ID: 950244342

View in Genome Browser
Species Human (GRCh38)
Location 3:11401999-11402021
Sequence TGTTAAGTGTACAACTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950244342 Original CRISPR TGTTAAGTGTACAACTTGGT GGG Intronic
901478575 1:9507876-9507898 TTTAAAGTGTACAGCTGGGTTGG + Intergenic
904473382 1:30749431-30749453 TCTTAAGTGCACACCTTGGTGGG - Intronic
907037943 1:51233277-51233299 TGTTAAGTTTAAAACTAGCTTGG - Intergenic
908489694 1:64631092-64631114 TGTTAAATGTACAAACTGGGGGG - Intronic
911008816 1:93256664-93256686 TTTTAAGTGTATAATTCGGTGGG - Intronic
911441735 1:97935196-97935218 TGTTAAGTGTGCATTCTGGTTGG + Intergenic
913302894 1:117391632-117391654 TGTTAACTGTACAGTTAGGTGGG + Intronic
916898723 1:169196755-169196777 TGTTATGTGAGCAGCTTGGTAGG - Intronic
918991574 1:191703392-191703414 TTTTAAGTGTACAATTCAGTAGG - Intergenic
919588163 1:199464996-199465018 TGTTAAGGGAAGAACGTGGTGGG - Intergenic
919823996 1:201490879-201490901 TATTAAGTGCCCAACATGGTGGG + Intronic
920405066 1:205702991-205703013 TGTTAAGTGGACAGTTTTGTGGG - Intergenic
920798911 1:209168938-209168960 TTTAAAGTGTACAATTTAGTAGG - Intergenic
922370221 1:224902594-224902616 TATCAAGTGTTCAAATTGGTAGG - Intronic
923670295 1:236034753-236034775 TTTAAAGTATACAATTTGGTGGG - Intronic
923680944 1:236118131-236118153 TTTTAAGTGTACAATTCAGTGGG + Intergenic
1063792423 10:9467941-9467963 TTTAAAGTGTAAAACTTAGTTGG - Intergenic
1065251041 10:23814309-23814331 TGTTAAGTGTCCCACATTGTAGG - Intronic
1068291968 10:55015183-55015205 TTTTAAGTGTAAAATGTGGTGGG - Intronic
1068639369 10:59385365-59385387 TGTTAAGTGGAAAAAATGGTGGG - Intergenic
1068775535 10:60864177-60864199 TCTTAAGTGAACCACTTGCTTGG + Intergenic
1069506950 10:69007989-69008011 TGTTGACTTTAAAACTTGGTGGG + Intronic
1069619911 10:69830769-69830791 TTTAAAGTGTACAATTTGATGGG + Intronic
1070747349 10:78942184-78942206 TTTTCAGTACACAACTTGGTGGG - Intergenic
1071811544 10:89187225-89187247 TGTTCAGTGTACAACCTGCATGG + Intergenic
1074880930 10:117657917-117657939 TGTTAATTGTAGAACATGGGTGG - Intergenic
1076437841 10:130458946-130458968 TTTAATGTGTACAACTTGATGGG - Intergenic
1077583489 11:3433080-3433102 TTTAAAGTGTACAATTTGGCCGG + Intergenic
1078766023 11:14299393-14299415 TCTTAAGTGTACAGCCTGATGGG - Intronic
1079465555 11:20726340-20726362 TTATAAGTTTACAACTTGCTGGG + Intronic
1080969397 11:37253030-37253052 TATTAAGTGCACAATTTGATGGG - Intergenic
1084240410 11:67815893-67815915 TTTGAAGTGTACAATTTGGCTGG + Intergenic
1087125042 11:94616884-94616906 TGTTAAGTGTAGACCTAGGAGGG + Intronic
1089128955 11:116197531-116197553 TGTTAAGTGTAAAAGTTAGGTGG + Intergenic
1092114290 12:5987937-5987959 TTTAAAGTGTACAATTTGATAGG - Intronic
1095755778 12:45765717-45765739 TATAAAGTATACAATTTGGTAGG + Intronic
1095812501 12:46384984-46385006 TATTAAGTTTACATTTTGGTGGG + Intergenic
1097538560 12:60905690-60905712 TTTGAAGTGTACAACATGTTTGG + Intergenic
1097911169 12:64970956-64970978 TGTTAAATGTACAACTATTTGGG - Intergenic
1099067642 12:78003706-78003728 TATTAATTTTAGAACTTGGTTGG + Intronic
1099734167 12:86546439-86546461 TGGTAGGTGAAAAACTTGGTAGG + Intronic
1100425594 12:94482633-94482655 TGTTAAGTATACAAATTGTTGGG - Intergenic
1100432205 12:94540943-94540965 TGTTAAGTTTGCTAGTTGGTGGG - Intergenic
1101271406 12:103149534-103149556 TGTTAAGTGAGACACTTGGTGGG + Intergenic
1102825733 12:115946531-115946553 TTTTAAGTGTACAACTCAGTAGG - Intergenic
1106163783 13:27224175-27224197 TTTTAAGTGTACAATTCAGTGGG - Intergenic
1106656052 13:31747349-31747371 TTTTAAGTGAAAAACTTGCTTGG - Intronic
1106945867 13:34827373-34827395 TGTGAAGTTTACAATCTGGTTGG + Intergenic
1107270047 13:38605042-38605064 TGTTAAGTAGACAAATTGTTAGG + Intergenic
1109955309 13:69557877-69557899 TGTTAAGGGAAGAACCTGGTGGG + Intergenic
1110065559 13:71101279-71101301 TATTAAGTGTCAAACTTGATTGG + Intergenic
1111398955 13:87706846-87706868 TTTTAAGTATACAGCTCGGTGGG + Intergenic
1111452263 13:88434837-88434859 TGTTAACTGTACAAATTGACTGG + Intergenic
1112228375 13:97563756-97563778 GGTTAAGTGCACATCCTGGTTGG - Intergenic
1118101880 14:62614895-62614917 TTTTAAGTGAACAGCTCGGTGGG - Intergenic
1120600693 14:86502750-86502772 TTTTATGTGTAGAACTTGCTGGG - Intergenic
1123879471 15:24662929-24662951 TAAGAAGTGTACAACTTAGTTGG + Intergenic
1124064998 15:26334031-26334053 TGTTCAGTGAACATCTTAGTTGG + Intergenic
1126579682 15:50231444-50231466 TTTAAAGTGTACAATTTGCTAGG - Intronic
1128995566 15:72291926-72291948 TGGTGAGAGTACAACCTGGTGGG + Intronic
1130708264 15:86253782-86253804 TTTTAAGTGTACAGTTTGGTAGG + Intronic
1131263100 15:90899630-90899652 TCTTAAGTGTACAGCTTGATGGG - Intergenic
1133351857 16:5106630-5106652 TTTAAAGTGTACAATTTGGCCGG + Intergenic
1134335433 16:13295182-13295204 TATTAAGTGTAAAACTTGAATGG - Intergenic
1134788666 16:16968424-16968446 TTTAAAGTGTACAATTTGATAGG + Intergenic
1134873459 16:17673923-17673945 TTTTAAGTGTACAATTCAGTGGG + Intergenic
1135328037 16:21540014-21540036 TCTAAAGTGTACAACCTGGTTGG + Intergenic
1135486210 16:22867535-22867557 TGTTCATTGCACAACTTGTTAGG - Intronic
1136338390 16:29626038-29626060 TCTAAAGTGTACAACCTGGTTGG + Intergenic
1139910010 16:70391903-70391925 GGTCAAGTGTACACCTTGGCTGG - Intronic
1139946052 16:70643029-70643051 AATAAAGTGTACAACTTTGTGGG - Intronic
1141785383 16:86196498-86196520 TGTGAATTGTACATCATGGTGGG - Intergenic
1142041121 16:87894951-87894973 TCTAAAGTGTACAGCCTGGTTGG + Intronic
1203118332 16_KI270728v1_random:1513936-1513958 TCTTAAGTGATGAACTTGGTGGG - Intergenic
1142892495 17:2953548-2953570 TTTAAAGTGTACAATTTGGCCGG + Intronic
1146544145 17:33723819-33723841 TCTTAAGTGTACTGCTTGATAGG - Intronic
1149546205 17:57505601-57505623 AGAAATGTGTACAACTTGGTAGG + Intronic
1150310493 17:64125086-64125108 TTTAAAGTGTACAATTCGGTGGG - Intronic
1150441615 17:65196269-65196291 TGGAAAGTGTAAAACTTGCTTGG + Intronic
1150815357 17:68388379-68388401 TTTTAATTGTACAACTTAGGGGG - Intronic
1152493162 17:80651582-80651604 TTTAAAGTGTACAACTTGGCTGG + Intronic
1153290558 18:3498211-3498233 TGTTAAGTGTCCATCCAGGTGGG - Exonic
1155804943 18:30157576-30157598 TCTTAAGTGATCAACGTGGTTGG + Intergenic
1156231762 18:35159998-35160020 TTTTAAGTGTGCAAGTTGTTGGG + Intergenic
925983489 2:9196012-9196034 TTTAAAGTGTACAACTTGGCTGG + Intergenic
928572711 2:32625170-32625192 TTTTAACTGTACAATTTGTTAGG - Intergenic
931426025 2:62171949-62171971 TTTTAAGTGTACAATTCGGTGGG + Intergenic
931522526 2:63114815-63114837 TTTTAAGTGTACAGCTTAGTGGG + Intergenic
933984407 2:87578599-87578621 TGATAAGATTACAACTTGGAGGG - Intergenic
935481114 2:103591626-103591648 TGTTAACTGTACAAATTGATTGG + Intergenic
935838752 2:107085102-107085124 TGTTATTTGTATAACTTAGTTGG - Intergenic
936309447 2:111372200-111372222 TGATAAGATTACAACTTGGAGGG + Intergenic
937606404 2:123806581-123806603 TGTTAACTGTACAAATTGATTGG - Intergenic
937896703 2:126981585-126981607 TGTTCAGTGCAGAGCTTGGTGGG - Intergenic
938410221 2:131057570-131057592 TATTAAGTGCTCAACTGGGTGGG - Intronic
939146281 2:138419058-138419080 TTATAAGTTTACAACTTGCTGGG - Intergenic
939625086 2:144467217-144467239 TGTGAATTGTATAACCTGGTAGG + Intronic
940721644 2:157288963-157288985 TGGTATCTGAACAACTTGGTGGG + Intronic
941350696 2:164430672-164430694 TGTTAATTGTATAAATTGCTGGG + Intergenic
941448390 2:165629242-165629264 TGTCAGGAGAACAACTTGGTGGG - Intronic
941701807 2:168611643-168611665 TGTTAAGTGTAAAATTTAGTAGG - Intronic
941850467 2:170174945-170174967 TGTTTAGAGTATAACTTAGTAGG + Intergenic
942941723 2:181626553-181626575 TCTTAAATGGACAACTTGTTTGG - Intronic
947343568 2:229166386-229166408 TGTAAAGTGCACAAGTTGGTAGG - Intronic
1170187308 20:13605286-13605308 TGTAAAGTGTACAATTTGATGGG - Intronic
1170819133 20:19741083-19741105 TGTGAATTTTACAACTTGGGGGG + Intergenic
1172712070 20:36932852-36932874 TTTTAAGTGTACAGTTTAGTAGG - Intronic
1182052618 22:27324764-27324786 TCTTCATTGTACAACTTGTTGGG - Intergenic
950244342 3:11401999-11402021 TGTTAAGTGTACAACTTGGTGGG + Intronic
952769531 3:36985396-36985418 TATTAAGTGTACACCTCAGTGGG - Intergenic
957778896 3:84793025-84793047 TGTTAACTGCACAAGTTGTTCGG + Intergenic
957881285 3:86216423-86216445 TTTTAAGTATGAAACTTGGTAGG - Intergenic
960116703 3:113902069-113902091 TGTAAAGTGTACAATTTAGTGGG - Intronic
961298513 3:125906045-125906067 TTTCAAGTGTACAATTTGGCCGG - Intergenic
961544827 3:127625431-127625453 TTTAAAATGTACAACTTGGCCGG + Intergenic
963878497 3:150502749-150502771 TTTTAAGTGTACAGCTCAGTAGG - Intergenic
963973444 3:151454708-151454730 TTTAAAGTGTACAACTGGCTGGG + Intronic
963996707 3:151717982-151718004 TGTTGAGGGCACAACTTGGTGGG - Intergenic
966207236 3:177417519-177417541 TGTTATTTTTACAACTTGTTAGG - Intergenic
966900345 3:184478942-184478964 TTTTAAGTGTACAATTTGATGGG + Intronic
966963156 3:184961446-184961468 TGTTAACTATAAAATTTGGTTGG - Intronic
967812421 3:193772035-193772057 TTTTAAGTGTCCAACTTGGAGGG - Intergenic
969815218 4:9681966-9681988 TTTAAAGTGTACAATTTGGCCGG - Intergenic
974257165 4:59473100-59473122 TTTAAAGTGTACAAATTAGTGGG - Intergenic
974281601 4:59802203-59802225 TGTTAAGTGTTCTATTTGCTAGG + Intergenic
974717891 4:65694209-65694231 TGTGAAGGGGACAACATGGTAGG - Intergenic
976821122 4:89208158-89208180 TTTTAAGTGTACAGTTTAGTAGG + Intergenic
978435413 4:108678626-108678648 TCCTAAGTGTACAACTCAGTGGG - Intergenic
978618238 4:110615989-110616011 TCTCAAGTGAACAACATGGTGGG + Intergenic
980929816 4:139175077-139175099 TTTAAAGTGTACAGTTTGGTGGG - Intronic
981611230 4:146595915-146595937 TGTAAAGTGTACAATTCAGTGGG - Intergenic
983876359 4:172880605-172880627 TTTTAAGTGTACAGTTTGATAGG - Intronic
986312818 5:6567321-6567343 TTTTAAGTGTACAATTCTGTGGG - Intergenic
986438007 5:7753863-7753885 TCTGAAGTGTAAAAATTGGTAGG - Intronic
991550041 5:67825872-67825894 TGCAAAGTGCACAACTTGGGAGG + Intergenic
992180910 5:74197531-74197553 TGTTATGTGGACAATTTGGAAGG + Intergenic
993002707 5:82397906-82397928 TTTTAAGTGTACAATTTTATGGG - Intergenic
996755307 5:126929046-126929068 TATGATGTGTACAACTTGTTTGG - Intronic
997016790 5:129945558-129945580 TGTTAAGGGTACTACTTTTTGGG + Intronic
998910166 5:146951235-146951257 TTTTAAGTGTACAGTTTGATGGG + Intronic
1001673983 5:173497471-173497493 TGTTAGGTGTCACACTTGGTTGG - Intergenic
1003135796 6:3433957-3433979 TGTTAAGTGTATAGCTTAGTAGG - Intronic
1003440058 6:6132232-6132254 TGTTAATTGTATCAGTTGGTTGG - Intergenic
1004061880 6:12205706-12205728 TGTTAAGTGTACAAAATGAATGG + Intergenic
1005819383 6:29584965-29584987 TGTTTAATAAACAACTTGGTTGG + Intronic
1006255795 6:32830934-32830956 TTTTAAATGTACAATTTGGACGG + Intronic
1006540946 6:34739188-34739210 TCTTAAGTGCACAATTTGATCGG + Intergenic
1006961587 6:37936468-37936490 TGTTCAGAATACCACTTGGTCGG + Intronic
1008087209 6:47257830-47257852 GGTTAAGTGTTCAATTTTGTTGG + Intronic
1008431777 6:51426633-51426655 TTTTAAGTGCTCAACTTGGTGGG + Intergenic
1010167867 6:72938678-72938700 TTTTAAATGTACAATTTGCTGGG - Intronic
1011013690 6:82731031-82731053 TGTTAATTGTACAATTTAGGTGG - Intergenic
1011756635 6:90505906-90505928 TTTAAAGTGTACAATTTGATAGG - Intergenic
1011761569 6:90572632-90572654 TTTGAAGTGTACAATTTGGTGGG - Intronic
1013317101 6:108953580-108953602 TTTAAAGTGTACGATTTGGTGGG - Intronic
1013706085 6:112835812-112835834 TATTAAGTGTATAACTTGCTAGG - Intergenic
1013920992 6:115403163-115403185 TGTTAACTGTACAAATTGATTGG - Intergenic
1014151886 6:118066854-118066876 TTTTAAGTGAATAGCTTGGTTGG - Intronic
1015039230 6:128696951-128696973 TGTAAAGTTTACAATTTAGTTGG + Intergenic
1020036854 7:4969045-4969067 TTTTAAATGTACAATTTGGCCGG + Intergenic
1021090438 7:16476952-16476974 TATTAAGTGTAAAACGTAGTTGG - Intronic
1022579294 7:31532769-31532791 TGTGAAGTGGCCAACTTGCTTGG - Intronic
1025090844 7:56062922-56062944 TGTAATGTGTGCAGCTTGGTTGG + Intronic
1028071840 7:86460288-86460310 TTTTAAGTGTACAGTTTGATGGG - Intergenic
1028444859 7:90910073-90910095 TGTTAAGTGTGCTACTGGGATGG - Intronic
1031100731 7:117477092-117477114 TATTAATTGTGCAACTTGCTTGG + Intronic
1032960627 7:137029395-137029417 TGTTCACTGTATAAATTGGTAGG - Intergenic
1036734304 8:11296425-11296447 TTTTAAGTGTACAGTTTAGTAGG + Intronic
1037338444 8:17814749-17814771 TGTTAAGGGAAGAACCTGGTGGG - Intergenic
1040846417 8:51846569-51846591 TGTTGAGTGGAAAACCTGGTTGG - Intronic
1043842016 8:85117739-85117761 TGTTAAGGGTAGAATCTGGTTGG - Intronic
1043984330 8:86675876-86675898 TGTTAATTATACAATTTTGTTGG - Intronic
1044304245 8:90619393-90619415 TGTTGAGAGTAACACTTGGTAGG - Intergenic
1050177590 9:2884233-2884255 TGTTCAGTGGACAACTCTGTGGG + Intergenic
1051099241 9:13502289-13502311 TTTTAAGTGTACAGTTTGATGGG - Intergenic
1051854190 9:21543912-21543934 TGTTATGGGAAGAACTTGGTGGG + Intergenic
1052680395 9:31684294-31684316 TGTGAAGTGTAGAACTAAGTGGG + Intergenic
1055608465 9:77996270-77996292 TGATAAGTTTAAAACTTGATGGG + Intronic
1058574011 9:106380670-106380692 TGACAACCGTACAACTTGGTTGG + Intergenic
1059545231 9:115169096-115169118 AGGGATGTGTACAACTTGGTAGG + Intronic
1062470231 9:136699907-136699929 TCTAAAGTGTACAATTTGGCCGG + Intergenic
1186985582 X:15010142-15010164 TTTTAAGTGTACAGTTTGGTAGG + Intergenic
1187455955 X:19441450-19441472 TTTAAAGTGTACAAGTCGGTGGG - Intronic
1187961402 X:24569868-24569890 TTTTAAGTGCACAATTTAGTGGG - Intronic
1188575343 X:31642567-31642589 TGTTCAGTGGACAACTTGTATGG - Intronic
1189166054 X:38862285-38862307 TGTTAAGTGAGAAACCTGGTGGG + Intergenic
1189731055 X:44021609-44021631 TGTTGAGTGTACAAAGAGGTTGG + Intergenic
1190976151 X:55403285-55403307 TGATAAGTGCACAATTTGTTTGG + Intergenic
1192800234 X:74458641-74458663 TGTTAAGTGTAAATCTTGCCAGG - Intronic
1193186303 X:78517160-78517182 TTTTATGTGTACAATTTGATGGG + Intergenic
1193777896 X:85666209-85666231 AGATAAATGTACAATTTGGTGGG + Intergenic
1195745050 X:108108648-108108670 TTTTAAGTGTACAATTCAGTAGG + Intronic
1196521646 X:116680847-116680869 TTTAAAGTGTACAATTTAGTGGG + Intergenic
1198410880 X:136366521-136366543 TGTTAAGTGTTCAACTCATTTGG + Intronic
1198715796 X:139556896-139556918 TCTTTATTGTACAACTTGGGTGG + Intronic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1201735754 Y:17259481-17259503 TGATAATTATACAACTTGCTTGG + Intergenic