ID: 950250436

View in Genome Browser
Species Human (GRCh38)
Location 3:11460881-11460903
Sequence CCATGTGTATGGAGCCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950250428_950250436 -5 Left 950250428 3:11460863-11460885 CCCTAACCCTGATTCCATCCATG 0: 1
1: 0
2: 2
3: 16
4: 163
Right 950250436 3:11460881-11460903 CCATGTGTATGGAGCCCAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 170
950250427_950250436 3 Left 950250427 3:11460855-11460877 CCAGTTGACCCTAACCCTGATTC 0: 1
1: 0
2: 0
3: 0
4: 88
Right 950250436 3:11460881-11460903 CCATGTGTATGGAGCCCAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 170
950250429_950250436 -6 Left 950250429 3:11460864-11460886 CCTAACCCTGATTCCATCCATGT 0: 1
1: 0
2: 2
3: 23
4: 243
Right 950250436 3:11460881-11460903 CCATGTGTATGGAGCCCAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950250436 Original CRISPR CCATGTGTATGGAGCCCAGA GGG Intronic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
901497535 1:9630476-9630498 CCCTGTGTCTGGCACCCAGAGGG - Intergenic
901576382 1:10204510-10204532 CCATGTGTGAGGAGCCGAGTGGG - Intergenic
902736382 1:18404036-18404058 CCATGTGACTGGAGTCTAGAGGG - Intergenic
903681326 1:25099216-25099238 CCTTGTGTATGGAGAAAAGATGG - Intergenic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
908253365 1:62282776-62282798 CCAGGTGGATGGAGCCCCAAAGG + Intronic
908329727 1:63059273-63059295 GCATGAGTTTGGAGGCCAGATGG - Intergenic
909119171 1:71579209-71579231 CCATGTGACTGGAACACAGAGGG - Intronic
910083060 1:83364732-83364754 CCATGTGTCTGCAGGTCAGAGGG - Intergenic
911573463 1:99545679-99545701 CCATTTGTGTAGAGCACAGATGG + Intergenic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
918130213 1:181620943-181620965 CCATGTGTATGGCCCCAAGATGG + Intronic
919728835 1:200900366-200900388 CCATGAATATGTAGCCCAAATGG + Intronic
919758966 1:201085071-201085093 CCAGGTGTGTCCAGCCCAGAGGG - Intronic
919811452 1:201411413-201411435 CCTTGTGCTTGGAGCCCAGCAGG + Exonic
1065145454 10:22763641-22763663 TGATGAGGATGGAGCCCAGAGGG + Intergenic
1065145591 10:22764553-22764575 TGGTGTGGATGGAGCCCAGAGGG + Intergenic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1068931624 10:62596220-62596242 CCATCTGCATGGAGGGCAGAAGG - Intronic
1069831078 10:71282740-71282762 CCTTGTGCAGGGAGTCCAGATGG - Intronic
1071564288 10:86663652-86663674 CCATGTGTGTCCAGCCCTGAGGG - Exonic
1072472949 10:95731402-95731424 ACATGGGTAGGGGGCCCAGAGGG - Intronic
1073537972 10:104295158-104295180 CCATTTTTATGGATTCCAGAAGG - Intronic
1073989864 10:109250567-109250589 CCATGTATATGCAGGCCATAGGG + Intergenic
1075324227 10:121517774-121517796 CCAAAAGTATGGTGCCCAGAAGG + Intronic
1075740776 10:124694701-124694723 CTATGTGTCTGGGGCCCTGAGGG + Intronic
1078736898 11:14028713-14028735 TCCTGTGTACAGAGCCCAGAAGG - Intronic
1079332642 11:19546390-19546412 CCCTGGGTGTGGGGCCCAGATGG + Intronic
1079839900 11:25383227-25383249 CAATTTGTATGTAGCCAAGAGGG - Intergenic
1082273774 11:50199892-50199914 TTATGGGTATGGAGCCAAGATGG - Intergenic
1083652206 11:64210296-64210318 TCATGTGGAGGGAGCCCAGTGGG + Intronic
1083723075 11:64613029-64613051 CACTGTGTATGGTGCCCTGAAGG + Intronic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1088813235 11:113405406-113405428 CCTGGTGTCTGGAGCTCAGAGGG + Intergenic
1093262819 12:16961032-16961054 CCATTTGTAGGAAGGCCAGATGG + Intergenic
1093387267 12:18573342-18573364 CCTTGAGTCTGGACCCCAGATGG - Intronic
1094484978 12:30917925-30917947 CCATGTAAATGGAGGCCTGAAGG - Intergenic
1100220972 12:92504355-92504377 CCCTGTGTATGGAGCTCAAAGGG - Intergenic
1101694186 12:107109127-107109149 CCTAGTGGATGGAGCCCAGTGGG + Intergenic
1102178439 12:110893446-110893468 CCATGTGGAAGGAGCCCATCAGG - Intronic
1103180933 12:118910740-118910762 CTATGTGGATGGAAGCCAGATGG + Intergenic
1103560763 12:121792334-121792356 CAATGTTGATGAAGCCCAGATGG + Intronic
1104159159 12:126161938-126161960 ATATGTGAGTGGAGCCCAGAGGG - Intergenic
1106405622 13:29470521-29470543 GAATGTGTTTGGAGCCCAGGTGG - Intronic
1107430970 13:40339893-40339915 CCAGGTGTTAGGAGCACAGATGG - Intergenic
1109323027 13:60833328-60833350 CCATGGGGGTGGAGCCAAGATGG - Intergenic
1112084972 13:96020470-96020492 CAATGTTTGTGAAGCCCAGAGGG - Intronic
1112811437 13:103223513-103223535 GTAAGTGTTTGGAGCCCAGAAGG - Intergenic
1116280795 14:42904125-42904147 TCATGAGTATGGAGCTCACAGGG - Intergenic
1116479767 14:45383860-45383882 CCATAGGTCTGGAGCCCAAAAGG + Intergenic
1118508205 14:66440042-66440064 ACATGTAGTTGGAGCCCAGAAGG - Intergenic
1118616078 14:67575253-67575275 CCATTAGTAGGGAGCCCAAATGG + Intronic
1118821819 14:69350734-69350756 CCATGTGGAGGAAGCCCAGAGGG - Intronic
1121703043 14:95970624-95970646 CCTTGTCTACGGATCCCAGAGGG - Intergenic
1122973433 14:105161577-105161599 CCAGGTGTAGGGACCCCAGCTGG - Intronic
1129582853 15:76831091-76831113 CAAACTGCATGGAGCCCAGAGGG + Intronic
1129908699 15:79208297-79208319 CCACGTGGATGGATCCCCGAGGG - Intergenic
1130888141 15:88110906-88110928 CCATGTGGGAGGAGCCCAGATGG + Intronic
1132884167 16:2175233-2175255 CCTGGAGTCTGGAGCCCAGACGG - Intronic
1133313162 16:4864299-4864321 CCATGTGTATTGATCCCTTAGGG + Intronic
1134220988 16:12353694-12353716 ACATGTTTATGGAGCAGAGAAGG + Intronic
1138799032 16:60003169-60003191 CCATGTGTTTGGGACCCAGGTGG - Intergenic
1141040407 16:80668097-80668119 CCCTTTGTAGGCAGCCCAGATGG + Intronic
1142900380 17:3007929-3007951 CCAGGTGTCTGGAGCTCACAAGG + Intronic
1143155987 17:4836352-4836374 CCATGTGTGGGGAGGCCAGATGG + Intronic
1143992820 17:10981105-10981127 CCATGAGAATGGAGCCCTCATGG + Intergenic
1145260177 17:21349867-21349889 CCAGGTGTTTGGAGCTCAGAGGG + Intergenic
1145316442 17:21738071-21738093 CCAGGTGTTTGGGGCTCAGAGGG - Intergenic
1145714868 17:27009978-27010000 CCAGGTGTTTGGGGCTCAGAGGG - Intergenic
1148138904 17:45314380-45314402 CCTGGTGTGTGGAGACCAGAGGG + Intronic
1148631024 17:49109362-49109384 CCATGTAAATGGATTCCAGAAGG - Intergenic
1149642956 17:58216610-58216632 CCATGTGGAGGTAGACCAGATGG + Intronic
1150657432 17:67049226-67049248 CCAAATCTATGGAGGCCAGAAGG + Intronic
1152780000 17:82222912-82222934 TCATGTGAATGGAGCCCTGCAGG - Intergenic
1153434575 18:5055729-5055751 CCATGTGTATTGTGTCAAGATGG + Intergenic
1158509688 18:58079598-58079620 CCAAGTGATCGGAGCCCAGAGGG - Intronic
1159730640 18:72022912-72022934 CCCTCTGTATGAAGCCCAGTGGG - Intergenic
1160433190 18:78826365-78826387 CCTGGTGTATGGAGTCCACAAGG + Intergenic
1160486321 18:79296304-79296326 CCATGTTACTGCAGCCCAGAAGG + Intronic
1162094524 19:8302661-8302683 CCATGTGTATGGAGCTTGGTGGG - Intronic
1162822529 19:13231663-13231685 CCAGGCTTAGGGAGCCCAGACGG + Intronic
1162861934 19:13512587-13512609 CCATGGGTATCCAGACCAGAAGG - Intronic
1164742914 19:30590015-30590037 TCATCTGGATGGAGCCCAGTGGG - Intronic
1165638689 19:37365359-37365381 CCTTGCTTATGCAGCCCAGATGG + Intronic
1165800066 19:38543884-38543906 GCAGGTGGATGGAGACCAGAGGG - Intronic
1167449558 19:49558970-49558992 CCCTGTCTTTGCAGCCCAGATGG - Exonic
1167621640 19:50564097-50564119 CTCTGTCTATGGAGCCCAGCAGG + Intronic
925700667 2:6634255-6634277 CCATGTGTTTGAAACTCAGATGG - Intergenic
927460159 2:23292052-23292074 CCCTCTATATGGAGCACAGAAGG + Intergenic
929913384 2:46113302-46113324 CCATGTGTTTGAATCCCAGACGG + Intronic
934639007 2:96015153-96015175 CCATGTGACTGGAGCCAGGAAGG - Intergenic
934794641 2:97090259-97090281 CCATGTGACTGGAGCCAGGAAGG + Exonic
934973949 2:98787206-98787228 AGATGTGTACGGGGCCCAGAAGG + Intergenic
935690901 2:105731547-105731569 ACATGTGGATGGAGTCAAGATGG + Intergenic
936232981 2:110720361-110720383 CCAAGTGGATGGAACCCAGAGGG + Intergenic
937996467 2:127698271-127698293 CACTGTGAATGGAGCCCAGAAGG + Intergenic
940545200 2:155074260-155074282 CGATGTGTATAGAGCCTGGAGGG + Intergenic
941054902 2:160776686-160776708 CATTCAGTATGGAGCCCAGAGGG + Intergenic
941646640 2:168048061-168048083 CCATTTCTATGTGGCCCAGAGGG + Intronic
942732581 2:179076117-179076139 CCATGCCCATGGAGCCCAGCAGG + Intergenic
944366754 2:198929866-198929888 CCATGTGCATAGAAACCAGAGGG - Intergenic
944621719 2:201522707-201522729 CAACCTGTGTGGAGCCCAGAGGG + Intronic
945559260 2:211318399-211318421 ACACATGTATGAAGCCCAGAAGG - Intergenic
947816342 2:233040097-233040119 CCAGGTGTGGGGAGCCCACATGG + Intergenic
948595212 2:239075532-239075554 CCATGACTGTGGTGCCCAGAGGG + Intronic
1168863088 20:1060197-1060219 GCATGGGTATGTAGACCAGAAGG + Intergenic
1169040691 20:2492873-2492895 CCCTGTGTGTGGAGCACAGCTGG + Intronic
1169131264 20:3167397-3167419 CTATGTGCATGGAGCCCTGGGGG - Intronic
1171485969 20:25486535-25486557 CCATGCGGATGGGGTCCAGATGG - Intronic
1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG + Intronic
1172654839 20:36530327-36530349 CGATGTGTATGTATCCGAGAGGG - Intergenic
1174832212 20:53823376-53823398 CCAAGTGGCTGGAGCCCAAAGGG + Intergenic
1177417517 21:20813147-20813169 ACAAGTGTATGCAGCCAAGAGGG - Intergenic
1179292294 21:40029361-40029383 CCTTGTGTCTGGGGCCCAGAGGG - Intronic
1181461889 22:23090553-23090575 CCATGTGGCTGGTGCCAAGAGGG - Intronic
1183317270 22:37143569-37143591 TCCTGTGTCTGGAGCCAAGATGG - Exonic
950250436 3:11460881-11460903 CCATGTGTATGGAGCCCAGAGGG + Intronic
952694221 3:36247119-36247141 ACATCTGGTTGGAGCCCAGAAGG - Intergenic
954445010 3:50541837-50541859 CCCTGTGGCTGGAACCCAGAGGG + Intergenic
954705991 3:52480763-52480785 CCATGTTTGTGGGGCCAAGATGG + Intronic
955798466 3:62662060-62662082 CTATGTGTCTGGAACTCAGAAGG + Intronic
956703046 3:71975857-71975879 CCATGAGTATGGGTCCTAGAGGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956795767 3:72717108-72717130 CTATTTGTATGGCACCCAGACGG - Intergenic
958696852 3:97538783-97538805 TCATGGGAATGGAGGCCAGATGG + Intronic
958741358 3:98077166-98077188 AAATGTATATGGAGCCAAGAAGG - Intergenic
962350048 3:134650070-134650092 CAATGTGAATGGAGTACAGAGGG - Intronic
964142556 3:153420243-153420265 CAGTCTGTGTGGAGCCCAGAAGG - Intergenic
967038198 3:185663996-185664018 CCATGTCCCTGGTGCCCAGAGGG - Intronic
968472582 4:788807-788829 ACATGTGTATCCAGCCCAGGAGG + Intronic
969522267 4:7685338-7685360 CCAAGTGCATGGAGCCCACGTGG + Intronic
970703483 4:18771115-18771137 CAGTCTGTGTGGAGCCCAGAAGG + Intergenic
972973803 4:44609339-44609361 CCAGGTGGATGCAGCCCAGATGG + Intergenic
973668609 4:53190350-53190372 CCATGTGGCTGGAGCACAGCAGG - Intronic
979795401 4:124839958-124839980 CCTTCTCTATGGTGCCCAGATGG - Intergenic
985802688 5:2015647-2015669 GCATGTGTGTGGGTCCCAGAGGG + Intergenic
989229224 5:39067364-39067386 CCATGGGAATGGATCCCTGATGG - Intronic
990537169 5:56734135-56734157 CTTTGTGCATGGAGCCCAGGGGG - Intergenic
995856155 5:116594446-116594468 CCAAATGTTTGGAGACCAGATGG - Intergenic
996572401 5:124946137-124946159 CCATGAGAATGGAGCCCTCATGG - Intergenic
996595132 5:125192124-125192146 CGCTGTATATGGAGCACAGATGG + Intergenic
998375617 5:141688669-141688691 CCAGGAATATGGAGCCCTGAAGG + Intergenic
1000079803 5:157833996-157834018 CCAGGTGTATGGAATCCAGAGGG - Intronic
1005202761 6:23365101-23365123 ACATGTGGGTGGAGCCAAGATGG - Intergenic
1006211163 6:32396201-32396223 CCATGTGGCTGGAGAGCAGATGG - Exonic
1007888304 6:45257758-45257780 CCATGAGTGTGAAGCCCTGATGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008623785 6:53298174-53298196 CCATGTATATGGAGGTCACAGGG + Intronic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1010942880 6:81939780-81939802 ACATGTGGATGGAGCCCTAAGGG + Intergenic
1011535333 6:88370444-88370466 CCATGTGCTTGGTGGCCAGAAGG - Intergenic
1013396531 6:109746548-109746570 CCCTGTGGCTGGGGCCCAGAGGG + Intronic
1013599098 6:111687549-111687571 CCATGTGGAAGGAGCCCTGATGG + Intronic
1017067819 6:150546591-150546613 CCATGTTTGAGGGGCCCAGATGG - Intergenic
1023015695 7:35967666-35967688 CCCTGCGCATGGAGCCCAGAGGG + Intergenic
1024678335 7:51658275-51658297 CCATGGGAATGGTGCCCAGCAGG - Intergenic
1026072879 7:67138168-67138190 CCATCTGTATGATGCCCACAGGG + Intronic
1026604215 7:71802097-71802119 CCATATGGATGCAGTCCAGAAGG - Intronic
1026704003 7:72674040-72674062 CCATCTGTATGATGCCCACAGGG - Intronic
1027299893 7:76820932-76820954 CCATGTGTCTGCAGGTCAGAGGG - Intergenic
1029549646 7:101230926-101230948 CGATGTGTCTGGAGCCCACATGG + Intergenic
1029851346 7:103464709-103464731 CCAGGTGGATGGAGCACAAAGGG + Intergenic
1032392881 7:131567751-131567773 CCATGTTTATGGGACACAGAAGG - Intergenic
1032443333 7:131959173-131959195 CCCTGTGCCTGAAGCCCAGAAGG + Intergenic
1033586157 7:142775906-142775928 CCACATGTCTGGAGCACAGATGG - Intergenic
1034491446 7:151395174-151395196 CCATGAGGACGGAGCCCAGGAGG + Intronic
1039883495 8:41642020-41642042 CCATGAGGATGAAGCCCTGATGG + Intergenic
1043152148 8:76731097-76731119 CCATGTGTATGGGCCCCAGATGG - Intronic
1044308585 8:90666282-90666304 GCCTGTGTATGGAGCAGAGAGGG + Intronic
1045245880 8:100441392-100441414 CCATGTGACTGAAGCCCAGTAGG - Intergenic
1046216384 8:111152804-111152826 GAATGTGCATGGAGCCCAGGTGG - Intergenic
1047668094 8:127114691-127114713 CCATGTGGTTGGAGCACAGAGGG - Intergenic
1048365558 8:133735415-133735437 CCATGTGAATAGAGTCTAGAAGG + Intergenic
1050965428 9:11795584-11795606 CAGTCTGTATGGAGCCCAGAGGG - Intergenic
1052806777 9:33020259-33020281 CCTGGGGTAGGGAGCCCAGAAGG - Intronic
1057839971 9:98478434-98478456 CCATGTGTTGGGTCCCCAGATGG - Intronic
1059637746 9:116187368-116187390 CTATGTGAATGGTGCCCAGGTGG + Exonic
1060729678 9:126029478-126029500 CCATGTGTCTGGCTCCCAAATGG - Intergenic
1061570233 9:131473621-131473643 CCCCCTGTGTGGAGCCCAGAGGG + Exonic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1185569734 X:1124365-1124387 CCATGTGTGTGGAGGCTGGAAGG - Intergenic
1188147403 X:26630537-26630559 CAGTTTGCATGGAGCCCAGAGGG - Intergenic
1192762001 X:74103888-74103910 ACCTGTGTATGGAGCTTAGAGGG - Intergenic
1192932645 X:75824348-75824370 CAACCTGTGTGGAGCCCAGAGGG - Intergenic
1194087124 X:89541837-89541859 CCCTTTGTATGAAGCCCAGTGGG - Intergenic
1197283162 X:124561906-124561928 TCATCTGAATGGGGCCCAGATGG - Intronic
1198730428 X:139722116-139722138 CCATGTTTATGGAGAACATAAGG + Intergenic
1200439772 Y:3197710-3197732 CCCTTTGTATGAAGCCCAGTGGG - Intergenic