ID: 950243859

View in Genome Browser
Species Human (GRCh38)
Location 3:11396856-11396878
Sequence CTAAGGTTCTTGCATTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 7, 2: 11, 3: 43, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950243859 Original CRISPR CTAAGGTTCTTGCATTGTCT TGG Intronic
900469076 1:2842963-2842985 CTAAAGTACTTGCCTTGTCTTGG - Intergenic
901950077 1:12737739-12737761 CTAAGGTCCTTGAGTTTTCTGGG + Intergenic
902088519 1:13882932-13882954 CTAAGGTCCTTGCATTGTCCAGG - Intergenic
902539846 1:17146597-17146619 CTTAGGTTCTTGCCCTGACTTGG + Intergenic
902981321 1:20125489-20125511 CTAAGGTTTGTGCATTTTCCTGG + Intergenic
903625062 1:24724686-24724708 ATCAGCTCCTTGCATTGTCTTGG - Intergenic
903638276 1:24835653-24835675 CTAAGGTCTTTGCATTATCCTGG + Intronic
907007945 1:50934189-50934211 GTAAGGTTCTTACATTATATGGG - Intronic
907089174 1:51708865-51708887 TTAAGTTTCTTACATTGTTTGGG - Intronic
907315126 1:53564229-53564251 CTAAGGTTCTTGTATTGTTGGGG + Intronic
907690317 1:56658045-56658067 CTAAAGTCCTTGCTTTGTTTGGG + Intronic
909913839 1:81293442-81293464 GTAAGGCTCTTCCATTGCCTTGG - Intergenic
910008333 1:82428606-82428628 TGAAGGTTTTAGCATTGTCTGGG - Intergenic
910097109 1:83535746-83535768 GTAATGTTTTTGCATTGTTTTGG - Intergenic
912232440 1:107810901-107810923 TTAATTTTCTTCCATTGTCTTGG - Intronic
915167437 1:153956221-153956243 CTAAGGCTCTTGAATTGGCAGGG + Intronic
916613930 1:166420436-166420458 CTTAGGTGTTTGCATTGTTTAGG + Intergenic
916821902 1:168407653-168407675 CTAAGGTCTTTACATTGTCTAGG + Intergenic
917390044 1:174526146-174526168 CTGAGTTTCTTGCATATTCTGGG + Intronic
918578797 1:186099905-186099927 TTAAGATTCTTCCATTGCCTTGG - Intronic
920121098 1:203659052-203659074 CTAAGGTCCTTATATTTTCTAGG + Intronic
922374580 1:224948805-224948827 TTAAGATACTTGCATTTTCTGGG - Intronic
922816897 1:228455739-228455761 TTAAGGTTTTTGCAGGGTCTGGG - Intergenic
923067761 1:230535477-230535499 CTAAGGTCTTTGCATTGTCCAGG + Intergenic
923993229 1:239463287-239463309 CTAATTTTCATGCATTTTCTTGG + Intronic
924301224 1:242640110-242640132 CTTATGTACTTGCATTGTCTTGG - Intergenic
924542309 1:244992908-244992930 CTAAGGGTCTCTCATAGTCTGGG + Intronic
1063625853 10:7689350-7689372 CCAAGATTCTTGCAATTTCTGGG + Intergenic
1068489203 10:57700765-57700787 CTAAAGTTCTGAGATTGTCTGGG + Intergenic
1070050076 10:72880125-72880147 CTAATATTCCTTCATTGTCTGGG + Intronic
1072057316 10:91772827-91772849 CTAAAGTACTAGCATTGTCAGGG - Intergenic
1073695573 10:105862912-105862934 ATGAGGTTCTGGCATTGTCCAGG + Intergenic
1075787681 10:125061154-125061176 CTAAGGCCCTGGCATTGTCTAGG + Intronic
1078863292 11:15273206-15273228 CTAAGATCCTTGCAATGTTTGGG - Intergenic
1079433541 11:20421362-20421384 TTAATGTCCTTGCATTGTCTGGG - Intronic
1080325427 11:31066525-31066547 CTAAGGTACTTACATTGTTCTGG + Intronic
1080594724 11:33761043-33761065 CTAAAGTTCTTTCATTGTCCAGG + Intronic
1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG + Intergenic
1082192855 11:49268031-49268053 CTGCAGTGCTTGCATTGTCTGGG + Intergenic
1085084527 11:73657882-73657904 CTGAGCCTCTTGCATTGTCTTGG + Intronic
1085687978 11:78641997-78642019 CTAAGTTTGTTGCATCTTCTTGG + Intergenic
1086268732 11:85034023-85034045 CCATGGTTCTTGCATTTTCCTGG - Intronic
1086673277 11:89573061-89573083 CTGCAGTGCTTGCATTGTCTGGG - Intergenic
1087878263 11:103384663-103384685 CTAAGCTTCTTGAACTGTCTGGG - Intronic
1087979044 11:104587911-104587933 GTAAGGTCCTTGCATTGTCCAGG + Intergenic
1088252806 11:107876190-107876212 CTAAGGTTCTTGCATTGTTTGGG - Intronic
1091906348 12:4192529-4192551 CTAATGTTCCTGCAGTGACTTGG - Intergenic
1092152852 12:6263004-6263026 CTAAGGTGCTTAAGTTGTCTGGG - Intergenic
1093225057 12:16472929-16472951 CTTAGCTTCTTGCATTTTGTAGG + Intronic
1093550642 12:20406144-20406166 CTTAGGTTGTTTCAATGTCTTGG + Intronic
1095381530 12:41599974-41599996 CTAAGTTCCTTTCATTGTTTGGG - Intergenic
1097699482 12:62805424-62805446 CTAAGGTTGTTTCAGTGTCTTGG - Intronic
1098288096 12:68929001-68929023 TTAAGAATCTTGCATTGACTGGG - Intronic
1098971115 12:76857921-76857943 CAAAGAATGTTGCATTGTCTGGG - Intergenic
1099636022 12:85212635-85212657 CTATGATTCTTGTATTCTCTAGG + Intronic
1099694190 12:85997479-85997501 TGAAGGTACTTGCCTTGTCTCGG - Intronic
1102090778 12:110185521-110185543 TTTAGGTTCTTGCATTGCCCAGG - Intronic
1105208608 13:18243840-18243862 CCAAGGTTCTTGTACTGACTAGG + Intergenic
1107218425 13:37949968-37949990 CTGATGTGCTTGAATTGTCTTGG + Intergenic
1107556631 13:41521251-41521273 AAAAGGATCTTGCATTTTCTTGG - Intergenic
1107714224 13:43183301-43183323 TTAAAGTCCTTACATTGTCTGGG - Intergenic
1107797754 13:44070969-44070991 CCAAAGTCCTTTCATTGTCTGGG + Intergenic
1108433537 13:50379203-50379225 CTAAAATTCTTGCTTTGGCTGGG - Intronic
1108798374 13:54061979-54062001 CTGTGGTTCTTGCTTTGCCTTGG + Intergenic
1109002850 13:56828608-56828630 CTAGGGTTCTTGAATGTTCTAGG - Intergenic
1109315529 13:60744767-60744789 GGAAGGGACTTGCATTGTCTTGG + Intergenic
1109989577 13:70036974-70036996 CTAAGGTTCTTCTCTGGTCTGGG - Intronic
1111073147 13:83196554-83196576 AAAATGTTCTTGCATTCTCTAGG + Intergenic
1111740836 13:92204360-92204382 CTAAGACCCTTGCAATGTCTGGG + Intronic
1111752458 13:92350835-92350857 CTAAACTTTTTGAATTGTCTTGG - Intronic
1114685315 14:24525260-24525282 CTAATGTTCTTGAATTCTCCAGG - Intergenic
1115681729 14:35746799-35746821 CTAAGGTCCTTGTATTGATTAGG + Intronic
1117091176 14:52252346-52252368 TTAAGGTTTTAGCATTGCCTAGG - Intergenic
1117335827 14:54756494-54756516 CTAAGGTGCTTGCAGTTTCTGGG - Intronic
1118068817 14:62222979-62223001 CTGAGGTTCTTTCCTTGGCTTGG + Intergenic
1118567327 14:67156412-67156434 TTAAGGTTCTTGTATTGTCTGGG + Intronic
1119116796 14:72030045-72030067 CTAAGATCTTCGCATTGTCTGGG + Intronic
1119421303 14:74509411-74509433 GTGAGGTTCCTGCATTGCCTGGG - Intronic
1120698495 14:87671335-87671357 CTAAGGTTCCTGGTTTGCCTGGG - Intergenic
1123662896 15:22580796-22580818 CTAAGGTCTTTGCATTGTTTAGG - Intergenic
1124261389 15:28195126-28195148 CTAAGGTTTTTGCATTGTTTAGG + Intronic
1124316697 15:28675100-28675122 CTAAGGTCTTTGCATTGTTTAGG - Intergenic
1125005794 15:34815326-34815348 CAAAGGTGCTGGCATTCTCTGGG + Intergenic
1125113866 15:36065813-36065835 TTAAGGTTCCTGCATTATCTGGG + Intergenic
1126237641 15:46404698-46404720 CTATGGGTCCTGCTTTGTCTGGG - Intergenic
1127364412 15:58273842-58273864 CTAAGTTTCTTGCATTGCTTGGG + Intronic
1129662947 15:77563297-77563319 CTAAGGTTCTTGCATTCTTGAGG + Intergenic
1130290951 15:82600601-82600623 GTAAGGTCCTTGCATTTTCTAGG + Intronic
1130620655 15:85459048-85459070 CTAAAGTTCATGCAAAGTCTTGG - Intronic
1130862120 15:87900385-87900407 CTAAGGTTCCTGGTTTATCTTGG - Intronic
1131289140 15:91090041-91090063 GCAAGGTTTTTGCATTGTTTGGG + Intergenic
1132124995 15:99215343-99215365 CAAAGGTCCTTGCATTGTTCAGG + Intronic
1133586952 16:7204905-7204927 CTATGTCTCTTGCACTGTCTGGG + Intronic
1135483333 16:22841556-22841578 CTAAGGTTCTTGTATTATTTGGG - Intronic
1137465091 16:48700473-48700495 CCAAGGTTCCTGAAGTGTCTGGG - Intergenic
1140766316 16:78161863-78161885 CTAAGGTTCTTGTCTTCTCCAGG - Intronic
1141051796 16:80772415-80772437 CTAAGGTCTCTGAATTGTCTGGG + Intronic
1141119213 16:81338230-81338252 TTAAGGTTGCTGCATTTTCTAGG + Intronic
1143394622 17:6582837-6582859 CTAAGGTTCTTGCATTGTATGGG - Intronic
1143543949 17:7585613-7585635 ACCAGGGTCTTGCATTGTCTTGG - Intronic
1143572540 17:7769037-7769059 CTCTGCTTCTTGCACTGTCTCGG + Intronic
1147476964 17:40721509-40721531 CTAGGGCTCTGACATTGTCTAGG + Intergenic
1149019376 17:51945500-51945522 CTGAGGCTCTTGCATTATGTGGG + Intronic
1149234002 17:54569882-54569904 ATAAGGGACTTGCCTTGTCTTGG - Intergenic
1149481641 17:57008183-57008205 CTAAGGTTCTTGCTTTCCATGGG - Intergenic
1152027427 17:77820666-77820688 CCAAAGTTCTGGCCTTGTCTGGG + Intergenic
1155668874 18:28345277-28345299 CTGTGCATCTTGCATTGTCTTGG - Intergenic
1156838034 18:41579051-41579073 CTAAGGTCTTTGCACTTTCTGGG + Intergenic
1157215314 18:45777958-45777980 CTAAGGTCCTTGCATTGTCTGGG - Intergenic
1157690260 18:49676003-49676025 CTAAGGTTTTGGAACTGTCTTGG + Intergenic
1158902558 18:61979502-61979524 GTAAGGTCTTTGCATTGTCCAGG - Intergenic
1159572356 18:70131424-70131446 CTAAGGTCCTTGCATTGTCTGGG + Intronic
1160098213 18:75895689-75895711 CTAAGATTTTTGAATTGTATTGG - Intergenic
1162345938 19:10118217-10118239 CTGGGGTGCTTGCACTGTCTTGG - Intronic
1164631317 19:29763501-29763523 TTAAGAATCTTGCATTCTCTGGG - Intergenic
1164773687 19:30833858-30833880 CTTGGCTTCTTCCATTGTCTAGG + Intergenic
1166920230 19:46224146-46224168 CTCAAGTTGTTGCATTCTCTGGG + Intergenic
1168137862 19:54363527-54363549 CTCAGGTTCTTGCCAGGTCTTGG - Intronic
924996141 2:363754-363776 TTAAGGTTCTGACATTTTCTTGG - Intergenic
926439710 2:12875163-12875185 TTAAGGAACTTGCATTATCTAGG + Intergenic
926764589 2:16313186-16313208 TTATGGTTCTTTCATTGTGTTGG + Intergenic
926997350 2:18750790-18750812 CTAAGTTGCTTCAATTGTCTGGG + Intergenic
927252136 2:21005872-21005894 CTAAGGATCCTGCAATGTCAAGG + Exonic
927659544 2:24981205-24981227 CTAAGGTTCTTACATTGCTTAGG - Intergenic
928842866 2:35632006-35632028 CTGAAATTCTTGCATTGTGTAGG - Intergenic
929548079 2:42869489-42869511 CTAAGGTTCTTGCATTATCCAGG + Intergenic
930412492 2:51043188-51043210 TAAAAGTTCTTGCATTGTCCTGG - Intergenic
931302220 2:60991424-60991446 CCAAGGTCTTTGCATTCTCTGGG + Intronic
931792294 2:65674785-65674807 CTAAGGTCCTTGAATTGCTTGGG - Intergenic
932065262 2:68550765-68550787 GTAAGGTTCTTGCACTGTTTGGG - Intronic
932912177 2:75817782-75817804 CAAAGGGACTTGCCTTGTCTCGG - Intergenic
935113826 2:100116601-100116623 CTAAGGTCCTTGAATTTTCCTGG - Intronic
935456391 2:103272753-103272775 TTAAGCCTCTTGCTTTGTCTGGG - Intergenic
935586738 2:104807215-104807237 ATAAGATTCTGCCATTGTCTCGG - Intergenic
936097355 2:109541203-109541225 CTCAGGTTCTTGCATTAACTGGG - Intergenic
941812068 2:169765148-169765170 TTAAGGTTCTAGCATTGTCAGGG + Intronic
942425925 2:175860570-175860592 CTAAAGTTCTTGTATTGTTTGGG + Intergenic
944440166 2:199734788-199734810 CTGGAGTTCTTTCATTGTCTGGG - Intergenic
946004780 2:216514552-216514574 CGAAGGTTCTTGCATTGTTCTGG + Intronic
1169168602 20:3445275-3445297 CTAAGGTCCTTGCATTGCCCAGG + Intergenic
1169512957 20:6284676-6284698 CTAAGGTCCTGGCATTGTCTGGG + Intergenic
1173949809 20:46982034-46982056 TTAAGGACCTTGCATTTTCTTGG - Intronic
1175590538 20:60187394-60187416 CTAGGGTAATTGAATTGTCTGGG - Intergenic
1176087159 20:63303165-63303187 CTAAGGTCCTAGCGTTGCCTGGG - Intronic
1178290149 21:31360384-31360406 CTAATGTCCTTGTATTATCTAGG + Intronic
1178290152 21:31360411-31360433 CTAATGTCCTTGTATTATCTAGG + Intronic
1179216426 21:39370956-39370978 CTAAGATTCCTGCATTTGCTAGG - Intergenic
1179935081 21:44598627-44598649 CTAAGGTTTCAGCATTGTTTTGG - Intronic
1180058201 21:45370528-45370550 CAAAGGTCCTGGCGTTGTCTGGG - Intergenic
1180767654 22:18355495-18355517 CCAAGGTTCTTGTACTGACTAGG - Intergenic
1180778652 22:18506895-18506917 CCAAGGTTCTTGTACTGACTAGG + Intergenic
1180811378 22:18764203-18764225 CCAAGGTTCTTGTACTGACTAGG + Intergenic
1181197529 22:21198457-21198479 CCAAGGTTCTTGTACTGACTAGG + Intergenic
1181704218 22:24638724-24638746 CCAAGGTTCTTGTACTGACTAGG - Intergenic
1182813591 22:33138394-33138416 ATAAGGGACTTGCCTTGTCTCGG + Intergenic
1183042014 22:35188415-35188437 CTAAGGCTCTTGCTTTGTTCAGG + Intergenic
1183595760 22:38809512-38809534 CTAATGTCCTTACATTGTCCTGG - Intergenic
1203229270 22_KI270731v1_random:96378-96400 CCAAGGTTCTTGTACTGACTAGG - Intergenic
950243859 3:11396856-11396878 CTAAGGTTCTTGCATTGTCTTGG + Intronic
953999604 3:47545386-47545408 CTAAGGTTCTTTAATTGCCTGGG + Intergenic
955066857 3:55540898-55540920 CTGAGGGTCTTGCAGTGACTGGG - Intronic
955462675 3:59201711-59201733 CTAAAGTTACTGCATTGTCCAGG - Intergenic
959523916 3:107354500-107354522 CGAAGGTTCTTGAACTGTCTTGG - Intergenic
959904729 3:111698758-111698780 CTGAGGTTCCTGGCTTGTCTGGG - Intronic
960633403 3:119756637-119756659 CTAAGGCACTTGCATTGTTTAGG + Intronic
960918884 3:122726019-122726041 CAAAGGTCTTTGCATTGTCTGGG - Intronic
962024168 3:131529484-131529506 CTTAGGATCTTGGATTGTCTGGG + Intergenic
962459956 3:135601872-135601894 CTAAGGTCCTTGCATTATTTTGG + Intergenic
963827938 3:149974939-149974961 CTAAGGTTTTTGGATTGTCTAGG - Intronic
964339990 3:155698246-155698268 CTAAAGTTCTTTCATTTTTTTGG - Intronic
964471176 3:157057424-157057446 CTATGGTTCCTGCATTGCTTGGG - Intergenic
964960781 3:162422562-162422584 TTCAGGTTCTTGTATTTTCTGGG - Intergenic
965434942 3:168638673-168638695 GTAAGGTTCTAGCATTATATGGG + Intergenic
976005415 4:80423996-80424018 CTAAAGTTCTTGGACAGTCTGGG - Intronic
976979424 4:91208101-91208123 CTAAGTTTCTTGCAGATTCTGGG + Intronic
978387650 4:108192029-108192051 CTGAGGCTCTTTCATAGTCTGGG - Intergenic
979155389 4:117381442-117381464 CTTATGTTCCTGCATGGTCTGGG + Intergenic
980447171 4:132924430-132924452 CTAAGTTTCATGGATTGTCTAGG + Intergenic
982386997 4:154817980-154818002 CTAAGTTCCTTGTATTATCTAGG - Intronic
983122212 4:163900425-163900447 ATAAGGATTTTGCATTTTCTGGG - Intronic
984176221 4:176420704-176420726 CTAAGGTTGTTTCTATGTCTTGG - Intergenic
984863341 4:184258612-184258634 CACAGGTTCTTGGATTGCCTGGG + Intergenic
988026782 5:25704413-25704435 CTAATTTTCTTTCATTGTGTTGG + Intergenic
988295228 5:29350139-29350161 CTAGGACCCTTGCATTGTCTAGG + Intergenic
990027348 5:51210345-51210367 CTAAGTTCTTTGCATTGTCTGGG - Intergenic
990686524 5:58308981-58309003 CTAAGGGCCTTGCACTCTCTAGG - Intergenic
991350023 5:65711541-65711563 CTGTGGTTCTTTCATTGTCTGGG - Intronic
992983990 5:82208529-82208551 CTTAGCTTCTTGTTTTGTCTAGG + Intronic
994338049 5:98592152-98592174 CCAAGGCTCTTGCTTTGTCCAGG + Intergenic
997463012 5:134067800-134067822 CTAAGGTTCTTTTGTTGTTTTGG - Intergenic
997641882 5:135454744-135454766 CCAAGGTCCTTGCATTGTCCAGG + Intergenic
998893063 5:146767474-146767496 CAAAGCTTCTTGCCTTGTGTTGG - Intronic
999481537 5:151952871-151952893 ACAAGGTTCATGCATTGTATTGG + Intergenic
1000167128 5:158661545-158661567 TTAAGATTCTCTCATTGTCTTGG - Intergenic
1000498533 5:162018208-162018230 GTAAGTTTCTTACATTCTCTGGG - Intergenic
1001302456 5:170544796-170544818 GTAAAGTTCTTGCATTGTTCAGG - Intronic
1002545009 5:179935863-179935885 CTAACATGCTTGCATTGTCCAGG - Intronic
1002665289 5:180818894-180818916 CCAAGTTTCTAACATTGTCTTGG - Intergenic
1003001126 6:2334780-2334802 CTGAGGTCCATTCATTGTCTAGG + Intergenic
1003056903 6:2829456-2829478 CTAAAGTCCTTGCATTGTCTGGG - Intergenic
1003056930 6:2829918-2829940 CTAAGGTCCTTGCATTGTCTGGG - Intergenic
1005217640 6:23550394-23550416 CTAAGATTCTTTCATTATTTTGG + Intergenic
1008760498 6:54847037-54847059 CTACGTTTCTTTCATTGTCGTGG + Intronic
1010747083 6:79576080-79576102 TTAAGGTCCTTGCATTGTTTAGG - Intergenic
1010810330 6:80292722-80292744 GTAAGGGACTTGCCTTGTCTTGG - Intronic
1011184314 6:84657447-84657469 CGAAGGGTCTGGAATTGTCTTGG - Intergenic
1011652005 6:89515396-89515418 CTTAGGTTCTTGCAAGGACTTGG + Intronic
1012646725 6:101693459-101693481 CTTAGGTTTGTTCATTGTCTGGG + Intronic
1013335186 6:109151147-109151169 CTAATATCCTTGCATTTTCTTGG + Intronic
1015778555 6:136839851-136839873 CTGGGGTCCTTGCACTGTCTGGG + Intronic
1015810074 6:137153654-137153676 ATGAGGTTCTTATATTGTCTAGG + Intronic
1016950504 6:149574919-149574941 CTAAGGTTCTTGCATTGTTTGGG - Intronic
1020714971 7:11661896-11661918 TTAAGGTCCTTGCATTTTCTAGG + Intronic
1022135312 7:27441964-27441986 GTAAGGTTCTTGCACTGTAAAGG + Intergenic
1023531448 7:41160205-41160227 CTTATCTTATTGCATTGTCTAGG - Intergenic
1023536013 7:41211798-41211820 CTAAGGTCCTTGCATATACTTGG - Intergenic
1024384852 7:48739325-48739347 ATAAGGGACTTGCCTTGTCTTGG + Intergenic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026080006 7:67209390-67209412 CAAAGCTTCTTGGATTGTCATGG - Intronic
1027714786 7:81656448-81656470 CTAGAGCCCTTGCATTGTCTTGG + Intergenic
1027762172 7:82293244-82293266 TTCAGTTTCCTGCATTGTCTCGG + Intronic
1028089500 7:86680690-86680712 ATACAGTTCTTGCACTGTCTGGG - Intronic
1029911491 7:104154603-104154625 CTATGTTTCAGGCATTGTCTTGG - Intronic
1031013205 7:116545439-116545461 CTAGGGTTCTTGCAAAATCTAGG - Intronic
1031095032 7:117406844-117406866 CTAAGATTCCTGCATTGTCCAGG + Intronic
1031807978 7:126329911-126329933 AGAAGGTACTTGCCTTGTCTTGG + Intergenic
1032593564 7:133215965-133215987 TTAAGGTTATGGCATTTTCTCGG + Intergenic
1032963137 7:137063759-137063781 CTTAGGTTCTTACAATATCTTGG - Intergenic
1033105774 7:138521354-138521376 CTAAGGTCCATGCATAGTCTAGG + Intronic
1034214012 7:149389617-149389639 TTAAGGTTCTTGCAGTTTCATGG + Intergenic
1034645811 7:152646208-152646230 CTAAGGTCCTTGCATTGTCCGGG - Intronic
1036196318 8:6718894-6718916 CTAAGGTACTTGCTGTGTTTAGG - Intronic
1037998698 8:23371841-23371863 TTGAGGTTCTTGTGTTGTCTGGG + Intronic
1038654836 8:29440040-29440062 CTAAGGTCATTGCATTGTCTGGG + Intergenic
1039098983 8:33920569-33920591 GTAAGGTTCAGGCATTGCCTTGG - Intergenic
1039450308 8:37668457-37668479 GTGAGTTTCTTGCATTGTCCAGG + Intergenic
1040966144 8:53082807-53082829 GAAAGGTGCTTGCCTTGTCTTGG + Intergenic
1041843487 8:62298938-62298960 ATAGGGATCTTGCATTGTATTGG - Intronic
1042097895 8:65238590-65238612 CTCAGGTTCTTGCAGTTTGTTGG - Intergenic
1043140758 8:76586989-76587011 CTAAGGATTTTGGAATGTCTAGG - Intergenic
1043754147 8:83981397-83981419 TTAAAGTCCTTGCATTGTCAAGG + Intergenic
1044072886 8:87784613-87784635 TGAAGGATCTTGCTTTGTCTTGG - Intergenic
1044302416 8:90600725-90600747 CTAAGGATGTTGCTTTTTCTGGG - Intergenic
1044991014 8:97795892-97795914 CTAAGGTCCTTGCATTGTCTAGG - Intronic
1045355192 8:101380842-101380864 CTAAGGTTCTTGCATTACCTTGG - Intergenic
1045526905 8:102948755-102948777 GTAAGGTTCTTGTCCTGTCTGGG - Intronic
1045848999 8:106671458-106671480 TTAACATCCTTGCATTGTCTGGG + Intronic
1047428729 8:124771831-124771853 CGTAGGTCCTTGCATTTTCTGGG - Intergenic
1051002370 9:12299607-12299629 CTAAGCTTCATGCATTGTGAAGG - Intergenic
1052000122 9:23268559-23268581 CTATGGTGGTTGCATTTTCTAGG + Intergenic
1052000612 9:23275032-23275054 GTAAGGTTTTTGCTTTGTTTAGG - Intergenic
1052637027 9:31119797-31119819 CTAAGGTTGTTGGCTTGTCAGGG + Intergenic
1052814889 9:33094524-33094546 CCAAGGTTCTTGCACTATCCTGG + Intergenic
1052906422 9:33838674-33838696 GTACGGTTCTTGCATTTCCTGGG - Intronic
1053400233 9:37812953-37812975 CTAAGGTTCTTGCATCATCCAGG + Intronic
1053616148 9:39768546-39768568 GTAAGGATCTTGCATTCTTTGGG + Intergenic
1053874319 9:42527847-42527869 GTAAGGATCTTGCATTCTTTGGG + Intergenic
1053898296 9:42766741-42766763 GTAAGGATCTTGCATTCTTTGGG - Intergenic
1054237369 9:62573844-62573866 GTAAGGATCTTGCATTCTTTGGG - Intergenic
1054268016 9:62938907-62938929 GTAAGGATCTTGCATTCTTTGGG - Intergenic
1054551504 9:66608355-66608377 GTAAGGATCTTGCATTCTTTGGG - Intergenic
1055015270 9:71610137-71610159 CTAAGTTTGTTGCATTATCCTGG + Intergenic
1055644655 9:78351528-78351550 TTAAGGTTGTTGCATTGTTCTGG + Intergenic
1057080408 9:92170773-92170795 CTAGGGTTCTTGCATATACTTGG - Intergenic
1057391137 9:94642326-94642348 CTCAGGATCTTGGATTGGCTAGG + Intergenic
1059187949 9:112293866-112293888 CTTAGTTTCTTGAATTGTGTTGG - Intronic
1060201669 9:121655044-121655066 CTTAGGTTCTTCCCTTTTCTGGG + Intronic
1060913876 9:127372775-127372797 CTCTGTTTCTTGCATTATCTGGG - Intronic
1187609494 X:20926425-20926447 CTAAGGTCCTTACATTATTTGGG + Intergenic
1187925468 X:24245737-24245759 CTAGAGTCCTTGCATTGTCTGGG - Intergenic
1188767587 X:34115031-34115053 ATAAGGTGCTTGCATTACCTAGG - Intergenic
1189109491 X:38273040-38273062 CTAAGGTCCTGGCATTATTTGGG + Intronic
1189230596 X:39449769-39449791 CTATGGTTCTGGGATTGGCTGGG + Intergenic
1189629518 X:42937545-42937567 CAAAGGTCCTTGAATTTTCTGGG - Intergenic
1192047381 X:67690153-67690175 CTCAGGTTCTCACATGGTCTAGG - Intronic
1192986990 X:76410215-76410237 CTAAGATCCTTGCAATATCTAGG + Intergenic
1193883074 X:86949924-86949946 CTAAGTTCTTTGCATTGTTTAGG + Intergenic
1194211553 X:91076210-91076232 TTAAAGTCCTTACATTGTCTGGG + Intergenic
1194399091 X:93421049-93421071 TCAACGTTCTTGCACTGTCTTGG - Intergenic
1195873067 X:109506503-109506525 CTATGGTCCTTGTATTGTTTGGG + Intergenic
1197955427 X:131941737-131941759 CTAAGGTCCTTATATTGTCCAGG - Intergenic