ID: 950243127

View in Genome Browser
Species Human (GRCh38)
Location 3:11389560-11389582
Sequence CGGGAAAATACCGCCTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950243125_950243127 -9 Left 950243125 3:11389546-11389568 CCATCATACTAAAACGGGAAAAT 0: 1
1: 0
2: 0
3: 19
4: 228
Right 950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950243127 Original CRISPR CGGGAAAATACCGCCTGTGT GGG Intronic
900829139 1:4951671-4951693 CAGGAAAATGCAGCATGTGTTGG + Intergenic
906677792 1:47705774-47705796 GGGGAAAAAATTGCCTGTGTTGG - Intergenic
906968851 1:50489162-50489184 AGGGAATATACAGCCTGTCTAGG - Intronic
909879166 1:80850773-80850795 GAGGAAAATAACTCCTGTGTTGG - Intergenic
920730347 1:208477536-208477558 CAGGAAAATACCACCTGGCTGGG - Intergenic
1078853483 11:15186592-15186614 TGGGAAAATACCTCCTAAGTGGG - Intronic
1084088888 11:66867450-66867472 CGGGGAAATCCTGCCAGTGTAGG - Intronic
1092644446 12:10554450-10554472 CGTGAAAATAACGACAGTGTTGG + Intergenic
1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG + Intergenic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1144721584 17:17474668-17474690 CAGAAAAATACTGCCTGTGCTGG - Intergenic
1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG + Exonic
926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG + Intergenic
945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG + Intronic
1173321770 20:41993800-41993822 CTGGAAAATGCAGCCTGTATGGG + Intergenic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
954882022 3:53843017-53843039 CTGGAAAATTCCACCTGTGTGGG + Intronic
956435067 3:69227043-69227065 GAGAAAAATACCACCTGTGTTGG + Intronic
960524951 3:118699031-118699053 TGGAAAAATACCACCTGTATGGG - Intergenic
961666790 3:128497738-128497760 TGGAAAAATACAGCCTTTGTCGG - Intergenic
995752726 5:115470787-115470809 AGGGAAAATACTGCCTCTCTGGG - Intergenic
996403744 5:123088091-123088113 TGGGAAAGTACCTCCTGAGTCGG + Intergenic
1002761804 6:208310-208332 TGGGAAAATACCCCCTGGGCAGG + Intergenic
1002872881 6:1183275-1183297 CAGGAAGATACCTACTGTGTTGG + Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1007701074 6:43766999-43767021 AGGGAAACTCTCGCCTGTGTGGG - Intergenic
1009990420 6:70836294-70836316 CAGGCAAAGACAGCCTGTGTAGG + Intronic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1017323619 6:153121225-153121247 TTGGTAAATACAGCCTGTGTGGG - Intronic
1019783557 7:2959111-2959133 TGGGAAATTACAGCGTGTGTGGG - Intronic
1027731901 7:81885028-81885050 CAGGAAATTACTACCTGTGTGGG + Intergenic
1037106943 8:15120356-15120378 GGGGAAAATACTACCTGTATAGG - Intronic
1052102484 9:24465951-24465973 CAGTAAAAGACAGCCTGTGTTGG + Intergenic
1189910269 X:45804193-45804215 CTGGAAACTATGGCCTGTGTTGG + Intergenic
1192203515 X:69081896-69081918 TGGGAAACTACCCCCTGTGGTGG + Intergenic
1195073555 X:101304568-101304590 AGGGAATATCCTGCCTGTGTGGG + Intergenic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic