ID: 950248017

View in Genome Browser
Species Human (GRCh38)
Location 3:11439613-11439635
Sequence CACTAGGACTGCAAGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950248008_950248017 30 Left 950248008 3:11439560-11439582 CCAGGCTTTTAGGAGGCAGACGC 0: 1
1: 0
2: 2
3: 31
4: 1229
Right 950248017 3:11439613-11439635 CACTAGGACTGCAAGGCAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950248017 Original CRISPR CACTAGGACTGCAAGGCAGT GGG Intronic
900742270 1:4337968-4337990 CCCCAGGGCTGCAAGGCTGTTGG + Intergenic
900760404 1:4466719-4466741 CACTGTGTCTGCAGGGCAGTAGG - Intergenic
901216574 1:7558572-7558594 CACTAGGGCTGATGGGCAGTGGG + Intronic
901222880 1:7593796-7593818 CACTAGGAGGCCAAGGCAGGTGG + Intronic
904420175 1:30386140-30386162 CTCTTGGCCTGCAAGGCAGGTGG + Intergenic
904853803 1:33479684-33479706 GACCAGGACTGCAGGACAGTCGG + Exonic
905409406 1:37757937-37757959 CTCTAGGACTGGAAGGGAGGAGG - Intronic
909771771 1:79432047-79432069 CACTATGACTGCAATCCAGGAGG - Intergenic
917555374 1:176081261-176081283 CAGTCGAACTGCAAGCCAGTTGG - Exonic
919032600 1:192262570-192262592 CATGAGTACTGTAAGGCAGTTGG + Intergenic
919325353 1:196100112-196100134 GCCTGGGACTTCAAGGCAGTGGG - Intergenic
920832400 1:209477417-209477439 CACCAGGAGTGCCAGCCAGTTGG - Intergenic
1070660948 10:78304835-78304857 CACCAGGACTGGTGGGCAGTGGG - Intergenic
1074072703 10:110088588-110088610 CACTGCAACTGCAAAGCAGTTGG - Intronic
1074870207 10:117570152-117570174 CACCAGGACTCCAAGCCAGGTGG - Intergenic
1080214587 11:29826828-29826850 CACTGGGACTGATAGGCTGTTGG + Intergenic
1083153800 11:60810296-60810318 CACCCGGACTCCAGGGCAGTGGG - Intergenic
1084566549 11:69931893-69931915 CACTTGGACTTCAAGCCACTTGG - Intergenic
1085005780 11:73088114-73088136 CACTGGGAGGGCAAGGCAGAAGG - Intronic
1087620666 11:100538053-100538075 CAATATGGCTGCAGGGCAGTGGG + Intergenic
1089775431 11:120832232-120832254 CACTGGGGCAGCAGGGCAGTAGG + Intronic
1089919293 11:122193212-122193234 CACTGGCAGTGCAAGACAGTGGG - Intergenic
1096570804 12:52521990-52522012 CACAAGGAAGCCAAGGCAGTGGG + Intergenic
1099235756 12:80080693-80080715 CACTAGGAGTGCCAGACAGTGGG - Intergenic
1101176884 12:102161349-102161371 CACTAGGAGGCCAAGGCAGGTGG - Intronic
1103914473 12:124369406-124369428 CACTGGGGCTGCCAGGCAGGAGG + Intronic
1104475186 12:129065217-129065239 CACCTGAACTGCAAGGCAGCTGG + Intergenic
1104865597 12:131951424-131951446 CACTAGGAGGCCAAGGCGGTAGG - Intronic
1105582928 13:21717979-21718001 CTCTTGGAATGCAAAGCAGTGGG + Intergenic
1105717810 13:23084794-23084816 CACTTGGACTGCATGGCAGTTGG + Intergenic
1111219583 13:85186821-85186843 CACAGGGACTACAAGGCAATTGG - Intergenic
1114036754 14:18636505-18636527 CACCGGGACTGCAGGGCAGCAGG - Intergenic
1114121882 14:19678532-19678554 CACCGGGACTGCAGGGCAGCAGG + Intergenic
1114500258 14:23163220-23163242 CACAAGGACTGCAAGAGAGAAGG - Intronic
1124232682 15:27959010-27959032 CAGTAGGTCTGCCACGCAGTGGG - Intronic
1124696147 15:31866302-31866324 GACTAGGACTGGGAGGGAGTGGG - Intronic
1125620428 15:41056525-41056547 CAGTAGCACTGCAAGGGAATGGG + Intronic
1132735862 16:1385555-1385577 CACCAGGACGGCAGGGCAGCGGG + Intronic
1136105533 16:28027390-28027412 CTCTAGGGTTGCAAGGCAGGTGG + Intronic
1137753755 16:50885651-50885673 CAGTAGGGCTGGAATGCAGTAGG - Intergenic
1140080456 16:71742158-71742180 CACTAGGAAAACAAGACAGTAGG + Intronic
1143103468 17:4516427-4516449 CACACGGCCTGCCAGGCAGTAGG - Intronic
1143393578 17:6575104-6575126 CACTGGGGCTGCAGGGCAGATGG + Intergenic
1144724247 17:17493754-17493776 CACTAGTACTGCAAACCTGTTGG - Intergenic
1144780772 17:17807351-17807373 CACTGGGACTGCAGGGCACCAGG + Intronic
1145983479 17:29028424-29028446 CACTAGGACGGCATGGCTGGAGG + Intronic
1148132917 17:45273225-45273247 CACGGGGACTCCAAGGCAGAAGG + Intronic
1149559591 17:57599068-57599090 CACTAAGGCTGCTGGGCAGTGGG + Intronic
1157153840 18:45245314-45245336 CCCTAGGACTTCATGGCAGCTGG + Intronic
1157167847 18:45374811-45374833 TTCTAGGACTGCAAAGCAGAAGG + Intronic
1158477739 18:57795151-57795173 CACTAGGAGGCCAAGGCAGGAGG + Intronic
1159586353 18:70287275-70287297 CACTGGAACTCCGAGGCAGTAGG + Intergenic
1160153405 18:76412579-76412601 CTCAAGGACTGCAATGCACTGGG + Intronic
1160378568 18:78431649-78431671 CTCTAGGTCTGGAAAGCAGTGGG - Intergenic
1167495082 19:49812923-49812945 CTCTGGGTCTTCAAGGCAGTAGG - Intronic
925900448 2:8505541-8505563 GACTAGGACTGCAGGGCTGCTGG - Intergenic
926691012 2:15733415-15733437 CCCTAGGGATGCAAGGCAGGAGG - Intronic
927087124 2:19683189-19683211 TGCTAGAACTGCAATGCAGTAGG - Intergenic
929497363 2:42457705-42457727 CACTGGGAGGGCAAGGCAGAAGG + Intronic
935005142 2:99067157-99067179 CAGAATGACTGCCAGGCAGTGGG - Intronic
936824483 2:116564427-116564449 CACTAGGAGATCAAGGCATTGGG - Intergenic
940307599 2:152243314-152243336 CACTAGGACTAGAATGCTGTTGG - Intergenic
942768936 2:179491942-179491964 CTTTAGGAGGGCAAGGCAGTAGG - Intronic
948536969 2:238653687-238653709 CTCTGGAACTGTAAGGCAGTTGG + Intergenic
1171164031 20:22955150-22955172 CACGAGGACTGCAAGGAGGTAGG - Intergenic
1171196849 20:23206495-23206517 CACTAGGGCTGAGAGGCACTGGG + Intergenic
1174607592 20:51772311-51772333 CACTAGGAGGTCAAGGCAGGAGG - Intergenic
1175024455 20:55887253-55887275 CACTAGGACTGCCAGGCTGATGG - Intergenic
1177393766 21:20507959-20507981 CACTGGGAGTCCAAGCCAGTGGG + Intergenic
1178780367 21:35597769-35597791 CACTAGGAGGCCAAGGCAGGAGG + Intronic
1180460878 22:15563553-15563575 CACCGGGACTGCAGGGCAGCAGG - Intergenic
1183043750 22:35203295-35203317 CAGAAGGACTGCTGGGCAGTTGG - Intergenic
1183892600 22:40942374-40942396 CACTAGAACTTCTAGCCAGTGGG - Intergenic
1184880219 22:47299889-47299911 CACTGGGACTGCAGGGGAGCTGG - Intergenic
949107100 3:212629-212651 TACTTGGCCTGCAAAGCAGTAGG - Intronic
950248017 3:11439613-11439635 CACTAGGACTGCAAGGCAGTGGG + Intronic
950757341 3:15186779-15186801 CACTAGGAGTGTCAGACAGTGGG + Intergenic
951727802 3:25779494-25779516 CACTATCACTTTAAGGCAGTTGG - Intronic
957062877 3:75496358-75496380 CACTAGGAGGCCAAGGCAGGTGG - Intergenic
959131649 3:102363562-102363584 TCCTAGGCCTGCAAGGCAGCAGG + Intronic
961211892 3:125131901-125131923 CACCAGTACTGCCAGGGAGTTGG - Intronic
965476905 3:169167327-169167349 CAGTTGGACTGCAAGCCATTGGG + Intronic
969138575 4:5050665-5050687 CCGCAGGACTGCAAGGCAGGGGG + Intergenic
969568808 4:7995989-7996011 CCCCAGGACTGCAAGGCAGGAGG - Intronic
969814098 4:9673913-9673935 GACTATGACTGCCAGGCAGTAGG + Intergenic
969834039 4:9824441-9824463 CACTATGACTGTCAGGCAATAGG - Intronic
970892907 4:21067684-21067706 CACTGGGACTGCACAGCACTGGG - Intronic
973311141 4:48711188-48711210 CACTAGGAGTGCCAGACAGTGGG + Intronic
984603460 4:181756214-181756236 CACTAGGATAACAAGGCAGAAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986419670 5:7566241-7566263 CACTAGGAGGCCAAGGCAGAAGG + Intronic
986646120 5:9917678-9917700 CACGAGGCGTGCAGGGCAGTGGG - Intergenic
986732810 5:10648004-10648026 CACCAGGACTGCCAGGTGGTAGG + Intronic
989141364 5:38204697-38204719 AACTAGGAGAGCAAGGCAGCTGG + Intergenic
989183302 5:38599272-38599294 CTCTAGGACTTTAAGGCAATGGG - Intronic
990948178 5:61271067-61271089 CATGAGGCCTGCAAGGCAGAAGG - Intergenic
993977291 5:94497982-94498004 CACTAGAATTTCCAGGCAGTGGG + Intronic
994617967 5:102130219-102130241 CACTAAAAATGCAAGCCAGTTGG + Intergenic
996261476 5:121475701-121475723 CACTGGGAATGCAAAGCAATAGG - Intergenic
1002211915 5:177604403-177604425 CACCAGCACTGCCAGGCGGTGGG - Exonic
1002620942 5:180487735-180487757 CTCTGGCACTGCATGGCAGTGGG + Intergenic
1002963906 6:1943243-1943265 CACTTGGAGTGCCAGGCAGTTGG - Intronic
1005856822 6:29869118-29869140 CTCTTGGCCTGCCAGGCAGTGGG - Intergenic
1005862632 6:29913250-29913272 CTCTTGGCCTGCCAGGCAGTGGG - Intergenic
1005874119 6:29998453-29998475 CTCTTGGCCTGCCAGGCAGTGGG - Intergenic
1006726725 6:36204425-36204447 GATTAGGACTGCAAGGCAAGAGG + Intronic
1008536416 6:52509463-52509485 CGCTGGGACAGGAAGGCAGTGGG + Intronic
1008901113 6:56617163-56617185 CACTGTGACTGCCAGGCAGTTGG - Intronic
1010175017 6:73017930-73017952 CCCTAGGAGTGCAGGGCAGTAGG + Intronic
1010501732 6:76609556-76609578 CACAAGGGATGCAATGCAGTGGG + Intergenic
1013508760 6:110825845-110825867 GAGTAGGACTGGGAGGCAGTGGG + Intronic
1017517026 6:155165554-155165576 CACTGGGAGGGCAAGGCAGGAGG + Intronic
1023150424 7:37196567-37196589 CTCAAGGACTCCAAGGGAGTGGG + Intronic
1024185684 7:46945932-46945954 CAATAGGACAGCAAGGAAGATGG + Intergenic
1026390278 7:69894305-69894327 CACTAGGAGAGAAAGGCAGGAGG - Intronic
1029897877 7:104005333-104005355 CACTAGGACGGAAATGCAGATGG + Intergenic
1031063343 7:117076614-117076636 CACAAGGGGTGGAAGGCAGTGGG - Intronic
1031317578 7:120275121-120275143 CACCATGACTGCAAGGCAGAGGG + Exonic
1037333402 8:17767451-17767473 CATTAGGAGTCCAAGGCAGGAGG + Intronic
1041817753 8:61994415-61994437 CACTAGGAGTGCCAGACAGTGGG + Intergenic
1042162548 8:65912056-65912078 CACAAGGACTGCAAGTCTTTAGG + Intergenic
1043396003 8:79837426-79837448 CACTAGGAGTCCAAGGCAGGAGG + Intergenic
1044987599 8:97769015-97769037 CACTGGGAGGGCAAGGCAGGCGG - Intergenic
1045229069 8:100283290-100283312 AACTAGGACTCCAAGGCAGAGGG + Intronic
1046588296 8:116175130-116175152 CACTAACTCTGCAAGGTAGTTGG + Intergenic
1048779062 8:137981249-137981271 CACCAGGAGAGCAAGGCATTGGG + Intergenic
1052128487 9:24809793-24809815 AACTAGGACAGTAGGGCAGTGGG + Intergenic
1052150466 9:25108770-25108792 CTCTAGAAGTGCAAGTCAGTTGG + Intergenic
1053155259 9:35773912-35773934 CACTGGGAGTCCAAGGCAGGAGG - Intergenic
1055353841 9:75417433-75417455 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353854 9:75417558-75417580 CACTAGGACTGGATGACTGTGGG + Intergenic
1055353866 9:75417642-75417664 CACTAGGACTGGACGACTGTGGG + Intergenic
1055353884 9:75417761-75417783 CACTAGGATTGGAAGACTGTGGG + Intergenic
1055353907 9:75417929-75417951 CACTAGGAGTGGAGGGCTGTGGG + Intergenic
1055353914 9:75417971-75417993 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353921 9:75418013-75418035 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353928 9:75418055-75418077 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353935 9:75418097-75418119 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353960 9:75418223-75418245 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353967 9:75418265-75418287 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353974 9:75418307-75418329 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353981 9:75418349-75418371 CACTAGGACTGGAGGACTGTGGG + Intergenic
1058935589 9:109766900-109766922 CACTGGCACTGCAAGGCTCTGGG - Intronic
1059078125 9:111216876-111216898 CACCAGGACTGCAGAGCAGAGGG - Intergenic
1059552830 9:115247104-115247126 CACTAGCTCTGCAAGACAGTGGG + Intronic
1059781525 9:117533331-117533353 CAGTATGACTACAAGCCAGTTGG - Intergenic
1186549055 X:10482947-10482969 CACAATGACTGCAAGACTGTAGG + Intronic
1190007538 X:46755005-46755027 CACTGGAGCTGCAAGGCAGCGGG - Intronic
1192581475 X:72286355-72286377 CACTGGGAGTCCAAGGCAGGTGG - Intronic
1192697679 X:73434619-73434641 CACAAGGAGTGCCAGACAGTGGG - Intergenic
1197666925 X:129234136-129234158 CTCTGGGAATGCAAGGGAGTGGG + Intergenic