ID: 950250289

View in Genome Browser
Species Human (GRCh38)
Location 3:11459582-11459604
Sequence CCTGGAAGCCAGAGCCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950250284_950250289 10 Left 950250284 3:11459549-11459571 CCAAAATTCAACATGAATTGTAA 0: 1
1: 0
2: 15
3: 373
4: 5553
Right 950250289 3:11459582-11459604 CCTGGAAGCCAGAGCCAACAGGG 0: 1
1: 0
2: 3
3: 44
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950250289 Original CRISPR CCTGGAAGCCAGAGCCAACA GGG Intronic
900489929 1:2942778-2942800 CCTGGAAGCCAGTGGCTCCATGG - Intergenic
900616591 1:3568310-3568332 CCTGGAGGCCAGAGCCCTCAGGG - Intronic
900697753 1:4022810-4022832 ACTGGGAGCCAGGACCAACAAGG - Intergenic
901028445 1:6291840-6291862 CCCAGAACCCAGAGCCAGCAGGG + Intronic
901042996 1:6376818-6376840 CCTGGGAGGCAGAGCGAACATGG + Intronic
901935349 1:12622663-12622685 CCTGGCAGCCAGAATAAACACGG - Intergenic
902441220 1:16431368-16431390 CCATGATGCCAGCGCCAACACGG + Exonic
902546755 1:17195103-17195125 CCTGGGAGCCAGAGCCATCTGGG + Intergenic
902571935 1:17352574-17352596 TCTGGAAGGCAGAGCCAGCAGGG + Intronic
902725918 1:18335865-18335887 TCGGGAAGCCAGAACCACCACGG - Intronic
903072835 1:20735992-20736014 ACTGAAAACCAGAGCCAAGATGG + Intergenic
903532798 1:24044772-24044794 CCTGAAAGCCAGACACAAAAGGG - Intergenic
904684462 1:32250453-32250475 GGTGGAAGACAGAGCAAACAGGG - Intergenic
906533921 1:46540931-46540953 GCTGGAAGCCAGAGCTTGCAGGG - Intergenic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907316987 1:53578620-53578642 CCTGGTAGCCAAAGCAAAGAGGG - Intronic
907358106 1:53893004-53893026 CCCAGAAGCCAGAGACAGCATGG - Intronic
908640888 1:66222078-66222100 ATTGGAAGCCAGAGCTAATATGG - Intronic
909569425 1:77091489-77091511 CTTGAAAGAGAGAGCCAACAAGG - Exonic
910793858 1:91077987-91078009 CCTGGAAATCTCAGCCAACATGG - Intergenic
910975463 1:92901589-92901611 CTTGGAAACCTGAGCCAATACGG + Intronic
912861427 1:113217189-113217211 GCAGGAAGACAGAGCCAAGAGGG - Intergenic
913240257 1:116824133-116824155 ACTGGCAGCCAGAGCCAAAAGGG - Intergenic
915012249 1:152698406-152698428 CCTGGGAGCCAGAGGGCACAGGG + Intronic
916119831 1:161519232-161519254 CCTGAAAGCCACAGACAATATGG + Exonic
916139088 1:161677712-161677734 CCTGAAAGCCACAGACAATATGG + Exonic
916165922 1:161967363-161967385 CCAGGAAACCAGAGACAATATGG - Intergenic
916472446 1:165137463-165137485 CATGAAGGCCAGAGCCAACGTGG + Intergenic
919433200 1:197523091-197523113 CCTGCAAGCCTGAACCACCAAGG - Intronic
919468692 1:197952503-197952525 CCTGGAAGTTAGAAGCAACATGG - Intergenic
919896537 1:202012804-202012826 GCTGGGAGCCAGAGGGAACAAGG - Intronic
921180796 1:212629865-212629887 CCTGAAAGACAGAGCACACATGG + Intergenic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
923274836 1:232386874-232386896 CCAGGAAGCCTGAGCCAGCCAGG - Intergenic
923637453 1:235714155-235714177 CTTGGAAACCACAGCAAACAAGG + Intronic
1062932586 10:1362939-1362961 CCTGGACGCCACTCCCAACAGGG + Intronic
1064346145 10:14534330-14534352 GCTGGAACCCAGATCCCACATGG - Intronic
1064559649 10:16583590-16583612 CAGGGAAGCCAGAGCAAACCAGG - Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1067059334 10:43069885-43069907 CCTGGAAGCCAGGGCCCAGAGGG + Intergenic
1068204474 10:53831368-53831390 GATGAAGGCCAGAGCCAACAAGG + Exonic
1069694035 10:70373873-70373895 CCTGGGAGCCATACCCACCAAGG - Intronic
1070322990 10:75368509-75368531 CCTGGAGGCCAAAGCAAAGAAGG + Intergenic
1071544358 10:86517005-86517027 CCTGGGAGGCGGAGCCAGCATGG + Intronic
1072493866 10:95935299-95935321 CTTTGAAGGCAGAACCAACAGGG - Intronic
1072643039 10:97228090-97228112 CCTGGAAGACAGAAGCAACGAGG + Intronic
1072695057 10:97596974-97596996 CCTGATAGCCAGAGCTAAAAGGG - Intronic
1074209131 10:111312434-111312456 CCTGGCAGCCAAAGCAAAAAGGG - Intergenic
1074459381 10:113623543-113623565 CCTGGCAGCCAAAGCCAAGAGGG - Exonic
1074522659 10:114239583-114239605 CCCGGGCGCCAGAGCCAACTCGG - Intronic
1075401275 10:122163295-122163317 CCTGGAGGGATGAGCCAACAGGG + Intronic
1075722512 10:124595560-124595582 CCTGGCAGCCAAAGCAAAGAGGG - Intronic
1076445555 10:130511569-130511591 CCTGAAAGCCAGAGCAAGGAGGG - Intergenic
1076508037 10:130991436-130991458 CCAGGAAGCCAGATCCCCCACGG + Intergenic
1077430089 11:2512022-2512044 CCTGGAGGGCAGAGACATCAGGG + Intronic
1078097628 11:8310382-8310404 CCAGAAACCCAGACCCAACAGGG - Intergenic
1078488171 11:11743104-11743126 TCTGCAGGCCAGGGCCAACAGGG + Intergenic
1078557330 11:12340051-12340073 TCTGGAAGGTAGAGCCAAGATGG - Intronic
1079513933 11:21244689-21244711 CCTGGAAGAGACAGGCAACATGG - Intronic
1080076100 11:28151620-28151642 CCTGGAAGAAAGAGCAAACAGGG - Intronic
1081152468 11:39648716-39648738 CCAGGAACCCAGTGCCACCACGG + Intergenic
1083487725 11:62993957-62993979 CTTGGAAGCCAAAGCAAAAAGGG - Intronic
1084669758 11:70598105-70598127 GCTGGAGTCCAGAGCCAGCAGGG + Intronic
1084937421 11:72594596-72594618 CCTGGCAGCCAGAGCCCAGCTGG + Intronic
1085249420 11:75132476-75132498 TCTGGAAACCAGAGCAATCAAGG + Intronic
1086220072 11:84432249-84432271 CCTGGAAGCTAGAGAGAGCATGG + Intronic
1087058591 11:93957017-93957039 CCAGAATGCCAGAGCCAACCTGG + Intergenic
1092258872 12:6941859-6941881 CCTGCCACCCAGAGCCAAGAGGG + Exonic
1094489451 12:30949873-30949895 CCTGGAAGCCAGGGAAGACAGGG - Intronic
1096353474 12:50919077-50919099 CTTGGAGGCCAGAGGCAACATGG + Intergenic
1097446365 12:59677834-59677856 CCTGGAAGTAAGAGACACCATGG - Intronic
1097903600 12:64897802-64897824 CCTAGAAGTCAGAGACAGCAAGG - Intergenic
1098044987 12:66391241-66391263 ACTGAAACCCAGAGCAAACAAGG + Intronic
1098294543 12:68991039-68991061 CCTGGTAGACTGAGCCAAGATGG + Intergenic
1101042402 12:100770113-100770135 CCTGGTAGCCAAAGCAAAAAGGG - Intronic
1101752170 12:107590799-107590821 CCAGGAAGCCAAATCCCACATGG - Intronic
1103528717 12:121584831-121584853 ACAGGAATCCAGAGCCCACAGGG - Intergenic
1104358640 12:128111609-128111631 CCTGGGATCCAGGCCCAACACGG - Intergenic
1104495407 12:129232462-129232484 CCTGCAAGGCAGAGCTAGCATGG - Intronic
1104743926 12:131198638-131198660 CTTACAAGCCAGAGCCAAAATGG - Intergenic
1104760317 12:131294128-131294150 CCAGGAAGCCAGAGCCACCCAGG - Intergenic
1104819450 12:131666519-131666541 CCAGGAAGCCAGAGCCACCCAGG + Intergenic
1105251250 13:18700167-18700189 GCTGGATGCCAGATCCATCATGG - Intergenic
1106186992 13:27418344-27418366 TGTGGAAGCCAAAGCCAAGAAGG + Intergenic
1108140511 13:47416108-47416130 CCTGGAGGACAGAGCCAGGAGGG + Intergenic
1108526038 13:51286834-51286856 CCTGGAAGCCAGAGCGAAAAGGG + Intergenic
1108635990 13:52334505-52334527 ACTGGAAGCCAGAGCCTAAATGG - Intergenic
1108651820 13:52488743-52488765 ACTGGAAGCCAGAGCCTAAATGG + Intergenic
1111942640 13:94628167-94628189 CTTAGAATCCAGTGCCAACACGG - Exonic
1112237851 13:97652280-97652302 CCTGGAATGGAGAGCCATCACGG + Intergenic
1115442663 14:33454032-33454054 CCTGGCAGCCAGGGCAAAAAGGG - Intronic
1115781768 14:36776905-36776927 TCAGGAAGCATGAGCCAACAAGG - Intronic
1118332200 14:64823484-64823506 CCTGGGAGCCAGAGGCAGCAGGG + Intronic
1119397043 14:74334181-74334203 CCTGGAAGCCAAAGCCAAGAAGG + Intronic
1120643791 14:87047850-87047872 CCTGGAAGCAAGAGCTTAAATGG + Intergenic
1122794890 14:104201168-104201190 CAAGGAAGCCACAGCCACCACGG - Intergenic
1122972354 14:105157561-105157583 CCTGGCAGCCAAAGCAAAAAGGG + Intronic
1125540302 15:40466274-40466296 CCTGGAGCCCAGAACCCACAGGG - Exonic
1125572756 15:40733572-40733594 CCTGGAAGCCAGATGCCAAATGG + Intergenic
1126169743 15:45685397-45685419 CCGGAAAGCCAGACTCAACATGG - Intronic
1127436445 15:58963086-58963108 CCTTTCAGCCAGAGCCAACAGGG - Intronic
1128091115 15:64919574-64919596 GCTGGAAGCAAGAGCCAGCAGGG - Intronic
1128224496 15:65992536-65992558 TCTGGAAGCCAGATTCAGCAGGG + Intronic
1128494066 15:68181442-68181464 ACTGGAAGACTGAGCCAACAGGG + Intronic
1128760913 15:70215445-70215467 GCTGGAGGCCAGAGCCAGAAGGG - Intergenic
1129659459 15:77544857-77544879 TCTGGGAGCCAGAGCCAGAAGGG + Intergenic
1129693973 15:77730118-77730140 ACTAGATGCCAGAGCCAAGAGGG - Intronic
1129737807 15:77975675-77975697 CCTGGAAGCCAGGCCCGACAAGG - Intergenic
1130649542 15:85754464-85754486 CCTGGCAGCCACAGCTAAAAGGG + Intergenic
1131065744 15:89433953-89433975 CCTGGAAGCAAGAGTCAGCCAGG - Intergenic
1131353055 15:91719070-91719092 CCAGGAAGCCAGAACCACAATGG + Intergenic
1131373613 15:91905113-91905135 CCTGGGAACCAAAGCAAACAGGG + Intronic
1132669128 16:1095510-1095532 AGGGGAAGCCAGAGCCAACCTGG + Intronic
1132794181 16:1710947-1710969 CCTGCCAGCCAGAGAGAACACGG + Intronic
1132858028 16:2056137-2056159 CCTGGATGGCCGAGCCACCACGG - Intronic
1133707758 16:8371497-8371519 CCTGGCAGCCAAAGCAAAGAGGG + Intergenic
1134475076 16:14566413-14566435 ACTGGAAGCCAGAGGAGACAAGG + Intronic
1134537148 16:15035203-15035225 CCAGGGAGCCAGGCCCAACAGGG - Intronic
1134882450 16:17757503-17757525 TGTGGAAGCCAGACCCACCAGGG - Intergenic
1136372921 16:29847431-29847453 CCAGGAAGGCAGAGCCAAGGCGG + Intronic
1137408155 16:48206128-48206150 CCTGGCAGCCAGTGCCTCCATGG + Intronic
1138690920 16:58767891-58767913 CTTCGAAGACAGAGGCAACATGG - Intergenic
1138807242 16:60105061-60105083 CCTGGTAGCCAGTGCAAAGAAGG + Intergenic
1139434255 16:66926961-66926983 TCAGGAAGCCAGAACCAGCATGG - Intergenic
1140209380 16:72958868-72958890 ACTGGAAGCCAGAGGCCCCAGGG + Exonic
1140800932 16:78487816-78487838 CCTGGAAGCCAGAGAAAAGGAGG - Intronic
1143654788 17:8287888-8287910 CCTGAAAGTGAGAGCCAACCTGG - Exonic
1143782035 17:9234031-9234053 CATGGGGGCCAGAGTCAACAAGG - Intronic
1144025471 17:11272883-11272905 CCTGGAATCCAGATCCAAGGTGG + Intronic
1144687218 17:17234167-17234189 CCCAGCACCCAGAGCCAACATGG + Intronic
1145388778 17:22438573-22438595 CCTGGAACCCTGTGCCAAAAAGG - Intergenic
1146458742 17:33026914-33026936 CCTAGAAAACAGAGCAAACAGGG - Intronic
1147547321 17:41412021-41412043 CCTGGAAAACAGAGAAAACAAGG + Intergenic
1147667816 17:42159910-42159932 CCAGAAATCCAGAGCCAACCAGG + Exonic
1148744087 17:49908750-49908772 CCTGGAGGCCAGGGCCACCAGGG + Intergenic
1148770554 17:50063704-50063726 CCAGGAAGCAAGAGCCAGCAGGG - Intronic
1150523675 17:65897977-65897999 CCTGGAAGCCACAGCAAAGAGGG - Intronic
1150624146 17:66830624-66830646 CCTGGATGACTGAGCAAACAGGG - Intergenic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151334977 17:73434416-73434438 CTTGGAAGCCAGAAGCAAGACGG + Intronic
1152252960 17:79221256-79221278 CCTGAAGGCCAGAGCCCACCCGG + Intronic
1152653375 17:81507285-81507307 CCTGGATGACAGAGCCAGGATGG + Intergenic
1152821181 17:82438658-82438680 GCTGGAGGCCAGACCCACCAGGG + Intronic
1153019111 18:610916-610938 CCTGGCTGCTGGAGCCAACATGG + Intronic
1154437686 18:14359790-14359812 GCTGGATGCCAGATCCATCATGG + Intergenic
1155016932 18:21852468-21852490 ACAGGAAGCCAGAGCCAAGGTGG + Intronic
1155178845 18:23325474-23325496 CCTGGCAGCCAAAGCAAAGAAGG + Intronic
1157293072 18:46423668-46423690 CCTGGATGCCAGCCCCAACTTGG + Intronic
1157616302 18:48989674-48989696 CCTGGCAGCCAGTTCCAATAAGG - Intergenic
1158195296 18:54878410-54878432 ACTGGAAGCCACAGCCATCTTGG - Intronic
1158241482 18:55383632-55383654 CCTGTAAGCCAGAGATATCAAGG - Intronic
1160022655 18:75192529-75192551 CCTGGCAGCCAGAGACCCCAGGG + Intergenic
1160033780 18:75283237-75283259 CCTTGTAGCCCAAGCCAACATGG + Intronic
1160423233 18:78763340-78763362 CCAGGAAGCCAAAGCTAAAATGG + Intergenic
1161516789 19:4700884-4700906 CCTGGAGGCCAGAGCCACGAGGG - Intronic
1162492005 19:10998265-10998287 TCTGGCAGGCAGACCCAACATGG + Intronic
1162494873 19:11018056-11018078 GCTGGAAGCCACAGCCAACCAGG - Intronic
1162799306 19:13102312-13102334 TCTGGAACCAAGAGCAAACAGGG - Intronic
1164667592 19:30051762-30051784 CCTGGAAGACAGAGGCAAGGGGG + Intergenic
1165453030 19:35896218-35896240 CCTGGAAGCCAGAGACTTCGAGG - Exonic
1166446749 19:42864816-42864838 CCTGGAAGCACTAGCCCACATGG + Intronic
1166570296 19:43791632-43791654 CCTGGAAGGCAGAGCTTGCAGGG - Intergenic
1166938038 19:46346870-46346892 CCTGGTAGAGAGAGCCAATAGGG - Intergenic
1167018448 19:46857049-46857071 CATGGTAGCCAGAGACTACATGG - Intergenic
1167565649 19:50254894-50254916 CCTGGCAGCCAGAGCAAAAAGGG + Intronic
1167705328 19:51078195-51078217 ACAGGTAGCCAGAGCCACCATGG + Intronic
1167774359 19:51545027-51545049 CCTGGAGCCCAGATGCAACAGGG + Intergenic
1168152815 19:54458081-54458103 CCTGGAAGGCAGAGGCACCGAGG - Exonic
926167613 2:10531248-10531270 CCTGGAGTGCAGAGCCACCATGG + Intergenic
926172542 2:10561409-10561431 CCTGGAAGGCAGACCTAGCAAGG + Intergenic
926668071 2:15546849-15546871 GCTGGAAGCCAGAGGCAACCAGG + Intronic
927698617 2:25253282-25253304 CCTCGAGGGCAGAGCCAACAGGG - Intronic
929758965 2:44790594-44790616 CTGGGAAGCCAGAGCCCAAAAGG + Intergenic
930721685 2:54644301-54644323 CCTGGAAAACAAAACCAACATGG - Exonic
932380581 2:71278035-71278057 CCTAGAAACCAGAGCCAAGAAGG - Intronic
936558180 2:113514064-113514086 CCTGAAAGCCAGATGCTACAAGG + Intergenic
937097569 2:119245634-119245656 CTTTGAAGCCAGAGCCCACCAGG - Exonic
939741287 2:145910444-145910466 CCTGTAAGACAGAGCCAAAGGGG - Intergenic
940690056 2:156905248-156905270 CCTGGAAGCTAGAGGTAACATGG + Intergenic
941784815 2:169485748-169485770 ACTGGAAGCCAGAGTATACAAGG - Intronic
943013180 2:182476920-182476942 CCTGGCAGCCAAAGTAAACAGGG + Intronic
946644826 2:221821998-221822020 CCTAAAAGCCAGGGCAAACATGG + Intergenic
946753568 2:222919180-222919202 CCTGGGAGCCAAGGCCAGCATGG + Exonic
948295390 2:236856649-236856671 CATGGAAGCCTGAGCCACGATGG - Intergenic
948641904 2:239380098-239380120 CATGGGTGCCAGAGCCAAGAGGG + Intronic
1168978970 20:1988883-1988905 CCAGGGAGGCAGAGCCAACAAGG - Intronic
1170285737 20:14706454-14706476 CTTGGAAGTCAGAGGCCACAAGG - Intronic
1171027077 20:21640590-21640612 GCAGGAAGACAGAGCCAAGATGG + Intergenic
1172126107 20:32626245-32626267 CCAGGAGACCAGAGCCAAAAGGG + Intergenic
1172601527 20:36187161-36187183 CCTGGCAGCCAAAGCAAAGAAGG + Intronic
1173186999 20:40848015-40848037 CTTGGAAGCCAGAGGCAGCTGGG + Intergenic
1173272193 20:41547492-41547514 CCTGGGAGCCAGTGCAGACATGG - Intronic
1173560886 20:44004527-44004549 ACTGGGACCCAGAGCCCACATGG - Intronic
1173853689 20:46235700-46235722 CATTGAAGGTAGAGCCAACAGGG - Intronic
1174060728 20:47831099-47831121 CCTGGATGCCAGTGCCCACCTGG - Intergenic
1174071170 20:47900271-47900293 CCTGGATGCCAGTGCCCACCTGG + Intergenic
1174099933 20:48119522-48119544 CCTGGATGCCAGTGCCCACCTGG - Intergenic
1174102514 20:48138330-48138352 CCCAGAAGCCAGAGGCCACAAGG - Intergenic
1174511980 20:51060289-51060311 CCTGGAAGACTGAGACATCATGG + Intergenic
1175190942 20:57211770-57211792 CCTAGAAGCCAGAAACAACAAGG + Intronic
1175241039 20:57549125-57549147 CCGGGAAGCCAGGGCCTGCACGG - Intergenic
1175670281 20:60896711-60896733 CCTGGTAGCCAGAAGCAACAAGG + Intergenic
1176836772 21:13800051-13800073 GCTGGATGCCAGATCCATCATGG - Intergenic
1176905314 21:14493339-14493361 CCTGTAATCTAGAGCAAACAAGG + Intronic
1178454078 21:32730518-32730540 TCTGGAGGCCAGAACCAACAGGG - Intergenic
1179541470 21:42085796-42085818 CGTGGAAGCCAGCACCAACCTGG + Intronic
1179728918 21:43356441-43356463 ACAGCAAGTCAGAGCCAACAGGG - Intergenic
1179799237 21:43803170-43803192 CCTGAACGCCAGGGCCGACAGGG - Intronic
1180094190 21:45547641-45547663 CCTGGAAGCCAGCCCCCACCAGG + Intergenic
1180757640 22:18173771-18173793 CCTGGAAGCCAGAAACAAATGGG - Exonic
1181074134 22:20363674-20363696 CCTGGAAGCCAGAAACAAATGGG + Exonic
1181309508 22:21937020-21937042 CCCTGAAGCCAGAGCCCCCATGG - Intronic
1181481195 22:23200206-23200228 CCTGGATGTCTGAGCCCACACGG - Intronic
1184348158 22:43925527-43925549 CCTGCCTGCCAGAGCCAGCAGGG + Intronic
1184396595 22:44245632-44245654 GCTGGAATCCTGAGCCAACCTGG + Exonic
1184477735 22:44730470-44730492 ACTGGAACCCAGAGCCAGCTTGG + Intronic
949862489 3:8518859-8518881 CCTGGAAACCAGAGGAAACCAGG + Intronic
949959252 3:9298655-9298677 CCTGGCAGCTTGAGCCACCAAGG + Intronic
950250289 3:11459582-11459604 CCTGGAAGCCAGAGCCAACAGGG + Intronic
950532740 3:13562160-13562182 CCTGGCAGCCAAAGCCAAAAGGG - Intronic
952563322 3:34622483-34622505 CCTGTAAGCCAAAGCTAGCAAGG - Intergenic
953114982 3:39983954-39983976 TCTGGCAGCCAGAGCAAAAAAGG - Intronic
953519200 3:43625038-43625060 CTTGGAAGCCAGAGAGAACATGG - Intronic
955095560 3:55794311-55794333 CCTGGCAGCCAGAGCAAAAAGGG - Intronic
955391062 3:58522601-58522623 CCTGAAAGCCAAAGCAAAAAAGG + Exonic
957508434 3:81155809-81155831 CTTGGGAACCAGAGCCAATAGGG - Intergenic
962198258 3:133381024-133381046 CCTGGAAGCCTGGGACAGCAGGG + Exonic
962283203 3:134067270-134067292 CCTGGAAGCCAGAGCCTTTCAGG + Intronic
962304972 3:134278017-134278039 GCTGGTAGTGAGAGCCAACATGG + Intergenic
962855170 3:139338821-139338843 GCAGGAAGCCAGAGCCAGAAAGG - Intronic
963590692 3:147254349-147254371 CCTGGAAGTCAGAGTCAGGAGGG - Intergenic
964399732 3:156286462-156286484 ATTGGAAACCACAGCCAACAGGG - Intronic
967250405 3:187531826-187531848 CCTGGAAGCAAAAGAGAACATGG + Intergenic
967843524 3:194026596-194026618 CCTGGAAGTAAGAGAGAACATGG + Intergenic
967949338 3:194828836-194828858 CCTGGAAGCAAGAGCAAACACGG + Intergenic
967978113 3:195046636-195046658 TCAGGAGGCCAGAGCCAAAATGG + Intergenic
968495435 4:912702-912724 CCTGGAACCAGGAGCCAGCACGG - Intronic
969842361 4:9891893-9891915 CCATGAAGCCAGAGCACACATGG + Intronic
970234857 4:13948273-13948295 CCTGGTAGCCAAAGCAAAAAAGG + Intergenic
971142391 4:23938289-23938311 CCTGGAAGGTAGAGGCACCAAGG + Intergenic
971513991 4:27464001-27464023 CCTGGAGCCCAGAGCTATCATGG - Intergenic
972666249 4:41167891-41167913 AGAGGAGGCCAGAGCCAACATGG + Intronic
973678175 4:53286962-53286984 TTTGGATTCCAGAGCCAACAGGG - Intronic
973867079 4:55125148-55125170 CCTGAAAGCCAGATCTAACTCGG - Intronic
974630331 4:64480095-64480117 CCTGGAAGCAAGAGCCCACTTGG + Intergenic
977726248 4:100300313-100300335 CAACGGAGCCAGAGCCAACAGGG - Intergenic
981824500 4:148924664-148924686 ACTGGAAGTCAGAGGCAAAAAGG + Intergenic
984860916 4:184237150-184237172 CCAAGAAGCCAGAGGCAACTAGG + Intergenic
984902747 4:184599664-184599686 CCTGGAGGTCAGAGGCAAGATGG - Intergenic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
984958372 4:185069066-185069088 ACTGGGAGCCACTGCCAACAGGG - Intergenic
985680589 5:1253763-1253785 CCTGGAGGCCGCAGCCAACCCGG - Exonic
985723150 5:1501268-1501290 CGTGGAAGACAGAGGCAACGGGG + Intronic
986045207 5:4030211-4030233 GCTGGAAGCCAGTGGCAAGAAGG - Intergenic
986055640 5:4134110-4134132 CCTTGAAGCCAGTGCACACATGG - Intergenic
988503013 5:31799185-31799207 CCTGGGGGCCAGACCCCACAGGG - Exonic
990047777 5:51456162-51456184 GCTGGAGGCTAGAGCCCACAAGG - Intergenic
990554494 5:56917649-56917671 GCTGGCAGCCAGAGTCCACAGGG - Intergenic
992462547 5:76975114-76975136 CCTGGAAAGGAGAGTCAACAGGG - Intronic
993741121 5:91541008-91541030 CCTGAAATCCAGAGTCAACCAGG - Intergenic
995716719 5:115087805-115087827 CCAGGGAGCCAGACTCAACAGGG + Intergenic
995858154 5:116615200-116615222 CCTGGGAGCCACAGCCAACCAGG - Intergenic
997177717 5:131796770-131796792 CCTGGAGCCCGGAGCCCACAAGG + Intronic
997696129 5:135862523-135862545 GCTGGAAGCCACAGCCTTCAGGG + Intronic
998175107 5:139896919-139896941 CCTGGCAGCCAGGGCCCTCAGGG + Intronic
999095037 5:148970216-148970238 GCTGGAAATCAGAGCCAACTAGG + Intronic
999324132 5:150632623-150632645 CCTGGAGGGCAGAGCCGAAAGGG - Intronic
1000192230 5:158922443-158922465 GCTGGAAGACAGAGTCAGCAAGG + Intronic
1000630692 5:163587283-163587305 CCTGGAACCCAGAGACACCTGGG - Intergenic
1001728729 5:173931226-173931248 TCTGGGAACCAGAGCTAACATGG - Intronic
1002088793 5:176792635-176792657 GCTGGAAGGCAGGGGCAACAGGG + Intergenic
1002441837 5:179268383-179268405 CCTGGCAGGCAATGCCAACAAGG - Intronic
1002519486 5:179783315-179783337 CCAGGAAGCCATGGCCCACAAGG + Intronic
1003487664 6:6593650-6593672 CCTTGAAGCCAAATCAAACAAGG + Intronic
1004064892 6:12234298-12234320 CCTGGAAGCAAGAACCCCCAAGG + Intergenic
1004868615 6:19879713-19879735 CCTGTAAGTCAAAGCAAACATGG + Intergenic
1006057313 6:31395006-31395028 CAGGGAAGCCAGAGCCACCATGG - Intergenic
1007627737 6:43255709-43255731 CCTGGAGGCAAGAGGCCACAGGG - Exonic
1007954321 6:45902413-45902435 CATGGAAGCCAGGGACAGCATGG + Exonic
1010371508 6:75114973-75114995 CCTAGAACTCCGAGCCAACATGG + Intronic
1012137124 6:95572356-95572378 AGTGGAAACCAGAGCCAGCAGGG - Intergenic
1012621599 6:101351333-101351355 TCTGGAAGCAAGACTCAACAGGG - Intergenic
1013010079 6:106112539-106112561 CCTGGAAGGAAGAGCAAACTAGG - Intergenic
1014172421 6:118293239-118293261 TCTGGAAGTCAGAGCCTACTTGG + Intronic
1015281944 6:131443365-131443387 TCTGGAAGCCAGAACAAAAATGG - Intergenic
1020166445 7:5811309-5811331 CCTGGGAGCCAGAGGCTGCAGGG - Intergenic
1020199166 7:6065826-6065848 CTGGGAGGCCACAGCCAACATGG - Intergenic
1022014653 7:26338987-26339009 CCTTGGAGCCAGAGACTACATGG + Intronic
1022551178 7:31240508-31240530 CCTGGGAGCCAAAGCAAAAAGGG + Intergenic
1024273548 7:47659863-47659885 CTGGGGAGCCAGAGCCACCAAGG + Exonic
1025234198 7:57222921-57222943 CCTGGATGCCAGTGCCCACCTGG + Intergenic
1025866085 7:65382425-65382447 ACTGGAAGCCTGAGACAAAAAGG - Intronic
1026833612 7:73624160-73624182 CCTGGAAGCCAAGGCCGTCAGGG + Intronic
1029124075 7:98285397-98285419 CCTGGAAGCCAGAGCTCCCCTGG + Intronic
1029214431 7:98936342-98936364 AGTGCAAGCCAAAGCCAACAGGG + Intronic
1032098093 7:128949564-128949586 CCTGGAAGGCAAAGCCAGCCAGG - Intronic
1032528730 7:132602409-132602431 GCTGGTAGACAGAGGCAACATGG - Intronic
1034762621 7:153687356-153687378 CCTGGAAGCTGGAGTCAATATGG - Intergenic
1034824729 7:154251380-154251402 CCTAAAAGACAGAGTCAACAAGG + Intronic
1036463459 8:8974557-8974579 CATGGTAGTCAGAGACAACATGG - Intergenic
1040096607 8:43450710-43450732 CCTGCAAGCTAGGGCAAACAAGG - Intergenic
1040737784 8:50531646-50531668 CCTGGGAGTCAGAGCTCACAGGG + Intronic
1041113633 8:54512014-54512036 CCTGGAGGCAGGAGCCAAGACGG - Intergenic
1045395891 8:101760319-101760341 GCTGGAAACCAGAGCCAGCTGGG + Intronic
1046826438 8:118696555-118696577 CATGCAAGCCTGAGCCTACAGGG + Intergenic
1047136387 8:122083230-122083252 CCAGGAAGCCACAGCCACCCTGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1047748568 8:127863731-127863753 CTTGGAAGCCAAAGCCCAGAGGG + Intergenic
1048963624 8:139599628-139599650 CCTGGAAGCCAGAGACAGTGTGG + Intergenic
1049479633 8:142815714-142815736 CCAGGAGGCCAGAGGCAGCAGGG - Intergenic
1049894682 9:102202-102224 CCTGAAAGCCAGATGCTACAAGG - Intergenic
1050497274 9:6257160-6257182 CCTGGAAGCCAGGGTCAGAAGGG - Exonic
1050999361 9:12261122-12261144 TTTGGAAGGAAGAGCCAACAGGG - Intergenic
1051601444 9:18878439-18878461 CCAGGAACTGAGAGCCAACAGGG + Intronic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1053735888 9:41102192-41102214 CCTGAAAGCCAGATGCTACAAGG - Intergenic
1054692485 9:68329206-68329228 CCTGAAAGCCAGATGCTACAAGG + Intronic
1055667744 9:78569356-78569378 CCAGGGAGCCAGAGACAGCAGGG - Intergenic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1057192174 9:93094397-93094419 CCTGGAGGCCAGAGCCAGCCTGG + Intergenic
1059597564 9:115739184-115739206 CCTGGAAAACAGATTCAACAAGG - Intergenic
1060785905 9:126451496-126451518 CCTGGAGACCAGAGACAGCAAGG + Intronic
1061723079 9:132565725-132565747 CCAGGAAGGCAGAGCCCACATGG - Intronic
1062004538 9:134232603-134232625 CCTGGCAGCCAGGGCAAAAAGGG + Intergenic
1062453808 9:136626580-136626602 CCGGGAAGCCAGAGCCACGACGG + Intergenic
1062485623 9:136773824-136773846 CCTGGATGCCAGTGCCCACATGG - Intergenic
1062566167 9:137164892-137164914 CCTGTAAGCCAGGGCCACCCAGG + Intronic
1187540203 X:20185700-20185722 CCTGGAAGTCCTAGCCAATATGG - Intronic
1189297627 X:39930020-39930042 CCTGGAAGCCAATGACAGCAGGG + Intergenic
1189505092 X:41605403-41605425 CCTGGTAGCCTGGGCAAACATGG + Intronic
1191109942 X:56796463-56796485 CCTGGAAGTCAGGGTCAACTGGG + Intergenic
1191221361 X:57991065-57991087 CTTGGTAGCCTGATCCAACAAGG + Intergenic
1194010105 X:88551127-88551149 ACTGGAAGCCAAAGCCAAAATGG - Intergenic
1197639228 X:128949907-128949929 CCTGGAAGGCTGAGAGAACAAGG - Intergenic
1197657844 X:129136874-129136896 TGTGGAAGCCAGAGTCAAGAGGG + Intergenic
1198651984 X:138873165-138873187 ACAGGAAGCCAGAGCCAAATTGG - Intronic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic