691 6:45300398-45300420 ATTTTCCAATTTTATTTTGAGGG - Intronic
1010076040 6:71799803-71799825 ACTTTCTCATTTCAGTATGATGG + Intergenic
1011317350 6:86050754-86050776 ATTTTCCTGTGTTAGTTTGCTGG - Intergenic
1011838603 6:91467163-91467185 ATTTTCCTGTTTTAGGAGCAGGG + Intergenic
1011843904 6:91537668-91537690 ATTTTCCAGTTCTTGTGTGAAGG - Intergenic
1012459175 6:99441796-99441818 CTTTTCCCATTTTACTATTAGGG + Intronic
1012788817 6:103666143-103666165 CTTTTCCATGTTTAGTATGACGG - Intergenic
1013144570 6:107375673-107375695 ATTGTCTGGTTTTAGTATCAAGG - Intronic
1013975260 6:116070096-116070118 ATTATCTCATTTTAGAATGAAGG + Intergenic
1014526533 6:122508165-122508187 ACTTTCCTGTTTTACTATCATGG - Intronic
1015887801 6:137937472-137937494 TTTTTCCAGCTTTAGTATCAGGG + Intergenic
1016177147 6:141094870-141094892 AATTTCCTGTTTTAGTATTTAGG + Intergenic
1016262500 6:142188877-142188899 TTTTTCCCTTTTTAGAATCAGGG + Intronic
1016316381 6:142792845-142792867 ATTTTTCTGTTTTAGAATGGAGG + Intronic
1019815709 7:3198225-3198247 TTTTTCTGGTTTTAGTATCAGGG + Intergenic
1020348757 7:7194651-7194673 ATTTACTGGTTTTAGTATTAGGG + Intronic
1020738566 7:11984380-11984402 AATTTTCCTTTATAGTATGAAGG - Intergenic
1021463636 7:20916773-20916795 ATTTTCCCTTATTAGCATGTGGG + Intergenic
1022877115 7:34545241-34545263 ATTTTCACGTGTCAGTATCAGGG + Intergenic
1024284980 7:47749219-47749241 TTTGTCTGGTTTTAGTATGAAGG + Intronic
1024789705 7:52950723-52950745 ATTTTCTGGTTTTGGTATTATGG - Intergenic
1028831483 7:95331878-95331900 ATTGTCAGGTTTTAGTATCAAGG - Intergenic
1029330780 7:99853074-99853096 TTTTTCCAGTTTTAATATGATGG + Intronic
1031101811 7:117490449-117490471 ATGTTCCAGTTTGAGTCTGAAGG + Intronic
1031556384 7:123181561-123181583 GTTTTCCCCTTTTAGTTAGAAGG - Intronic
1032907373 7:136385434-136385456 ATTTTGCTTTTTTAGTATGCTGG - Intergenic
1034033505 7:147794613-147794635 TTTTTCTCGTTTCAGCATGAGGG + Intronic
1034166025 7:149025903-149025925 CCTTTCCTGTTTTAGCATGAAGG + Intronic
1039934530 8:42030189-42030211 ATTTTCCTATTCTAGTATCAGGG + Intronic
1039994078 8:42516342-42516364 TTTTTCCTGTTTTAGAATTAAGG + Intronic
1040556493 8:48482900-48482922 GTTATCCAGTTTTGGTATGAGGG + Intergenic
1040570996 8:48609966-48609988 TTTTTCTGGTTTTAGTATAAAGG - Intergenic
1041085345 8:54251521-54251543 ATTTCCAAGTTTTAGTATGCCGG + Intergenic
1041502587 8:58554353-58554375 ATTTTCCTGTTTAAGATTGAGGG + Intronic
1041959007 8:63590353-63590375 ATTTTCTGGCTTTAGTATCAAGG + Intergenic
1042633489 8:70846340-70846362 ATTTTCCTGTGTTTTTATGATGG - Intergenic
1044123991 8:88435327-88435349 ATTTTCCCCATTCAGTATAATGG - Intergenic
1044133265 8:88553376-88553398 ATTTTCCCATTTTAAGTTGAGGG - Intergenic
1044851688 8:96434831-96434853 ATTTTCCCTTTTTCTTAAGAGGG + Intergenic
1045149093 8:99382916-99382938 CTTTTCCCCATTCAGTATGATGG + Intronic
1045598688 8:103688583-103688605 ATTTTCTGGCTTTAGTATCAGGG + Intronic
1046182150 8:110664597-110664619 TTATTCCTGTTTTATTATGATGG - Intergenic
1046585195 8:116141992-116142014 ATCTTCCAATTTTAGTATTAAGG + Intergenic
1049739488 8:144230617-144230639 TTTTTCCAGCTTTAGTATCAGGG + Intronic
1050034186 9:1417760-1417782 ATTTTCCTGTAATAGTAGGATGG - Intergenic
1051475501 9:17503691-17503713 CTTTTCCCTCTTTAGTATGTAGG + Exonic
1051732971 9:20166767-20166789 ATTTTACCTTTTTAATATGAAGG - Intergenic
1052692564 9:31833983-31834005 ATTTTCCCTTTTGGGAATGAAGG + Intergenic
1054900541 9:70364363-70364385 ATTTTCACCATTAAGTATGATGG - Intergenic
1058275016 9:103029173-103029195 ATTATCTGGGTTTAGTATGAAGG - Intergenic
1058989869 9:110245273-110245295 TTTTTCCAGTTTTATTATGAAGG + Intronic
1059569302 9:115417107-115417129 ATTTTTCCTTTGGAGTATGAGGG + Intergenic
1186129307 X:6449068-6449090 ATTATCCCATATAAGTATGAGGG - Intergenic
1186947275 X:14582678-14582700 AGTTTCCCGTTTTAAAATTAAGG - Intronic
1187239185 X:17496930-17496952 GTTTTCCCATTTTAGTTTAAGGG - Intronic
1188261190 X:28026135-28026157 ATTATCTCGTTTTGGTATCAAGG + Intergenic
1188814127 X:34690089-34690111 TTTTTCTGGTTTTAGTATCAGGG + Intergenic
1189386040 X:40537695-40537717 ATTTTTCCTTTTTATTATAAAGG - Intergenic
1190721303 X:53151016-53151038 ATGTTTCCGTTTAAGTCTGAAGG + Intergenic
1191624307 X:63253144-63253166 ATTTTCCCTTTTTTTTTTGAAGG - Intergenic
1191975502 X:66866779-66866801 ATTTTGCCCTTGTAGTATGAAGG - Intergenic
1192198047 X:69045092-69045114 ATTGTCCAGTTTTGGTATCAAGG + Intergenic
1192956572 X:76076785-76076807 ATTTTCTCATTTCAGTATGTGGG - Intergenic
1193296246 X:79834819-79834841 CTTTTCTGGTTTTAGTATCAGGG - Intergenic
1194534582 X:95090055-95090077 TTTTTCTGGTTTTAGTATTAGGG - Intergenic
1194758941 X:97770990-97771012 ATTTTACCGAGTTAGTATGAAGG + Intergenic
1196500259 X:116372679-116372701 ACTTTACAGTTTTATTATGATGG + Intergenic
1197382356 X:125760568-125760590 TTTTTCCGGTTTTGGTATCAGGG + Intergenic
1197968224 X:132087714-132087736 TTTGTCCCGTTTTGGTATCAGGG - Intronic
1198295789 X:135285020-135285042 AATTTCCCATTTTAGTTTCAAGG + Intronic
1199170668 X:144731599-144731621 ATTTTTCCCATTTAGAATGAAGG - Intergenic
1199251758 X:145671520-145671542 CTTGTCTGGTTTTAGTATGAAGG + Intergenic
1199490373 X:148391839-148391861 CTTTTCCTTATTTAGTATGATGG - Intergenic
1200595396 Y:5134454-5134476 TTTTTCCCCATTTAGTATGATGG + Intronic