ID: 950251445

View in Genome Browser
Species Human (GRCh38)
Location 3:11468932-11468954
Sequence GTGTGTGGGCAGATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 388}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950251438_950251445 -5 Left 950251438 3:11468914-11468936 CCTCTGGCCCTCCAGGCTGTGTG 0: 1
1: 0
2: 6
3: 65
4: 685
Right 950251445 3:11468932-11468954 GTGTGTGGGCAGATTGAGGATGG 0: 1
1: 0
2: 4
3: 44
4: 388
950251436_950251445 -3 Left 950251436 3:11468912-11468934 CCCCTCTGGCCCTCCAGGCTGTG 0: 1
1: 0
2: 3
3: 43
4: 436
Right 950251445 3:11468932-11468954 GTGTGTGGGCAGATTGAGGATGG 0: 1
1: 0
2: 4
3: 44
4: 388
950251437_950251445 -4 Left 950251437 3:11468913-11468935 CCCTCTGGCCCTCCAGGCTGTGT 0: 1
1: 0
2: 1
3: 33
4: 290
Right 950251445 3:11468932-11468954 GTGTGTGGGCAGATTGAGGATGG 0: 1
1: 0
2: 4
3: 44
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950251445 Original CRISPR GTGTGTGGGCAGATTGAGGA TGG Intronic
900646581 1:3711562-3711584 GTGTTTGGGAAGTTTGGGGACGG + Intronic
901620115 1:10578083-10578105 GTGTGTCGGGAAATTGAAGATGG + Intronic
902517672 1:16998136-16998158 ATGTGTGGACAGTTTGTGGAGGG + Intronic
902620231 1:17646551-17646573 GTGTGTGTGCACATGGAGGTAGG - Intronic
902832733 1:19028299-19028321 CTCTGTGGGCACACTGAGGAGGG + Intergenic
902873741 1:19328883-19328905 GTGAGTAGGCAGAATGAGGTAGG - Exonic
903271372 1:22190452-22190474 GCATCTGGGCAGATGGAGGACGG + Intergenic
903539354 1:24088103-24088125 GTCTCTGGGCAGATGGAGGGTGG + Intronic
904386873 1:30148664-30148686 GAGGGTGGGCAGATGGAGCAGGG + Intergenic
906150167 1:43582963-43582985 CTGTGTGGGCAGATGAAGGTTGG + Intronic
907155821 1:52332849-52332871 GTGTGTGTACAGAATGATGATGG + Exonic
907665831 1:56433203-56433225 GGGTGAGGGCAGATTGGGGGAGG - Intergenic
908195764 1:61744170-61744192 GTGTGTCGGGAGGTTGAGGCAGG + Intronic
910190159 1:84586711-84586733 GTGGGTGGGATGGTTGAGGATGG - Intergenic
910669870 1:89762334-89762356 GTGTGTGGGCAGGGCTAGGAAGG - Intronic
910801332 1:91149614-91149636 GTGTGTGGGATGATTGATAAAGG + Intergenic
911532001 1:99054061-99054083 GTGTATGGACAGATGGGGGAAGG - Intergenic
912230621 1:107788344-107788366 GAGAGTGGGCAGAGTGAGGGTGG - Intronic
913319849 1:117580506-117580528 GTGTGTGTGCAGATCATGGAGGG - Intergenic
915048589 1:153042081-153042103 GTAGGTGTGCAGAGTGAGGAAGG + Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915269303 1:154742291-154742313 GTGTGTGGGCAGTAGGTGGATGG - Intronic
915919018 1:159960375-159960397 CTGTGTGGGCAGTTTCATGATGG + Intergenic
916407843 1:164515090-164515112 CAGTGTGGGCAGTTTGAGAATGG + Intergenic
917073320 1:171176748-171176770 GTGTTTAGGCAGATAGAGGCTGG - Intergenic
918819902 1:189239685-189239707 ATGTGTGTACAGATTGAGGTAGG + Intergenic
919091596 1:192984162-192984184 GTGTGTGGGCAGAATGTGAGAGG + Intergenic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920400471 1:205673060-205673082 GTGTGTGGGCAGGTGAAGGATGG - Intronic
921322291 1:213953723-213953745 CTGTGTGGGCAGGTGGAGGCTGG - Intergenic
922237488 1:223733088-223733110 GTGTGTGGGCAGGTTGGTGCTGG - Intronic
922621500 1:226992008-226992030 GAGGGTGGGGAGAGTGAGGAGGG + Exonic
922621506 1:226992026-226992048 GAGGGTGGGGAGAGTGAGGAGGG + Exonic
923425561 1:233865509-233865531 AGGAGTGGGCAGATTCAGGATGG - Intergenic
1064118120 10:12596138-12596160 GAGTGTGGGCATTTGGAGGAGGG + Intronic
1064851633 10:19714802-19714824 GTGTGTGGGCAGGGTGGAGATGG + Intronic
1064961501 10:20970167-20970189 TTGTGTGAGCAGAGCGAGGATGG + Intronic
1065661695 10:28010153-28010175 GTGTGTGGGTAGAGTGGGGAAGG + Intergenic
1066060802 10:31721992-31722014 GGGTGTGTGCAGATCAAGGATGG - Intergenic
1066305647 10:34137914-34137936 GTGTGGGGGCGGTCTGAGGAGGG - Intronic
1067204054 10:44198666-44198688 GTGTGTGGGCAGAGTGGGGAGGG + Intergenic
1067543279 10:47173171-47173193 GTGCGGGGGGAGAGTGAGGAGGG + Intergenic
1067908118 10:50315542-50315564 GATAGTGGGCAGATGGAGGAAGG - Intronic
1068685892 10:59869678-59869700 GTGGGTGTGCAGAATGAGCACGG - Intronic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1070916326 10:80157520-80157542 GTGTGTGGGCATCTTGATTATGG - Intronic
1071425074 10:85541291-85541313 GTGTGTGGGCAGAATAAGCCTGG - Intergenic
1071980824 10:91003134-91003156 GTGGCTTGGCAGCTTGAGGAGGG - Intergenic
1072933904 10:99693541-99693563 GTGTGTGTGCAGATTTAGAAAGG + Intronic
1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG + Intronic
1074234064 10:111567016-111567038 GTGTGTGGGGAGGTGGGGGAGGG + Intergenic
1074320479 10:112397496-112397518 TTGGGTGGGCAGCTAGAGGACGG - Intronic
1075405024 10:122189167-122189189 GTGTGTGCAGAGATTGGGGAGGG + Intronic
1075462431 10:122626058-122626080 GGCTATGTGCAGATTGAGGAAGG - Intronic
1075956561 10:126528372-126528394 GTGTGTGGGAAGAAAGAGCAAGG + Intronic
1076481944 10:130790569-130790591 GTGTGTGGGTAGAGTGTGGTGGG - Intergenic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077518287 11:3015681-3015703 GTGGGTGGGCAGACAGAGGAGGG + Intronic
1078090484 11:8261915-8261937 GTGTGTAGGAAGAGAGAGGATGG - Intronic
1078567266 11:12426907-12426929 TTCTGGGGGCAGAATGAGGATGG + Intronic
1078854736 11:15197802-15197824 GTGTGTGGGCTGGTGGTGGAAGG - Intronic
1079254054 11:18811271-18811293 GAGAGTGGGCAGCTGGAGGATGG + Intergenic
1079366919 11:19817555-19817577 GGGCCTGGGCAAATTGAGGATGG + Intronic
1079367107 11:19819054-19819076 GTGGGTGGGTAGATGGATGAAGG - Intronic
1080450450 11:32374792-32374814 GTGAGTGGGCAGATGGAGTCAGG - Intergenic
1081645993 11:44791171-44791193 GTGTGAGGGGAGACTGAGAAAGG - Intronic
1082182132 11:49132956-49132978 GAGTGTGGGCAGAGTGATGTAGG - Intergenic
1083293668 11:61703652-61703674 GTGAGTGGGTAGATGGAGGATGG + Intronic
1083657308 11:64235689-64235711 TTGTGAGGGCAGAGTGGGGAGGG + Intronic
1083757500 11:64799562-64799584 GTGTGTGTGCAGATTTTGGGGGG - Intronic
1084556426 11:69878860-69878882 GTGTGTTGGTGGAGTGAGGATGG - Intergenic
1084563371 11:69916226-69916248 GGGTCTGGGCAGAGTGAGGCTGG + Intergenic
1084963857 11:72733234-72733256 GTGTAGGGGCAGACTGTGGAAGG + Intronic
1085528280 11:77176543-77176565 CTGTGTGGGCAAAGTGGGGAAGG + Intronic
1086588385 11:88482624-88482646 ATGTTTAGGCAGATTGAGGAGGG + Intergenic
1086683373 11:89701992-89702014 GAGTGTGGGCAGAATGATGTAGG + Intergenic
1086875245 11:92087941-92087963 TCGAGTGGGCAGAGTGAGGAGGG - Intergenic
1088558962 11:111092905-111092927 GTGTGTGGACACACTAAGGAAGG + Intergenic
1088809870 11:113385048-113385070 TTGTTTGGGCAGATTGAAGATGG - Intergenic
1089010009 11:115124446-115124468 GGGTTTGGGAAGATTGAGGAGGG + Intergenic
1089013996 11:115152075-115152097 GTGTGAGGGCACATTGGGAAAGG + Intergenic
1089310106 11:117552332-117552354 GTGTCTGTGTAGATTGGGGATGG - Intronic
1090058014 11:123439846-123439868 CTCTGTGGTCAGATTGTGGAGGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1094749529 12:33389824-33389846 TTGTGTGGGCAGGTGGATGAAGG - Intronic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1097702824 12:62838028-62838050 GTGGGTGGGCAGATCGGGGTGGG - Intronic
1098220029 12:68259620-68259642 CTTTGTGGGCAGATTGTGGCAGG - Intergenic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1098917125 12:76269168-76269190 GTGAGGGGTCAGATTGTGGAAGG - Intergenic
1100682777 12:96947332-96947354 CTGTGGGGGCAGATTTAGAAAGG + Intronic
1101109778 12:101474367-101474389 GTGGGTGGGGAGAGTGAAGAGGG - Intergenic
1101809872 12:108098444-108098466 GAGTGTGGGCAGATGGGGCAGGG - Intergenic
1102077636 12:110072834-110072856 GCGTGTGGGCAGGTGGAGGCAGG + Intronic
1103444827 12:120987997-120988019 GTGGGTGGGTAGATGGATGATGG - Intronic
1103444877 12:120988186-120988208 GTGGGTGGGTAGATGGATGATGG - Intronic
1103931783 12:124454471-124454493 GTCTGTGGGCAGATGGGGGTGGG - Intronic
1104094520 12:125544781-125544803 GGGTGTGGGCAGATTATGCAGGG + Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104598764 12:130138416-130138438 GTGTGTGGGGAGCTTGGGGAAGG - Intergenic
1104995340 12:132650750-132650772 GTGTGGGGGCAGACAGAAGAGGG - Intronic
1105377952 13:19862777-19862799 CTGGGTGGGCAAATTTAGGAGGG - Intronic
1105389325 13:19959617-19959639 CTGGGTGGGCAAATTTAGGAGGG + Intronic
1105954504 13:25268121-25268143 GTATGTGGACTGATGGAGGAGGG - Intronic
1106307774 13:28528632-28528654 GTGTGTGGACAGATGGAGACAGG + Intergenic
1107232584 13:38128262-38128284 GTGTGGGAGGAGAGTGAGGATGG - Intergenic
1107418773 13:40225756-40225778 GTGTGTTGGCAGATTTGGCAGGG + Intergenic
1107458025 13:40573034-40573056 TAGTGTGGGCACATTGAGGAGGG - Intronic
1107908755 13:45085681-45085703 GTGTGGGGGCAGGTGGTGGATGG - Intergenic
1109102383 13:58201611-58201633 GTGTGTGTGTATCTTGAGGAGGG - Intergenic
1110656379 13:78004977-78004999 GTGTCTGTGCATATTGGGGAGGG + Intergenic
1114550037 14:23527457-23527479 GTGTGTTGGCTGGGTGAGGACGG - Intronic
1116260830 14:42623570-42623592 TTGTGTGGGAAGATGGGGGAGGG + Intergenic
1117645452 14:57846854-57846876 GTCTGTTTGGAGATTGAGGAGGG - Intronic
1121569271 14:94935231-94935253 GTCAGTGAGCAGATTAAGGAAGG - Intergenic
1121582575 14:95041846-95041868 GTGTGTGGGCAGTATGTGGTGGG - Intergenic
1122774082 14:104109606-104109628 GTGTGTGGTGGGCTTGAGGAGGG + Intronic
1123058836 14:105585356-105585378 GTGGGTAGGCGGATGGAGGATGG - Intergenic
1124400497 15:29343703-29343725 GTGTGTGGGAAGGATGAGGGAGG + Intronic
1126532287 15:49724669-49724691 GTGTGTGGGCAGTTGGGGGGTGG - Intergenic
1127448843 15:59096626-59096648 GTATGTGTGCAGATGGACGATGG + Exonic
1127454675 15:59145940-59145962 TCGTGAGGGCAGCTTGAGGATGG - Intronic
1127973717 15:63982025-63982047 GTCTGTAGGCAGGTTAAGGATGG + Intronic
1128720423 15:69943657-69943679 GTGTGTGGGCTCCTTGAGGAAGG - Intergenic
1128782976 15:70375178-70375200 GTGTGCGGGGAGGTGGAGGAGGG - Intergenic
1130557683 15:84934294-84934316 GTGTGTGTACATGTTGAGGAGGG + Intronic
1130841723 15:87707060-87707082 GTGTGTGGGTGGATTCAGGCAGG + Intergenic
1130975356 15:88769452-88769474 GTGGGTGGGGAGAGTGGGGAGGG - Intergenic
1132644692 16:993550-993572 GTGAGTGGGTGGATGGAGGATGG - Intergenic
1134236301 16:12468776-12468798 GGGTTTGGGAAAATTGAGGAGGG + Intronic
1134522711 16:14925891-14925913 GGGTGTGGGCGGGTTGGGGATGG + Intronic
1134710381 16:16324542-16324564 GGGTGTGGGCGGGTTGGGGATGG + Intergenic
1134718552 16:16368830-16368852 GGGTGTGGGCGGGTTGGGGATGG + Intergenic
1134949223 16:18344103-18344125 GGGTGTGGGCGGGTTGGGGATGG - Intergenic
1134956200 16:18383329-18383351 GGGTGTGGGCGGGTTGGGGATGG - Intergenic
1135909595 16:26546988-26547010 TTCTGTGGACAGATTCAGGAAGG + Intergenic
1136173510 16:28502513-28502535 GAGTCTGGGCACATGGAGGAAGG - Intronic
1137393337 16:48099497-48099519 GTGTGTTGGCATTTTAAGGAAGG + Intronic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137580101 16:49628339-49628361 ATGGGTGGGTAGATAGAGGATGG - Intronic
1137655633 16:50155303-50155325 GTGTGTGTGTAGCTTGAGTATGG + Intronic
1138273328 16:55711939-55711961 GGGTGTAGGCAGACTGCGGAGGG - Intergenic
1138598378 16:58041418-58041440 CAGTGTGGGGAGATCGAGGAGGG + Intronic
1139504480 16:67392199-67392221 GTGGGTGTGAAGATGGAGGATGG - Intronic
1139940868 16:70604523-70604545 ATGTGTTGGCAGACAGAGGATGG - Intronic
1139957696 16:70700945-70700967 ATGTGAGGGCAGGCTGAGGAGGG + Intronic
1140473774 16:75228663-75228685 GAGTGAGGGCAGATTGGGGCAGG - Intronic
1140869941 16:79096933-79096955 ATCTGTGGGCATATTGGGGAGGG + Intronic
1140986619 16:80163956-80163978 GTGTGGGTGCAGATGCAGGAGGG + Intergenic
1141527196 16:84618738-84618760 GGGGGTGGGGAGAATGAGGAAGG - Intergenic
1142106909 16:88309247-88309269 GTGTGCTGGCAATTTGAGGAGGG + Intergenic
1142860293 17:2756630-2756652 GTGTGTGGGATGATTTGGGATGG - Intergenic
1143619291 17:8071984-8072006 GAGAGTGGGAACATTGAGGAAGG + Intergenic
1144343003 17:14326053-14326075 GTGTGTGTGCATTTTCAGGAAGG + Intronic
1144583748 17:16475314-16475336 GTGTGTGTGGAGAGAGAGGAAGG + Intronic
1146111039 17:30089742-30089764 GTGTGTGGGCAGTTTGGGCTGGG - Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146931364 17:36780476-36780498 TTTTGTGGTCAGATTTAGGAGGG - Intergenic
1147266391 17:39237300-39237322 GTGTGTGGTCAGGCAGAGGAGGG + Intergenic
1147363401 17:39945039-39945061 GTGGGGGGGCAGGTTGAGGAGGG + Intergenic
1147540329 17:41351927-41351949 GGGTGTGGGTAGAGTGATGAAGG + Intergenic
1147668396 17:42163179-42163201 GTGGATGGGCAGATGGATGACGG + Intronic
1148202012 17:45755721-45755743 GTGGCTGGGCAGATGGTGGATGG - Intergenic
1148804443 17:50257250-50257272 TGGTGTGGGCAGATGGAGAAGGG + Intergenic
1149773861 17:59342169-59342191 TTGTATTGGCAGATTTAGGATGG + Intronic
1150284090 17:63945782-63945804 GTGTGTGTGCAGGTTGGGGGTGG + Intronic
1152253230 17:79222659-79222681 GTGTGGGGGGACATGGAGGAGGG - Intronic
1153479981 18:5537629-5537651 GTGTGAGGCCTGATTGTGGAAGG - Intronic
1153597495 18:6742521-6742543 GTGGATGAGCAGATTGTGGATGG + Intronic
1155083891 18:22436875-22436897 GGGTTTGGGAAGTTTGAGGAGGG - Intergenic
1155300500 18:24425009-24425031 GTGCTTTGGGAGATTGAGGAGGG + Intergenic
1155623260 18:27805950-27805972 GTGTGTAGAAAAATTGAGGATGG - Intergenic
1156688830 18:39681843-39681865 GTGGGTGGGCAGGCAGAGGAAGG + Intergenic
1157412956 18:47479153-47479175 GTTTGTGGGCAGAATGAGTATGG + Intergenic
1157620801 18:49016595-49016617 GGGTGGGGGAAGACTGAGGAGGG + Intergenic
1159928239 18:74288254-74288276 GTGTGTGGTGAGATGGTGGAGGG - Intronic
1160589299 18:79933741-79933763 GTGTGTGGGGAGATGGGGGCGGG - Intronic
1160905980 19:1451935-1451957 GTGTGTGGCCAGGTGGAGGAGGG + Exonic
1161705812 19:5820920-5820942 GTGTCTGAGCAGAGTGAGGAGGG - Intergenic
1162186337 19:8907726-8907748 GGGGCTGGGCAGAGTGAGGAGGG + Intronic
1162806228 19:13139268-13139290 GGGTGTGGGGAGATGGAGGGAGG - Exonic
1163198728 19:15746366-15746388 GTGCCTGGGGAGATTGAGGTGGG - Intergenic
1163609880 19:18295299-18295321 GTGGATGGGCAGATGGTGGATGG - Intergenic
1163642096 19:18467686-18467708 GTGTGTGGGGAGATTGTGTGTGG - Intronic
1163642111 19:18467757-18467779 GTGTGTGGGGAGATTGTGTGTGG - Intronic
1163642147 19:18467898-18467920 GTGTGTGGGGAGATTGTGTATGG - Intronic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1163727509 19:18931300-18931322 GTGTGTGGGCACAAGGAGGTGGG - Intronic
1164588200 19:29490806-29490828 TTGTGTGTGCATGTTGAGGATGG - Intergenic
1165144329 19:33721798-33721820 ATGTGTGGGCAGATAGGTGATGG + Intronic
1165382671 19:35492175-35492197 GTGTGGGGGCAGCGTGAGGATGG - Intronic
1165395054 19:35559372-35559394 GTATCTGGGCAGACTGGGGAAGG - Intronic
1165803588 19:38567212-38567234 GTGTGTGGGGAGGCTGAGGTGGG + Intronic
1166047705 19:40239050-40239072 GTGTGTGTGCAGAATAAGCAGGG - Intronic
1166921185 19:46230174-46230196 GTGTTTGGGAAGCTGGAGGAGGG + Intronic
1167673925 19:50873206-50873228 GTGTGAGGTCAGATTGGGCAGGG - Intronic
1167906001 19:52661340-52661362 GTGTGTGGACATTTTCAGGAGGG - Intronic
924994272 2:342619-342641 GTGTGTAGGCTGATTGAGAGTGG - Intergenic
925018377 2:548885-548907 GTGTTTGGGCAGATGAAGAAGGG - Intergenic
925191929 2:1892094-1892116 GCGCGTGGACAGGTTGAGGATGG + Exonic
925363524 2:3295754-3295776 GTGTGTGTGCAGAGAGAGGACGG - Intronic
925363538 2:3295822-3295844 GTGTGTGTGCAGGGAGAGGATGG - Intronic
925363547 2:3295859-3295881 GGGTGTGTGCAGAGAGAGGATGG - Intronic
925363568 2:3295960-3295982 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363587 2:3296060-3296082 GTGTGTGTGCAGAGAGAGGAGGG - Intronic
925363655 2:3296375-3296397 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
925993175 2:9269884-9269906 GTGTGTGGGGACAGTGGGGACGG - Intronic
926441385 2:12892371-12892393 GTGTGTGAGCTGATAGAGTAAGG - Intergenic
926596549 2:14796616-14796638 ATGTCTGGGCAGATAGAGGCGGG + Intergenic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
926803395 2:16682619-16682641 AAGAGTGGGCAGGTTGAGGAGGG + Intergenic
927114742 2:19888966-19888988 GTGTGGAGGCAGATGGAGCAAGG - Intergenic
927431178 2:23027537-23027559 GTGTGTGGCCAGGGTGTGGAAGG - Intergenic
928538503 2:32262526-32262548 GTGCTTGGGGAGACTGAGGAGGG + Intronic
929109663 2:38396125-38396147 GTTTGTGGGGAGAGGGAGGAGGG - Intergenic
929537399 2:42792389-42792411 GTGAGGGCGCAGATGGAGGAGGG + Intronic
929822059 2:45281752-45281774 GGGTGTGAGCAGATGGAGGTGGG - Intergenic
931997020 2:67848471-67848493 GTCTGTGGGGAGAATGATGAGGG - Intergenic
931998238 2:67859459-67859481 GTGTGTGTGCACATGGAGGGTGG - Intergenic
934498924 2:94837738-94837760 GTCTGTGGGTAGAATGAGAATGG - Intergenic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
935755738 2:106275123-106275145 GGGTGGGGGCAGAGTGAGGGTGG + Intergenic
936072052 2:109377556-109377578 GTGTTTGGGAAAATTGTGGATGG + Intronic
936789601 2:116135388-116135410 GTGTGTGGGCAGAGGGAGCGAGG + Intergenic
938250591 2:129812900-129812922 GTGTGTGGGCAGGTGTGGGAGGG - Intergenic
938468906 2:131542591-131542613 GTGTTTGGGTAGATGGAGGGGGG - Intergenic
939031873 2:137086398-137086420 GGGTGTGGGCAGATAGAAAATGG - Intronic
941708023 2:168680473-168680495 GTCAGTGAGCAGATGGAGGAAGG - Intronic
942447154 2:176085657-176085679 GTGTGTCGGCAGAAAGAAGAGGG - Intergenic
943683963 2:190796931-190796953 CTGTGTGGGAAGTCTGAGGAGGG + Intergenic
948662451 2:239515672-239515694 GTGGGTGTGCAGAATGAGCAGGG - Intergenic
948915792 2:241034536-241034558 GGGTGGGGGCAGAGTGAGGGAGG - Intronic
1169357372 20:4918914-4918936 GTGTGTGCACACATTGAGGAGGG - Intronic
1172083128 20:32358316-32358338 GTGTGTGTGAAGAGTGAGGAGGG - Intergenic
1174456365 20:50651514-50651536 GTGGGAGGGTAGATTGAGTAGGG - Intronic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175801825 20:61805366-61805388 CTGTGTTGGCAGATGGAGGTGGG + Intronic
1179543761 21:42100900-42100922 GTGGGTGGGGAGGGTGAGGAGGG - Intronic
1181479829 22:23191705-23191727 GGGTGTTTGCAGATTGAAGATGG + Intronic
1182060690 22:27395040-27395062 GTGAGTGAGCAGATGGATGAGGG + Intergenic
1183597732 22:38822522-38822544 GTGCGTGGGCAGGCTGAGGAGGG + Exonic
1183841682 22:40502987-40503009 GTGTGTGGGTGTATTGGGGAAGG - Intronic
1185193439 22:49453132-49453154 GTGGATGGGCAGATGGATGATGG + Intronic
1185193478 22:49453345-49453367 GTGGATGGGCAGATGGATGATGG + Intronic
949930191 3:9072318-9072340 GTGTGTGGGAACATGGAAGAGGG - Intronic
950162510 3:10771074-10771096 ATGTTTGGGCAGTTCGAGGATGG + Intergenic
950251445 3:11468932-11468954 GTGTGTGGGCAGATTGAGGATGG + Intronic
950678508 3:14569096-14569118 GCGTCTGGGCAGAGTGGGGAAGG - Intergenic
950961333 3:17111162-17111184 GTGTGTGGGCTGAAGAAGGAAGG - Intergenic
951040506 3:17983931-17983953 GTTTGTGGCCAGAATGGGGAAGG - Intronic
951270155 3:20614848-20614870 GTTTGTGGCCAGATTGTGGGGGG + Intergenic
951407856 3:22323256-22323278 GTCTGTGGGCAGGGTCAGGAAGG - Intronic
951594578 3:24303447-24303469 AGCTGTGGGCTGATTGAGGATGG - Intronic
951806983 3:26656326-26656348 TTGTGCGGGCAGTTTGAGGGTGG + Intronic
951847925 3:27104273-27104295 GTGTGTTGGAAGTTTGAGCAGGG - Intergenic
952903070 3:38122211-38122233 CTCTGTGGGCAGTTTGGGGAAGG - Intronic
956470931 3:69566207-69566229 GTGTGTGGGCAAGGTGAGGAGGG - Intergenic
957657106 3:83094391-83094413 GTGTGGGTGCAAATTGAGTAAGG - Intergenic
958552770 3:95637714-95637736 TTATGTGGGCAGAGGGAGGATGG + Intergenic
959289670 3:104457821-104457843 GTGTGTGTGCAAAATGAGGTCGG - Intergenic
961092611 3:124127462-124127484 GTTTGGGGTCAGATTGAGAAGGG - Intronic
961789723 3:129366733-129366755 GTGTGCGGGCAGCCTGGGGAGGG - Intergenic
962403887 3:135083838-135083860 GTTTCTGGGCAGCTTGGGGATGG - Intronic
962820241 3:139041749-139041771 GTGGGTGGGGAGATAGGGGAGGG + Intronic
964378869 3:156076097-156076119 GGGTGGGGGCAGACTGGGGATGG - Intronic
964793863 3:160477337-160477359 GGGTGTGGTGAGAATGAGGAAGG + Intronic
966183484 3:177207601-177207623 GTGTGTGGGCGGGTTGGGGTTGG + Intergenic
966614016 3:181895214-181895236 GTGTTTTGGGAGATTGAGGCAGG + Intergenic
967028676 3:185586170-185586192 GCGCGTGCGCAGATTGAGAATGG + Exonic
967575894 3:191092086-191092108 GTGTGTGTGCAGATAGAGAGAGG - Intergenic
967827391 3:193888371-193888393 GTGTGTGAGGAGCCTGAGGAGGG + Intergenic
968594734 4:1476501-1476523 GTGGGTGGGTAGATGGATGATGG + Intergenic
968741381 4:2333264-2333286 GTGGGGGGGCAGCTTGGGGAGGG - Intronic
970879099 4:20906856-20906878 GTATCTGGGAAGAATGAGGAAGG + Intronic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
972869459 4:43279347-43279369 GTGTGTGGGTAGATCGTGGATGG + Intergenic
974077159 4:57177699-57177721 GTCTGTGAGCATATTGAGAAAGG - Intergenic
975174250 4:71269405-71269427 GGGTGTGGGCAGATTCTGAACGG + Intronic
977447458 4:97148855-97148877 GTGTGGGGGTAGATTAAAGAGGG + Intergenic
977628741 4:99217914-99217936 GTCTCTTGGCAGATTGAGGTTGG + Intronic
977677262 4:99761881-99761903 AGGTGTGGGCAAATTGAAGAAGG - Intergenic
977952597 4:102990770-102990792 GTGCATGGACACATTGAGGAAGG + Intronic
978912836 4:114084707-114084729 GGGTGTGGGCAGCTGGAGAAAGG + Intergenic
979127736 4:116997827-116997849 GTGTTTTGGGAGACTGAGGAAGG + Intergenic
980094449 4:128474889-128474911 GTCTGTGAGGAGAATGAGGAAGG + Intergenic
982206993 4:153004295-153004317 GTGTGTGGGGAGGAGGAGGAAGG + Intergenic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
984078412 4:175213256-175213278 GTTTGTAGGCAGATAGATGAAGG + Intergenic
985549528 5:525907-525929 GGGTGGGTGCAGATGGAGGATGG + Intergenic
985674250 5:1222603-1222625 GTGTGTGTGCATATTCAGGCAGG + Exonic
985856348 5:2430193-2430215 GCGTGTGCGCAGCTTGAGGCTGG - Intergenic
986781725 5:11072763-11072785 GTGTCTGGGCAGCCTGAGGCCGG - Intronic
987323529 5:16792456-16792478 ATGTGAGAGCTGATTGAGGATGG - Intronic
988835003 5:35023689-35023711 GTTTGTGGGCAGATTGGAGAAGG + Intronic
994431359 5:99666050-99666072 GGATTTGGGCAGATTGAGGTTGG + Intergenic
995453731 5:112330882-112330904 GAGTGTGGACAGGGTGAGGAGGG + Intronic
996082566 5:119271799-119271821 GGATGTGGGCAGTGTGAGGAGGG - Intronic
997709648 5:135993178-135993200 GTGTGTGTGGGGCTTGAGGAAGG - Intergenic
998230966 5:140361174-140361196 GTGTCTGGGCAGAGGGAGAAGGG + Intronic
998421277 5:141989090-141989112 GTGTGTGTCCAGAGTGAGCAAGG + Exonic
1000153552 5:158527854-158527876 GTGTCTGGGGGGATTGTGGAAGG + Intergenic
1000155049 5:158542048-158542070 CTGTTTTGGCAGATTCAGGAAGG + Intergenic
1000473406 5:161674958-161674980 ATATGTGTGCAGATTGAGCATGG + Intronic
1000951248 5:167485930-167485952 GTGTGTGTGCACATAGATGAAGG - Intronic
1001082257 5:168676076-168676098 GTGGGTGGGTAGATGAAGGATGG - Intronic
1002015989 5:176323232-176323254 GCATTTGGACAGATTGAGGAAGG + Intronic
1004580734 6:16949000-16949022 GTGTGTTGGCACATTGTGGGAGG - Intergenic
1004772064 6:18795449-18795471 GTGTGGGGGCAGGGTGAGGAAGG - Intergenic
1005955028 6:30657629-30657651 GTGTGTGGGAGGAGTGAGGGAGG - Intronic
1005959204 6:30684255-30684277 GTGTATGTGCAGAGCGAGGAAGG + Intronic
1006107123 6:31723521-31723543 GTGTGTGGGAAGATCCAGGATGG + Intronic
1006390329 6:33754584-33754606 GTGTGTGGGCAGGCCAAGGATGG - Intergenic
1006404709 6:33838196-33838218 GTTTGCGGGCAGAGGGAGGAGGG + Intergenic
1006517940 6:34555035-34555057 GTGTGTGTGCATGTTGGGGAGGG - Intronic
1006699408 6:35959672-35959694 GGGAGTGGGCAGGTTGAGAAAGG + Intronic
1006893735 6:37452405-37452427 GTGTGTGGGCAGAATGAGCCAGG + Intronic
1008237527 6:49068324-49068346 GTGGGTGGGCAGACTGAGGATGG + Intergenic
1008424671 6:51343421-51343443 GTGTGTGGGGGGCTAGAGGAGGG - Intergenic
1009819297 6:68779340-68779362 GTTTGTGGGGAGAATGAGGGGGG - Intronic
1011586659 6:88933403-88933425 GTGTGTGGGCAGGAGGAGCATGG - Intronic
1012208330 6:96489320-96489342 GTGTGTGTGATGAGTGAGGAAGG - Intergenic
1012218351 6:96616901-96616923 GTGTGGGGGAAGAGTGGGGAGGG - Intergenic
1015465342 6:133542806-133542828 GTGTGTGTGCAGAGGAAGGAGGG + Intergenic
1015540027 6:134304511-134304533 GTGTGGTGGCAGACTGAGGCAGG + Intronic
1016362919 6:143287119-143287141 GTGTGTGGGAGGGTTGATGATGG - Intronic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017242598 6:152187509-152187531 TGGTGTGGGAAGACTGAGGAAGG - Intronic
1018060000 6:160082794-160082816 GTGTGTTGCCAGATGGCGGATGG + Intronic
1018441650 6:163819636-163819658 GTGTGAGGGCAAATTTATGAAGG - Intergenic
1018677478 6:166235672-166235694 GTGTGTGGGTAGAAAGAGGGAGG + Intergenic
1018706305 6:166465779-166465801 GTCTGTGAGCAGCTGGAGGACGG + Intronic
1019067658 6:169315929-169315951 GTGTGTGTGCAGACACAGGAGGG - Intergenic
1019347861 7:539426-539448 GTGTGTGGGCAGGTAGAGGAGGG - Intergenic
1019351057 7:554130-554152 ATGTGGGGGCAGATGGCGGAGGG + Intronic
1019474657 7:1238247-1238269 GGGTGGGGGGAGATGGAGGACGG - Intergenic
1019920043 7:4157540-4157562 GTGGGTGGGCAGATGGAAGCGGG + Intronic
1020899176 7:13982614-13982636 GTGTGTGGGCGGGGAGAGGATGG - Intronic
1021628825 7:22623520-22623542 GTGTGTGGGGGCATTGGGGAGGG - Intronic
1021923430 7:25510627-25510649 GTGGGTGGGCTGAGTGGGGATGG + Intergenic
1022010521 7:26304527-26304549 GGGTGTGGGCAGATGGGAGAGGG + Intronic
1022557800 7:31317195-31317217 GTGTGTGCACAGATTTAGGGTGG - Intergenic
1022808125 7:33843460-33843482 GTGTGTGAGCTGAGTGAGGCTGG + Intergenic
1023517237 7:41013651-41013673 GTGAATGGGCTGATTTAGGAGGG + Intergenic
1023537811 7:41231928-41231950 GTGTGGGAGCAGAGTGAGGCCGG - Intergenic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023878714 7:44306825-44306847 GAGTGTGAGTAGAATGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023981372 7:45072579-45072601 GAGTGCGGGCAGCTTGATGAAGG + Intronic
1025959908 7:66210715-66210737 GAGTTTGGGCAGATTGAGGTGGG + Intronic
1026873968 7:73869437-73869459 GCCTGCGGGCAGACTGAGGAGGG - Intergenic
1027348712 7:77288506-77288528 GTGTAGGGGTAGACTGAGGAAGG - Intronic
1027619605 7:80467328-80467350 TTGTGTGTGCAGATTGACGTAGG + Intronic
1027974070 7:85126429-85126451 GTGTGTGTGTAGGTTGGGGAAGG + Intronic
1028025199 7:85828580-85828602 CTGTGCTGGCCGATTGAGGATGG - Intergenic
1030711441 7:112754632-112754654 GTGGGTGGGGAGATAGGGGAGGG - Intergenic
1031648691 7:124259274-124259296 GTATGTTGGCAGATGGAGGCAGG + Intergenic
1032183843 7:129706183-129706205 GTGTGAGGCCAGATTGTGGTGGG + Intronic
1032777685 7:135131032-135131054 GTGTGTGTCCAGAGTGAGCAAGG + Intronic
1032787770 7:135214122-135214144 GTGTCAGGGCAGATGGAGGTGGG - Intergenic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1035170942 7:157017211-157017233 GGGTGGGGGCAGATTTAAGATGG + Intergenic
1039043478 8:33429578-33429600 GGGGGAGGGCAGATGGAGGAAGG + Intronic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1039620101 8:38989066-38989088 GTTTGTGGGCAGATGGATGATGG + Exonic
1039826705 8:41180476-41180498 GTGTTTGGGCAGAGTGAGGATGG - Intergenic
1042036533 8:64540099-64540121 GTGGGTGGGGAGACTGAGGTAGG + Intergenic
1043459663 8:80446626-80446648 ATGAGTGGGCAGAATGAGCAGGG + Intergenic
1044984842 8:97748349-97748371 GTGTGTGGGGAGGGTTAGGAGGG - Intergenic
1045851258 8:106701246-106701268 GTGTGTGTGCAGTTTGGTGAGGG - Intronic
1045949997 8:107840730-107840752 TTGTGTGGGCACATAGTGGAGGG - Intergenic
1046079593 8:109355140-109355162 ATGTGTAGGCATATAGAGGAAGG - Intergenic
1046549860 8:115702139-115702161 GTGTATGGTCAGATTCATGAAGG + Intronic
1048173715 8:132132642-132132664 GTGTGTGTGCAGGTGGAGAAGGG + Intronic
1048612039 8:136033539-136033561 GAGTGAGGGCAGAATCAGGAGGG + Intergenic
1049073123 8:140372472-140372494 GTGTGTGGACAGGTGAAGGAAGG - Intronic
1049364217 8:142228927-142228949 ATGTGTGAACAGATTGTGGATGG + Intronic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1049407170 8:142456958-142456980 GTCTGAGGCCAGAGTGAGGAGGG - Intronic
1049749890 8:144278076-144278098 GTGCGTGGCCTGACTGAGGAGGG + Intronic
1049774703 8:144398935-144398957 GTGTGTGGGCAGGTAGGGGGCGG - Intronic
1050174838 9:2859012-2859034 GAGTGTGGCCAGCTTGAGGGAGG - Intergenic
1050598702 9:7229219-7229241 GTGTGTGTGCATATTAGGGATGG + Intergenic
1051044453 9:12856573-12856595 GTGAGGGGGCAGATGGATGAAGG + Intergenic
1051584208 9:18710118-18710140 GAGTGTGGGAAGCTGGAGGAGGG - Intronic
1053601598 9:39616362-39616384 TTGTGTGGGAAGATTGTAGATGG + Intergenic
1053654045 9:40197552-40197574 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1053658233 9:40242817-40242839 GTCTGTGGGTAGAATGAGAATGG + Intronic
1053859245 9:42370129-42370151 TTGTGTGGGAAGATTGTAGATGG + Intergenic
1053904433 9:42826729-42826751 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1053908607 9:42872091-42872113 GTCTGTGGGTAGAATGAGAATGG + Intergenic
1054251935 9:62726084-62726106 TTGTGTGGGAAGATTGTAGATGG - Intergenic
1054366160 9:64343768-64343790 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054370355 9:64389092-64389114 GTCTGTGGGTAGAATGAGAATGG + Intronic
1054526365 9:66133404-66133426 GTCTGTGGGTAGAATGAGAATGG - Intronic
1054530552 9:66178785-66178807 GTGTTTGGGTAGATGGAGGAGGG - Intergenic
1054566050 9:66760585-66760607 TTGTGTGGGAAGATTGTAGATGG - Intergenic
1054673789 9:67833498-67833520 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054677985 9:67878848-67878870 GTCTGTGGGTAGAATGAGAATGG + Intronic
1055469533 9:76597612-76597634 GTGGGTGGACAGCTTGAGGGGGG - Intergenic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1057379594 9:94555783-94555805 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1058058812 9:100474135-100474157 GTGTGTGTGCAGAGTGCGGTGGG + Intronic
1058994378 9:110285372-110285394 GTGTGTGGGCAATGGGAGGAGGG + Intergenic
1060172639 9:121474457-121474479 GGGTGAGGGTAGAGTGAGGAAGG - Intergenic
1061393695 9:130331870-130331892 GTGTGGGGGCAGTGAGAGGATGG + Intronic
1061923674 9:133795645-133795667 GTGTGTGGGTAAACTGAGGCAGG - Intronic
1062351654 9:136142573-136142595 GAGTGTGGGGAGGTTGGGGAGGG - Intergenic
1062403425 9:136382392-136382414 GTGTGTGGGCAGCGAGGGGAGGG - Intronic
1062590252 9:137271357-137271379 GTGTGCGGACAGGTTGAGGATGG - Intronic
1062637400 9:137498744-137498766 GTGTGTGGACAGACTGTCGAGGG + Intronic
1186816041 X:13239029-13239051 GAAAGTGGGCAGACTGAGGAGGG - Intergenic
1186987666 X:15034254-15034276 GTGTGAGGACAGATGGAGAATGG + Intergenic
1188143814 X:26585870-26585892 TTGTGTTGGCAGATTTTGGATGG + Intergenic
1188206986 X:27372455-27372477 GTGTGGGGGCACATGGAGGGAGG - Intergenic
1188627589 X:32305749-32305771 GTGAGTGTCCAGATTGTGGAGGG - Intronic
1188736858 X:33727396-33727418 GTGTGTGGGGAGGTGGGGGAGGG - Intergenic
1188955537 X:36431596-36431618 GTGTGTGGGTAGAGGGAGGGAGG + Intergenic
1189378079 X:40481213-40481235 ATTTGTGGGAAGATGGAGGAAGG - Intergenic
1190693313 X:52930597-52930619 GTGGGTGGGGGGATAGAGGAGGG + Intronic
1192300409 X:69895383-69895405 GTGTGTGTGTAGGTTGAGAAAGG - Intronic
1192300492 X:69896423-69896445 GTGTGTGTGTAGGTTGAGAAAGG + Intronic
1192555218 X:72083915-72083937 GTGTGTGGGCAGGGGGAGTAAGG - Intergenic
1194166522 X:90522612-90522634 GTTTCTGGGCACTTTGAGGAAGG + Intergenic
1196627994 X:117899983-117900005 TTCTGTGGGCAGAGTGAGGGTGG + Intronic
1198119969 X:133582778-133582800 CTGTGTGGGCAGAATCAGAAGGG + Intronic
1198934444 X:141891274-141891296 GTATGTGTGCATTTTGAGGAAGG + Intronic
1199696855 X:150348732-150348754 GTGTGTGGGCATTTTGAGGTGGG - Intergenic
1199905392 X:152223549-152223571 GTGGCTGGCCAGAGTGAGGAAGG - Intronic
1200354904 X:155538540-155538562 AGGTGTTGGCAGTTTGAGGATGG - Intronic
1200512791 Y:4100393-4100415 GTTTCTGGGCACTTTGAGGAAGG + Intergenic
1202167230 Y:22002798-22002820 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202318985 Y:23612089-23612111 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202551784 Y:26057968-26057990 GTTGCTGGGCAGATGGAGGATGG - Intergenic