ID: 950249799

View in Genome Browser
Species Human (GRCh38)
Location 3:11454886-11454908
Sequence AGGATAGCACTACTATAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950249797_950249799 -1 Left 950249797 3:11454864-11454886 CCATCATTACAGAAAGGTCTATA 0: 1
1: 0
2: 11
3: 142
4: 640
Right 950249799 3:11454886-11454908 AGGATAGCACTACTATAGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 63
950249795_950249799 30 Left 950249795 3:11454833-11454855 CCATATTGGATGATACAGATATA 0: 1
1: 1
2: 8
3: 72
4: 349
Right 950249799 3:11454886-11454908 AGGATAGCACTACTATAGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950249799 Original CRISPR AGGATAGCACTACTATAGAG AGG Intronic
903988979 1:27251776-27251798 ATGATCGCACCACTATATAGTGG + Intronic
907791316 1:57667599-57667621 AGGATAGCACTACTCTGCTGTGG - Intronic
908957131 1:69646432-69646454 AGAATAGCACTAATATAAAAAGG + Intronic
912594231 1:110858160-110858182 AGGGGAGCACTACTATAAAAGGG - Intergenic
916067365 1:161147197-161147219 ATGATAGCTCTGCTATAGGGAGG - Intergenic
916440814 1:164822788-164822810 AGGATAGGACTACTAAGTAGTGG + Intronic
918816903 1:189197818-189197840 AGGAGAGCACTAGTGAAGAGAGG + Intergenic
923646240 1:235823201-235823223 TGGATAGCACCACTGTCGAGTGG + Intronic
1064111636 10:12544735-12544757 TGGATAGTACTAGTATTGAGTGG + Intronic
1067518269 10:46973910-46973932 TGGATAGCTCTACTATTGTGGGG + Intronic
1067643980 10:48077918-48077940 TGGATAGCTCTACTATTGTGGGG - Intergenic
1069618714 10:69823082-69823104 AGGAAAGCACTAGAATAGACAGG - Intronic
1071790529 10:88949050-88949072 AGGATAGCACTAGGACACAGAGG - Intronic
1077977994 11:7269691-7269713 ATGAAAGCACAAGTATAGAGTGG - Intronic
1084062064 11:66682406-66682428 TGGATAGCACTGCTATAAATGGG - Intergenic
1089963635 11:122637541-122637563 AGGAAAGCACTACCACAGTGGGG + Intergenic
1093324592 12:17758860-17758882 AGACTAGCACTAGTCTAGAGGGG - Intergenic
1098606184 12:72393418-72393440 AGGATAGCTCTACTACACAGAGG - Intronic
1101709796 12:107254664-107254686 AGGATAGCTCTAGCATAGTGTGG - Intergenic
1104409312 12:128544626-128544648 AGGAAAGCACAATTATAGCGGGG + Intronic
1105552680 13:21412154-21412176 AGGATTGCACGTCTACAGAGTGG - Intronic
1108917417 13:55632449-55632471 AGCAAAGCAATATTATAGAGAGG - Intergenic
1112851650 13:103713373-103713395 AAGATAGCACAGCTAGAGAGTGG - Intergenic
1117212810 14:53518947-53518969 AGGATAGCAATACAATGTAGGGG - Intergenic
1124880602 15:33639098-33639120 AGCAGAGGAATACTATAGAGGGG + Intronic
1125095117 15:35841770-35841792 ACGATAGGACTTTTATAGAGAGG + Intergenic
1129510630 15:76119065-76119087 AGGAAAGCACTACACCAGAGGGG + Intronic
1132724238 16:1332044-1332066 AGGAGAACACTGCTACAGAGTGG + Intergenic
1135350079 16:21721473-21721495 AGGACAGCACCACTACACAGAGG + Intronic
1137279837 16:46966548-46966570 TGGATAGCACTGCTCTAGAATGG + Intronic
1138801944 16:60043493-60043515 AGGATATCACAATTATTGAGTGG + Intergenic
1155900973 18:31389827-31389849 AGGATAGTCCTCCCATAGAGAGG + Intronic
1156070943 18:33207926-33207948 AGGGTAGCACTAGAATATAGAGG - Intronic
1166579246 19:43878616-43878638 AGGAAAGCACCACCATATAGGGG + Intronic
927286545 2:21362941-21362963 AGGAGAGCTCTGCTATAGAGAGG + Intergenic
928839420 2:35587287-35587309 AGGTTAGCACTAGTATTGATGGG + Intergenic
935631979 2:105219610-105219632 AGAATAGAAATACTGTAGAGTGG - Intergenic
939317492 2:140570163-140570185 AGGATAGAAATACTATAGATTGG + Intronic
942704784 2:178758373-178758395 AGGATAGCATTTTTATATAGTGG - Intronic
947452064 2:230217671-230217693 AGGGTTGCACAACTAGAGAGTGG + Intronic
947901782 2:233727334-233727356 AGGATAGCAGAACTATGGGGAGG - Intronic
1184098045 22:42327185-42327207 AGGCTGGCACTGATATAGAGGGG + Intronic
950249799 3:11454886-11454908 AGGATAGCACTACTATAGAGAGG + Intronic
955819281 3:62878692-62878714 AGGATAGCTCTACTATTAAGTGG - Intergenic
956122840 3:65983304-65983326 AGGAGAGCACTACTAAACATTGG - Intronic
958113585 3:89184305-89184327 AGGATACCATTACTCTACAGGGG - Intronic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
977324644 4:95559557-95559579 AGGTAAGTACTACTATAAAGTGG - Intergenic
982225153 4:153158070-153158092 AGGAAAGCTCTAGAATAGAGAGG - Intronic
982368556 4:154607599-154607621 TGGACAACACTTCTATAGAGTGG + Intronic
983189239 4:164737142-164737164 AGGATACTAGTAATATAGAGAGG - Intergenic
994847561 5:105009338-105009360 AGGATAGCAATACTATTGCTTGG + Intergenic
1000182607 5:158826475-158826497 AGGATGGCACTGCTCTAGAATGG + Intronic
1003691024 6:8353797-8353819 ATGATAGCACTACTGTAGTCTGG + Intergenic
1009293955 6:61920045-61920067 ACTATAGCATTACTATACAGTGG + Intronic
1009710778 6:67315890-67315912 AGGATAGCACAACGAAGGAGAGG + Intergenic
1010813283 6:80324704-80324726 AGGATAGCAGTATTGTAGACAGG - Intronic
1015314748 6:131806155-131806177 AGAATAGCTCTGCTACAGAGAGG + Intergenic
1017435929 6:154415608-154415630 AGGATAGCACCAACATAGGGTGG + Intronic
1027489289 7:78802601-78802623 AGTATAGTACTACTATATAATGG + Intronic
1027820286 7:83033602-83033624 AAGATTGCACTAATATAGAAAGG - Intronic
1049793825 8:144486911-144486933 ATAATAGCACTTCTACAGAGTGG - Intronic
1053125588 9:35578137-35578159 AGGTTAGCTCTACTATTGATAGG - Intergenic
1056597662 9:88020980-88021002 AGGCACGCACTACTAGAGAGGGG - Intergenic
1193035202 X:76942498-76942520 AGGATAGCATTAGAATAGATGGG + Intergenic
1194096476 X:89645752-89645774 AAGATAGCAATATTAGAGAGGGG + Intergenic
1200449488 Y:3307134-3307156 AAGATAGCAATATTAGAGAGGGG + Intergenic
1202189212 Y:22223761-22223783 AGGATGGCAGCAGTATAGAGAGG + Intergenic