ID: 950252264

View in Genome Browser
Species Human (GRCh38)
Location 3:11475594-11475616
Sequence GCTGATCTGCAGACTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950252264_950252269 16 Left 950252264 3:11475594-11475616 CCCTCTGCAGTCTGCAGATCAGC 0: 1
1: 0
2: 3
3: 20
4: 235
Right 950252269 3:11475633-11475655 CTCTCACCCAAAGCAGAACATGG 0: 1
1: 0
2: 1
3: 8
4: 203
950252264_950252272 30 Left 950252264 3:11475594-11475616 CCCTCTGCAGTCTGCAGATCAGC 0: 1
1: 0
2: 3
3: 20
4: 235
Right 950252272 3:11475647-11475669 AGAACATGGCAAGCTCCTGAAGG 0: 1
1: 0
2: 0
3: 20
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950252264 Original CRISPR GCTGATCTGCAGACTGCAGA GGG (reversed) Intronic
900560997 1:3306235-3306257 ACTGAACTGCCCACTGCAGATGG - Intronic
900919684 1:5662429-5662451 GATGAGCTGAAGACTGCACAGGG + Intergenic
901012004 1:6207367-6207389 GCTTCTCTGCAGACACCAGACGG + Exonic
902451950 1:16501755-16501777 GCTCACCTGCTCACTGCAGAGGG + Intergenic
902501005 1:16911909-16911931 GCTCACCTGCTCACTGCAGAGGG - Intronic
902869960 1:19308058-19308080 GCTGCTATGCAGACGGCACAGGG + Intronic
903759633 1:25688989-25689011 GCTGATCTGCTGGCTGCAGAGGG - Intronic
904481123 1:30794011-30794033 GCTGATCTGAACAATGAAGAGGG - Intergenic
905402468 1:37713709-37713731 GCAGATCTGCAGAAGCCAGATGG - Intergenic
905795996 1:40817019-40817041 TCTGAGCTGCAGCCTGCAGCAGG + Intronic
906119589 1:43380094-43380116 GCTGAGCTGCAGATTCCTGATGG - Intergenic
909949288 1:81700690-81700712 GCTGTTCTGTATACTCCAGAAGG + Intronic
912132900 1:106623662-106623684 GCTAATATCCAGACTGCACAAGG - Intergenic
912370530 1:109170746-109170768 GCTGGGCTGCAGCATGCAGAGGG + Intronic
913281581 1:117190104-117190126 GCTGATCTGCAGTCCAAAGATGG - Intronic
913517952 1:119621243-119621265 GCTGAGCTGGAGAATGCAAAAGG + Exonic
914332564 1:146685859-146685881 GCTCATCTACCGACTGGAGAAGG + Intergenic
914493889 1:148174777-148174799 GCTGGTCTGGAGATTCCAGATGG - Intergenic
915215819 1:154340261-154340283 GCTGAGGTGCTGACTCCAGAGGG - Intronic
915722525 1:157995034-157995056 GGAGATGTACAGACTGCAGATGG + Intronic
916441552 1:164830797-164830819 GTTGATCTGCAGACTACACTTGG - Intronic
917964297 1:180168818-180168840 GCTGACCTGGAGACTGCTGGTGG + Intronic
918164586 1:181932321-181932343 GCTGATGTTCTGATTGCAGAAGG - Intergenic
918546758 1:185693460-185693482 GCTGATCTGAAGACTACATTTGG - Intergenic
918564131 1:185906855-185906877 CCTGATATGGAGACTGAAGAGGG - Intronic
919426736 1:197441758-197441780 TCTGCCCTGCAGACTCCAGATGG + Intronic
920056829 1:203198910-203198932 TCTGCTCTGGAGACTCCAGAAGG + Intergenic
920126831 1:203700205-203700227 GGTGATCTGCTGCCTGCAGATGG + Exonic
920363217 1:205433640-205433662 GCTGGGCTGCAGACAGCAGAGGG + Intronic
922489118 1:226000968-226000990 GCTGGGGAGCAGACTGCAGAGGG - Intergenic
923610799 1:235491685-235491707 GCTGATCTACAGAGATCAGAGGG - Intronic
924061693 1:240181651-240181673 GGTGTTCTGCAGACTTCAAAAGG - Intronic
1067274692 10:44823202-44823224 GATGATATCCAGACTCCAGAGGG + Intergenic
1067747480 10:48946953-48946975 GCTCACCTGCAGAGCGCAGAAGG - Exonic
1068265247 10:54639971-54639993 GCTGATCTGGAGGCTGAGGAAGG + Intronic
1070660878 10:78304389-78304411 GGTACTTTGCAGACTGCAGAGGG - Intergenic
1073267540 10:102236958-102236980 GCTGAACTGCAGTGTGCAAATGG + Intronic
1073511613 10:104046070-104046092 GCTGCTCTGCAGGCTCCAGGTGG - Intronic
1074293376 10:112158684-112158706 GCTGATAAGCAGTCTTCAGAGGG - Intronic
1075957841 10:126539156-126539178 GCAGATCAGGAGACTTCAGAAGG + Intronic
1076624578 10:131813720-131813742 GCAGATATGCAGGATGCAGAGGG - Intergenic
1076743872 10:132502994-132503016 GCTGAACTGCACACTTCAGAGGG + Intergenic
1076825971 10:132968442-132968464 CCTGTTCTCCAGCCTGCAGATGG + Intergenic
1076861902 10:133141726-133141748 CCTCATCTGAACACTGCAGAGGG - Intergenic
1077187606 11:1242418-1242440 GCTGACCTGCAGCCTGGAGACGG + Exonic
1084000848 11:66294657-66294679 GCTGATCCGCCGGCTGCAGCAGG + Exonic
1084031805 11:66485475-66485497 GCTGATCCGCAGGCTGAACAAGG + Intronic
1084670578 11:70604340-70604362 GCAGATCTGCACATGGCAGATGG + Intronic
1086370519 11:86151511-86151533 GCTGATCCTCACTCTGCAGATGG - Intergenic
1086501598 11:87459317-87459339 GCTGCTATGGAGACTGGAGACGG - Intergenic
1087595121 11:100243822-100243844 GCTAATTTGGAGACTGAAGAGGG - Intronic
1088732602 11:112696388-112696410 GCTGACATGAAGACTGGAGAAGG - Intergenic
1091947418 12:4561002-4561024 GTGTATGTGCAGACTGCAGAGGG - Intergenic
1092263249 12:6963377-6963399 GCTGAGCTTGGGACTGCAGAGGG + Intergenic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098702397 12:73645609-73645631 TCTGATCATCAGGCTGCAGATGG - Intergenic
1102425786 12:112843448-112843470 GCTCATCTGCAGTCTGCAGATGG + Intronic
1102471673 12:113163033-113163055 GCTGATGCTCAGGCTGCAGAGGG + Exonic
1104948653 12:132428795-132428817 GCTGAGCTGCAGGCTGAAGTCGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107349250 13:39496915-39496937 TCTGATGTGCAGGCTGCAGGTGG + Intronic
1107536544 13:41340786-41340808 GCTGATCTGGAGACTGAGGCAGG - Intronic
1107949302 13:45447301-45447323 GTTGATCTCAACACTGCAGAGGG + Intergenic
1108498235 13:51045565-51045587 GCTCTTATGCAGCCTGCAGAGGG - Intergenic
1109174111 13:59134171-59134193 CCTGAACTAAAGACTGCAGACGG - Intergenic
1111567944 13:90041342-90041364 GTTTATCTGCAGACTTCTGAGGG + Intergenic
1113421221 13:110173045-110173067 GCTTATCTCCAGACGGCAGCAGG - Intronic
1113482134 13:110628768-110628790 GCAGACCCGCAGCCTGCAGATGG - Intronic
1114311992 14:21476558-21476580 GCTTATCTGTAAACTGCAGGAGG + Exonic
1114429007 14:22644579-22644601 GCTGAGCAGAAGACTGGAGAGGG - Intergenic
1115658678 14:35468484-35468506 GCTGATCTGCAGAATGATGAAGG + Intergenic
1116236950 14:42291155-42291177 GCTGATCAGTAAACTGCAAATGG + Intergenic
1118416376 14:65541341-65541363 CCTGTTCTCCAGCCTGCAGATGG - Intronic
1121298201 14:92847352-92847374 TCTGAGCTGCAGACTGCAGGAGG + Intergenic
1121603447 14:95223260-95223282 GCCAATCTGCACACAGCAGAGGG + Intronic
1122405332 14:101497311-101497333 GCAGCTCCTCAGACTGCAGAGGG + Intergenic
1122532724 14:102440150-102440172 GCTGCTCTAAAGACTGCAGACGG - Intronic
1122536412 14:102466691-102466713 ACTGAGCTGCACACTGTAGAAGG - Intronic
1122805027 14:104252240-104252262 GCTGGGCTGGAGCCTGCAGATGG + Intergenic
1122932517 14:104940944-104940966 ACTGACCTGCAGCCTCCAGAGGG - Exonic
1124882945 15:33659108-33659130 GCTGATGTGCAGTGGGCAGAGGG + Intronic
1125458732 15:39887947-39887969 GCTGATCACCAGCCTGGAGAGGG + Intronic
1127322703 15:57863244-57863266 CCTGGTCTGCAGGCTCCAGATGG - Intergenic
1127627279 15:60792179-60792201 GCTTAACAGCAGACTGGAGATGG + Intronic
1130603613 15:85295434-85295456 GCTGATCTGCAGCAGGGAGAGGG - Intergenic
1130815378 15:87426579-87426601 GCTGATATGCAGATGGCAGAAGG - Intergenic
1132141679 15:99402389-99402411 CCTGATCCGGAGCCTGCAGAGGG + Intergenic
1133932672 16:10244957-10244979 GCTGGGCTGCAGACTGGTGAAGG + Intergenic
1135905164 16:26505369-26505391 GCTGTTTTGCAGATGGCAGAAGG - Intergenic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1137829370 16:51528963-51528985 GCTTATCTGCACATTACAGATGG + Intergenic
1138165547 16:54798212-54798234 GGTAATCTTCAGACTGCAGAAGG + Intergenic
1138295919 16:55885087-55885109 GCTAAGCTGCACACTGCAGAAGG - Intronic
1138519684 16:57563838-57563860 GCTGACCTCCTGCCTGCAGAGGG - Exonic
1138653245 16:58473791-58473813 TCTGTTCTGCACATTGCAGAAGG + Intronic
1138908485 16:61367533-61367555 CCTGATCTGCAGTCTGAACAGGG - Intergenic
1138928562 16:61622943-61622965 GTTCATCAGCAGACTTCAGATGG - Intergenic
1139356341 16:66369048-66369070 ACTGAGGTGCAGGCTGCAGAGGG - Intronic
1139483489 16:67243866-67243888 GCTGAGCTGCAGACTGGTGAGGG - Intronic
1140001050 16:71025382-71025404 GCTCATCTACCGACTGGAGAAGG - Exonic
1140042512 16:71417934-71417956 GGTGAGCTGCAGCCTCCAGAGGG - Intergenic
1140616073 16:76665841-76665863 ACTGAGCTGCAGACTGCAGAAGG - Intergenic
1141041032 16:80672667-80672689 GCTGGCCTGCAGCCTCCAGATGG - Intronic
1141151156 16:81565472-81565494 GCTGAGCTGCAGTCTGCACCAGG - Intronic
1141190355 16:81820293-81820315 GGGGGGCTGCAGACTGCAGAGGG - Intronic
1141701945 16:85646694-85646716 GCTGGCCTGCAGCCTGCAGCGGG - Intronic
1142927997 17:3258192-3258214 ACTGGTCTGCAGACTCCAGGAGG + Intergenic
1143809082 17:9455948-9455970 GATGAGCTGTACACTGCAGATGG - Intronic
1144712995 17:17414647-17414669 GCTGATTTGCAAACCTCAGATGG + Intergenic
1145218002 17:21066634-21066656 GCTGATCTCCAGAATGGAGATGG + Intergenic
1147591028 17:41683447-41683469 CTTGATCTGCAGCCTGCACAGGG - Intergenic
1148781056 17:50122244-50122266 GCTGGCCTGCAACCTGCAGAGGG + Intronic
1152930089 17:83104944-83104966 TCTGATCTGCAGCCAGCACAGGG - Intergenic
1154197053 18:12274300-12274322 GGGGGTCTGCAGACTGCACAGGG + Intronic
1156059219 18:33053162-33053184 GCTGATGTCCAGACACCAGATGG - Intronic
1159090396 18:63842012-63842034 GCTAATCTTCACACTGCACAAGG - Intergenic
1160437826 18:78865446-78865468 GCTCATGTACAGAATGCAGAGGG + Intergenic
1160503076 18:79411736-79411758 GAGGATCTGGAGACTTCAGATGG - Intronic
1161345469 19:3766946-3766968 GCTGATCTGAAGGCTGGGGAGGG + Intronic
1161651098 19:5485576-5485598 GCTGATCTGCAGATGTGAGAAGG + Intergenic
1161971478 19:7583500-7583522 TGTGAGCTGCAGACTGCAGCTGG + Intergenic
1162017464 19:7853261-7853283 CCCGATCTGCAGGCTGGAGAAGG + Exonic
1162473002 19:10883501-10883523 GCAGATCTGGAGGCTGCTGAGGG - Intronic
1162781014 19:13007052-13007074 GCTGAGCTCCAGGCTGCAAAGGG - Intronic
1163929276 19:20373583-20373605 GCTGCTGTTCATACTGCAGAAGG + Intergenic
1164760094 19:30722198-30722220 ACTTTTCTGAAGACTGCAGAAGG - Intergenic
1164865066 19:31597908-31597930 ACAGAGCTGCAGACTCCAGAAGG - Intergenic
1166766558 19:45254608-45254630 TATGATCTGCAGTCTTCAGACGG - Intronic
925142094 2:1557701-1557723 GCTGACCTCCACCCTGCAGACGG + Intergenic
925386482 2:3465404-3465426 GCTGCTCTCCCGACTGCAGTCGG - Intronic
925872363 2:8282384-8282406 CCTGGTCTCCAGATTGCAGACGG - Intergenic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
927757031 2:25717042-25717064 ACTGATCTGGAGAGTCCAGATGG - Intergenic
927850402 2:26495068-26495090 GCTGACCTGCAGGCAGGAGAAGG + Exonic
929461993 2:42109128-42109150 GCTGATCTGGAGGCTGAAGTGGG + Intergenic
932194363 2:69770352-69770374 ACTGGTCTGCAGATTGCAAAGGG - Intronic
934974268 2:98789508-98789530 GTTCTTCTGCAGACTGCTGAAGG + Intergenic
936526011 2:113242118-113242140 GCTGAGCTGGGGACTGCAGTGGG + Exonic
937144395 2:119629939-119629961 TCTGACCTGCAGATTGAAGAAGG - Exonic
937605195 2:123792080-123792102 TCTTATCTGTAGAATGCAGATGG - Intergenic
941684282 2:168431828-168431850 GCTCATGTGCAGATTGCAGATGG + Intergenic
943089754 2:183360074-183360096 CTTGATCTGCTCACTGCAGAGGG - Intergenic
943289593 2:186051875-186051897 GCTGCTCTGCACAGTTCAGAAGG - Intergenic
943739062 2:191391188-191391210 GCTCCTCTGCAGGCTGAAGAAGG + Intronic
947458798 2:230283809-230283831 GCTGCTCTGCAGCCTGAAGGAGG + Intronic
947469041 2:230382977-230382999 GCTGCTCTGCAGCCTGAAGGAGG + Intronic
948014509 2:234677084-234677106 ACTCAGATGCAGACTGCAGATGG - Intergenic
1169901121 20:10552522-10552544 TCAGAACTGCAGGCTGCAGAGGG + Intronic
1170119260 20:12894135-12894157 GCTGATATGCAGAGTGCTGAGGG - Intergenic
1170159479 20:13297197-13297219 GCTGTTTTCCAGAATGCAGAAGG + Intronic
1170484437 20:16802325-16802347 GATGATCTCAAAACTGCAGAGGG + Intergenic
1170846537 20:19966643-19966665 GCTGACCTGGAGACTTCAGAGGG - Intronic
1172853003 20:37980078-37980100 CGTGATCTGCAGGCTGTAGAAGG - Intergenic
1174127022 20:48314162-48314184 GCAGATCTACACACAGCAGAGGG - Intergenic
1176377624 21:6094288-6094310 GATGGGCTGCAGACTCCAGACGG - Intergenic
1178584799 21:33862891-33862913 CTTGGTCTGCAGACTTCAGAGGG + Intronic
1179317803 21:40260394-40260416 GCTGAACTGCAAAGAGCAGATGG + Intronic
1179745851 21:43443956-43443978 GATGGGCTGCAGACTCCAGACGG + Intergenic
1180920710 22:19520163-19520185 GCTGAGCAGCAGAGTGCCGAGGG + Intronic
1181504902 22:23346896-23346918 GCTGAGATGCAGACTGCTCAAGG - Intergenic
1181580866 22:23827406-23827428 GCCACTCTGCAAACTGCAGAGGG - Intronic
1181709890 22:24677143-24677165 GCTGAGATGCAGACTGCTCAAGG - Intergenic
1182619677 22:31612015-31612037 GTTCTTATGCAGACTGCAGACGG - Intronic
1185041541 22:48506924-48506946 GGTGATTTGGAGCCTGCAGAAGG + Intronic
1185339816 22:50286282-50286304 CGTGGTCTGCAGACAGCAGAGGG + Exonic
949653451 3:6188647-6188669 GCTGATATGCTGATTGGAGATGG + Intergenic
950252264 3:11475594-11475616 GCTGATCTGCAGACTGCAGAGGG - Intronic
950913732 3:16621478-16621500 GCAGATCTGCAGACTGTCCAGGG - Intronic
950955259 3:17046203-17046225 GCTGAACAGGAGTCTGCAGAGGG + Intronic
950969010 3:17167954-17167976 GATGCTCTGCAAACTGCGGATGG + Intronic
952500949 3:33961477-33961499 TCTGATTTCCACACTGCAGATGG + Intergenic
954009833 3:47626256-47626278 GCTGTTCAGGAGACTGCAGCAGG - Intronic
954570718 3:51638542-51638564 GCTGAGTTGCACACTGCAGGGGG - Intronic
955202360 3:56862462-56862484 GTTGACCTTCAGACTGCAAATGG - Intronic
955931988 3:64066592-64066614 ACTGAACTGCAGAATGGAGAAGG + Intergenic
958255891 3:91324468-91324490 TCTGATGTGCAAAGTGCAGAAGG + Intergenic
959800235 3:110485640-110485662 CCTGATCTCCAGCCTGAAGAAGG - Intergenic
961648204 3:128403877-128403899 CCAGATCTCCAGACAGCAGAAGG - Intronic
965661352 3:171045435-171045457 GCTGATTTGCAGGGTGCTGAGGG + Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968262319 3:197335321-197335343 GCAGATCTGTAAACAGCAGAGGG + Intergenic
968359464 3:198137218-198137240 GGTGTTCTGCAGCCTCCAGAGGG - Intergenic
970599453 4:17629359-17629381 CCTCATCTGCAGAATCCAGATGG + Exonic
973297061 4:48536064-48536086 ACAGATCTTCAGACTGAAGAAGG - Intronic
975578656 4:75887669-75887691 GGTCACCTGCAGCCTGCAGATGG - Intronic
976879834 4:89906821-89906843 GCAGATCAGCAGACTGCTCATGG - Intronic
984240860 4:177218018-177218040 GAAGATCTGGAAACTGCAGATGG + Intergenic
985865614 5:2511772-2511794 GCTGACCTGGACTCTGCAGAGGG + Intergenic
986801525 5:11265476-11265498 GCTCCTCTCCACACTGCAGACGG + Intronic
988638487 5:33014936-33014958 CCTAATCTGCAGAGTCCAGATGG + Intergenic
988971514 5:36473011-36473033 GCTGATCTGTAGTCTTCATAAGG - Intergenic
989570780 5:42944247-42944269 GGAGAGCTGGAGACTGCAGAGGG + Intergenic
990283389 5:54275538-54275560 GCTCATGTGCAGGCTGCAGGAGG - Intronic
991503973 5:67305389-67305411 GCTCATCTGCAAATTGCAGAAGG - Intergenic
991920865 5:71655517-71655539 GCTGTGCTGCAGGCTTCAGAGGG + Intronic
992432397 5:76722102-76722124 TCAGATATACAGACTGCAGAAGG + Intronic
993937918 5:94026163-94026185 GCTGTTCATCAGGCTGCAGACGG - Intronic
995739116 5:115335928-115335950 GCTGATCTGCAGCCCAGAGAGGG - Intergenic
996523533 5:124452762-124452784 CCTGGTTTGCAGAGTGCAGAGGG + Intergenic
996909444 5:128638414-128638436 GCTGGTCTGAAGCCTGCACATGG + Intronic
999095235 5:148972182-148972204 GCTGATCTGCAGTCTACTGTAGG - Intronic
999709889 5:154308702-154308724 GATGAGCTGCAGACTGGAGGTGG - Intronic
1000187501 5:158873881-158873903 GTTGATCTGCATACTGCTGGTGG - Intronic
1000444201 5:161299929-161299951 ACTGTTCTGCATACTGAAGATGG - Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1002436119 5:179232409-179232431 GCTTATCTTCATTCTGCAGATGG + Intronic
1002457995 5:179356567-179356589 GCAGGACTGCAGCCTGCAGAGGG - Intergenic
1002575512 5:180171723-180171745 GCTGTTCTCCAGAGTGCCGAAGG - Intronic
1003444118 6:6169294-6169316 GCTGGTGTGCAGACCGCAGGAGG - Intronic
1003954562 6:11149780-11149802 TGTGACCTCCAGACTGCAGAAGG - Intergenic
1005499249 6:26415639-26415661 GCTGCTTTGAAGACTGAAGAAGG - Intergenic
1006809769 6:36812305-36812327 GCTGATGTGGAGACTGTACAGGG + Intronic
1006812323 6:36827902-36827924 GCTGCTGTGCAGACAGCGGAAGG - Intronic
1007663711 6:43502273-43502295 GCTGTTCTGCAGCCTGAAAAGGG - Exonic
1008062116 6:47009456-47009478 GCAGCTGTGCAGACTCCAGAAGG + Exonic
1008999450 6:57696705-57696727 TCTGATGTGCAAAGTGCAGAAGG - Intergenic
1009187936 6:60596109-60596131 TCTGATGTGCAAAGTGCAGAAGG - Intergenic
1009473473 6:64057941-64057963 GCTGCTTTGGAGACTGCAGTGGG - Intronic
1010759462 6:79706430-79706452 ACTGTTCTGCAGATTGTAGATGG - Intergenic
1012746778 6:103101126-103101148 CCTGATCCTCAGCCTGCAGATGG + Intergenic
1013292400 6:108730657-108730679 GCTACTCTGCAGACTGCTGTGGG - Intergenic
1015373106 6:132478626-132478648 GCCTATCTGGAGAATGCAGAAGG + Intronic
1018585623 6:165354601-165354623 GTCCATCTGCAGACTTCAGATGG + Intronic
1019260536 7:79457-79479 GGTGTTCTGCAGCCTCCAGAGGG + Intergenic
1021387586 7:20050798-20050820 GCTGAGAGGCAGACTGTAGAAGG - Intergenic
1027196613 7:76034932-76034954 ACTGAGCTGCAGACTCTAGAAGG + Intronic
1028848156 7:95506274-95506296 GCAGGTCTGAAGACTCCAGAAGG - Intronic
1029664328 7:101985254-101985276 GCTGCTCTGCAGACGGGAGAGGG + Intronic
1030789685 7:113708283-113708305 GCATATCTGCAGAGTGCAGTTGG - Intergenic
1039306262 8:36266675-36266697 GCTGATATGGAGGCTGTAGAAGG - Intergenic
1039665791 8:39526022-39526044 ACTGATCTGTAGACTGCTTAGGG - Intergenic
1039793140 8:40891398-40891420 GCTGCTCTGCCCTCTGCAGATGG + Intronic
1042420207 8:68579616-68579638 GCTGATCTGCAGAGCGCACTTGG - Intronic
1044935545 8:97290346-97290368 GATGATGTGCAGGCTGCAGCAGG - Intergenic
1048292545 8:133191804-133191826 GACACTCTGCAGACTGCAGAGGG - Intronic
1049526242 8:143128124-143128146 GCTGATTTACAAACAGCAGAAGG - Intergenic
1052430147 9:28355671-28355693 GCTGATCAGCAGGCTCCAGGAGG + Intronic
1052742604 9:32407820-32407842 ACTGATGTGCTGTCTGCAGAGGG + Intronic
1053102784 9:35385237-35385259 ACTGTTCTGCAGCCAGCAGATGG - Intronic
1053218539 9:36292792-36292814 GCTGACCTGCAGAGGGCAGGAGG - Intronic
1056680031 9:88709057-88709079 CCAGTTCTGCAGATTGCAGATGG - Intergenic
1057701415 9:97365788-97365810 CATGATCAGCAGACTGCAGAAGG - Intronic
1058956068 9:109949951-109949973 GCTTATGTGTAGACTGAAGATGG - Intronic
1061315093 9:129790432-129790454 GCTTATCTGCAACCTCCAGATGG - Intergenic
1185743776 X:2555180-2555202 TCTGCTCTGGAGACTCCAGAAGG - Intergenic
1186438874 X:9567603-9567625 ACAGCCCTGCAGACTGCAGATGG - Intronic
1189292205 X:39894520-39894542 GCTCTTCTGCGGATTGCAGAGGG - Intergenic
1190153531 X:47968155-47968177 GCTGATCTGAAGTCTGTTGAGGG - Intronic
1190715084 X:53096441-53096463 GCTGTCCTGTACACTGCAGAGGG + Intergenic
1191097858 X:56693105-56693127 GCTGTTCTGAAGACTACAGCAGG + Intergenic
1192436928 X:71148737-71148759 GCTGCTCTGCAGGCGGCACATGG - Intronic
1192580781 X:72279132-72279154 GCTCCTCTGCAGACTGCTGAGGG - Intronic
1194459151 X:94144616-94144638 TCTGATTTGTAGACAGCAGATGG + Intergenic
1195041775 X:101021275-101021297 GCTGATAGGGAGACTGCTGATGG + Exonic
1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG + Intronic
1197318609 X:124999882-124999904 GCTTATCTACACACTGCTGATGG - Intergenic
1198975811 X:142333938-142333960 GCTGATCTGTGGAGTGCACAGGG - Intergenic
1199052613 X:143254354-143254376 CTTGATCTTCAGCCTGCAGATGG + Intergenic
1200755211 Y:6984450-6984472 ACGGCCCTGCAGACTGCAGATGG - Intronic