ID: 950252267

View in Genome Browser
Species Human (GRCh38)
Location 3:11475605-11475627
Sequence CTGCAGATCAGCAGGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950252267 Original CRISPR CTGCAGATCAGCAGGTGATC AGG Intronic
901606232 1:10461523-10461545 CTGCAGGTCACCAGGTGGTGAGG + Exonic
901798882 1:11695847-11695869 CTCGAGTTCAGCAGGTGAGCGGG + Intronic
902790473 1:18764505-18764527 CAGCAGAGTAGCAGTTGATCTGG + Intergenic
905523253 1:38616331-38616353 CTGCAGATGAGCTTGAGATCAGG + Intergenic
905920850 1:41717709-41717731 CTGCAGATCAGTGGCTGAGCAGG + Intronic
907391896 1:54163594-54163616 CTGCATAGAAGCAGGTGTTCGGG + Intronic
908326526 1:63028912-63028934 CTGCAGATCAGCAGGTCACCTGG - Intergenic
909152116 1:72020259-72020281 CTCCAGATAAGCAAGTGTTCAGG - Intronic
910485190 1:87705362-87705384 CTGCACAGCAGGAGGTGAGCAGG + Intergenic
910752798 1:90652734-90652756 CTGCATTTCAGCAGTTGATGGGG - Intergenic
919922348 1:202174169-202174191 CTGAACGTCAGCAGGTGAGCTGG + Intergenic
924074585 1:240320140-240320162 CTACAGATCTGCAAATGATCAGG + Intronic
924381327 1:243467573-243467595 CTTCATATCAGCATCTGATCAGG + Intronic
1062761711 10:27738-27760 CTGCAGATCAGGAGGTCCCCTGG + Intergenic
1065507057 10:26439194-26439216 CAGCAGGTCAGCAGGTCAGCAGG + Intronic
1065507058 10:26439202-26439224 CAGCAGGTCAGCAGGTCAGCAGG + Intronic
1068584937 10:58787453-58787475 CTGCTCCTCAGAAGGTGATCTGG - Intronic
1069956245 10:72053764-72053786 CAGCAGCTCAGCAAGTGAACAGG + Intergenic
1070527280 10:77306134-77306156 CTGCAGCTCAGCAGGCTCTCAGG - Intronic
1071572502 10:86705723-86705745 TTTCAGATCTGCAGGTGCTCAGG + Intronic
1072237871 10:93468792-93468814 CTGCAGATCAGAGGGAGAGCTGG + Intronic
1073231258 10:101972665-101972687 ATGCAGAGCAGCAGGTGTTAAGG - Intronic
1074063367 10:109989193-109989215 TTGGAGAACATCAGGTGATCTGG - Intergenic
1074430038 10:113386665-113386687 CTGCAAAGCATCAGGTGATCTGG + Intergenic
1076299541 10:129414647-129414669 CTGCAGAGAAGCCGCTGATCTGG - Intergenic
1076460985 10:130647328-130647350 CTGGGGATCAGCAGGAGAGCTGG + Intergenic
1076752154 10:132548769-132548791 TTGCATATCAGCAGTTTATCTGG + Intronic
1077109934 11:857898-857920 GTCCAGATCACCAGGTGATGAGG - Intronic
1077466660 11:2736724-2736746 CTGCAGATGCGCAGGTGAAATGG - Intronic
1077579550 11:3407968-3407990 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1077859888 11:6168462-6168484 CTGCAAATCAGCAGTTGATTTGG + Intergenic
1077917078 11:6618374-6618396 CTGCAGATCAGCTGGGGAGCTGG + Intronic
1079249107 11:18774244-18774266 CTGGTGAACAGCAGGTGCTCAGG + Intronic
1080598098 11:33793683-33793705 CCGCAGATCAGCAGTTGCTTGGG - Intergenic
1080683061 11:34493857-34493879 CTGCAGAATAGAAGGTGACCTGG - Intronic
1080790255 11:35516148-35516170 CTGCAGATTGGAAGGTGATAGGG + Intronic
1082986802 11:59175967-59175989 ATGCAGATCAACAGGTGAATGGG + Intronic
1083780045 11:64913093-64913115 TTGCAGATCGGCAGCTGCTCAGG - Exonic
1084835852 11:71801487-71801509 CTGCAGTTTAGGAAGTGATCAGG - Intergenic
1086365137 11:86101335-86101357 CTGAAGATCAGCAGGTGAAATGG + Intergenic
1086700768 11:89898267-89898289 GTGGAGATAATCAGGTGATCTGG + Intergenic
1086705401 11:89946260-89946282 GTGGAGATAATCAGGTGATCTGG - Intergenic
1091201767 11:133786038-133786060 CTGCAGCTCAGCAGCTCAGCAGG - Intergenic
1092407474 12:8230916-8230938 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1094115576 12:26908718-26908740 CTTCTGATCAGCAACTGATCTGG - Intronic
1096112473 12:49037760-49037782 CTGGGGGTCAGCAGGTGAGCTGG + Exonic
1096407453 12:51354288-51354310 CTCCAGAGAAGCTGGTGATCAGG + Exonic
1102225546 12:111225682-111225704 CTGGAGATCTGCAGGTGGTTAGG + Intronic
1105203915 13:18203321-18203343 CTTCAGATCATCAGATCATCAGG - Intergenic
1106169378 13:27275776-27275798 CTGCTGATCAGCAGGAGGCCTGG - Intergenic
1106502294 13:30340533-30340555 CTGCAGTTCTGCAGCTTATCAGG - Intergenic
1107318050 13:39155358-39155380 CAACAGATGAGCAAGTGATCTGG - Intergenic
1109059207 13:57591914-57591936 GTGCAGAAGAGCAGGTGGTCAGG - Intergenic
1115495733 14:34002554-34002576 CTGCAGGTCAGAAGTTGAACAGG - Intronic
1119012133 14:71004349-71004371 CTGCACAGCAGGAGGTGAGCAGG + Intronic
1122739230 14:103861584-103861606 AGGCAGATCAGCAGATGAGCTGG - Intergenic
1123011563 14:105352320-105352342 CTGCATATCAGCAGGAAACCAGG - Intronic
1123054014 14:105560793-105560815 CTGCAGAACAGCCTGTGGTCAGG - Intergenic
1123078599 14:105681210-105681232 CTGCAGAACAGCCTGTGGTCAGG - Intergenic
1123091954 14:105745880-105745902 GGGCAGATCTGCAGGTGAGCAGG - Intergenic
1124440470 15:29682105-29682127 CTGCAGCTCAGCATGGGACCTGG - Intergenic
1124853136 15:33360509-33360531 ATTCATATCAGCAGGTGAACTGG - Intronic
1135688815 16:24519941-24519963 CTTCAGAGCAACAGGTGATATGG + Intergenic
1135829961 16:25764222-25764244 CTGGAACTCAGCAGTTGATCTGG + Intronic
1136089964 16:27911632-27911654 CAGCAGAACAGCAGGTGCACAGG - Intronic
1136187280 16:28595797-28595819 GTGCTGATGAGCAGGTCATCAGG + Exonic
1136189758 16:28608722-28608744 GTGCTGATGAGCAGGTCATCAGG + Exonic
1139573792 16:67828969-67828991 CTGCCCCTCAGCAGGTGGTCAGG - Intronic
1140484439 16:75282657-75282679 CTGCACATCCTCAGGAGATCTGG + Intergenic
1141640913 16:85340752-85340774 CTGCAGGTCAGCAGGTCAAGGGG + Intergenic
1146936560 17:36815834-36815856 GTGAAGATCAGCAGATGTTCCGG + Intergenic
1147047921 17:37768432-37768454 CTGCAGATCAGGAAGAGATGAGG - Intergenic
1147496491 17:40921519-40921541 CTACAGCTCAGCATGTGATGTGG + Intergenic
1148591277 17:48818196-48818218 GTGCACATCAGCAGGTGAAGGGG - Intergenic
1149995069 17:61402002-61402024 CTGCAGCTGAGCAGGAGAGCAGG + Intronic
1152507577 17:80760724-80760746 CTGCCGGTCTGCAGGTGACCTGG + Intronic
1152534846 17:80944567-80944589 CTGCTCCTCAGCAGGTGGTCAGG + Intronic
1152539366 17:80967302-80967324 CTGCAGAGCAGAGTGTGATCTGG - Intergenic
1152626873 17:81391833-81391855 CTGCAGCTTTGCAGGTGAGCGGG - Intergenic
1152954618 18:28068-28090 CTGCAGATCAGGAGGTCCCCTGG + Intergenic
1153006831 18:504566-504588 ATGCAGATCATCAGCTGATCAGG + Intergenic
1153330757 18:3871340-3871362 CTCCTGATCAGAAGGTCATCTGG - Intronic
1153351317 18:4083744-4083766 ATGCAGATGAGCAGGTCATGGGG + Intronic
1155958078 18:31970782-31970804 ATGCAGATCAGCAGGAGAGGGGG - Intergenic
1156352968 18:36316670-36316692 CTGCAGAACAGCAGGCGCTGGGG - Intronic
1157257914 18:46154803-46154825 CTTCACACCAGAAGGTGATCTGG - Intergenic
1160304638 18:77720522-77720544 CTGCATATCATCTGGTGACCAGG + Intergenic
1161325630 19:3662387-3662409 CTGCAGATGTGAAAGTGATCTGG - Intronic
1162037450 19:7949410-7949432 CCGCAGAGCAGGAGGTGAGCAGG - Intergenic
1167168787 19:47817436-47817458 CTCCTGATCACCAGGTGATATGG + Intronic
925439493 2:3872144-3872166 CTGCACAGCAGAAGGTGAACGGG - Intergenic
925870005 2:8262214-8262236 CTGCAGTTCAGCTGCTGATAAGG - Intergenic
928358474 2:30643145-30643167 CTGCAGACAAGCAGCTGCTCTGG - Exonic
928593006 2:32836400-32836422 CTGCACATAAGCAGGAGATGGGG + Intergenic
930087203 2:47506186-47506208 CTGTAGAACAGCAAGTGAACAGG + Intronic
934162830 2:89268563-89268585 ATGCAAATCAGCAGGGGATAGGG + Intergenic
934204444 2:89913961-89913983 ATGCAAATCAGCAGGGGATAGGG - Intergenic
934790817 2:97058623-97058645 CTGGAAAGCAGCAGGAGATCTGG + Intergenic
934815637 2:97323907-97323929 CTGGAAAGCAGCAGGAGATCTGG - Intergenic
934818872 2:97354760-97354782 ATGCAAATCAGCAGGGGATGGGG - Intergenic
934822058 2:97384576-97384598 CTGGAAAGCAGCAGGAGATCTGG + Intergenic
934856357 2:97732715-97732737 CAGCAGATCTGGAGGTGATGGGG + Intronic
935196916 2:100821359-100821381 CTGGAGTTCAACAGGTGTTCAGG + Intronic
935264944 2:101386591-101386613 CTCCAGGTCAGAAGGTGATGGGG + Intronic
935734329 2:106094759-106094781 CTGTTAATCAGCAGTTGATCTGG - Intronic
936547615 2:113406282-113406304 ATGCAAATCAGCAGGGGATGGGG - Intergenic
938124414 2:128661547-128661569 CTGCCCATCAGCAGTGGATCAGG + Intergenic
939661397 2:144895101-144895123 CTGCAAAACAAAAGGTGATCAGG - Intergenic
941204648 2:162556965-162556987 CAGCAGATCAGTTGGTGTTCTGG + Intronic
941231413 2:162916153-162916175 CTGAAGAACAGGAGGTGAACAGG + Intergenic
946734842 2:222743982-222744004 CAGCAGATCAGCAGAAGACCAGG + Intergenic
1168987752 20:2064781-2064803 CTGCACAGCAGGAGGTGAGCGGG + Intergenic
1169351126 20:4868768-4868790 CTGGAGAACAGGAGGGGATCTGG + Intronic
1172901990 20:38342053-38342075 ATTCAGATCTGCAGGTGATGTGG + Intergenic
1172926284 20:38539212-38539234 CAGCAGATCAGCAGTTGCTTAGG + Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173266421 20:41487161-41487183 CTGCAGAAATGCAGTTGATCTGG + Intronic
1174024191 20:47559105-47559127 CTGAAGATCAGGAGGTCATAAGG - Intronic
1175881911 20:62264263-62264285 CTGCAGCTCAGCATGTGGCCAGG - Intronic
1176714055 21:10334764-10334786 CTTCAGATCATCAGATCATCAGG + Intergenic
1178199873 21:30391211-30391233 ATGCAGACCAGCAGGTCATGGGG - Intronic
1178344150 21:31810763-31810785 CTGCAGATCAGAGGGGGATATGG - Intergenic
1179880953 21:44293162-44293184 CTGAGGGTCAGCAGGTGAGCGGG + Exonic
1181688818 22:24546852-24546874 CTGCAGATCTGTGGGTGAGCAGG + Intronic
1184479513 22:44738393-44738415 TGGCAGATCAGCAGGTGAACGGG - Intronic
1185225294 22:49648516-49648538 CTGCAGATCTGGAGAGGATCAGG - Intronic
949617477 3:5770017-5770039 CTGCAGATGAGCAGGTCGTGGGG + Intergenic
950252267 3:11475605-11475627 CTGCAGATCAGCAGGTGATCAGG + Intronic
950416340 3:12870953-12870975 CTGCAGGCCAGCAGGTGCACTGG - Intronic
950765071 3:15267511-15267533 CTGCAGATTGGCAGGTGTTCCGG - Intronic
951459926 3:22940426-22940448 CTGCACAACAGGAGGTGAGCAGG + Intergenic
951472620 3:23072273-23072295 GAGCAGATCATCAGGTCATCTGG - Intergenic
951822392 3:26827304-26827326 CAGCAGATCAAGAGGTGCTCAGG - Intergenic
952039167 3:29241052-29241074 ATGCAGGTCAGCAGGTGCTGGGG + Intergenic
952658001 3:35809449-35809471 ATGAAGATCAGCAGGGGATGTGG - Intergenic
953658314 3:44871589-44871611 CTGCAGTTCAGCAGCTGGTGGGG + Intronic
956522484 3:70121236-70121258 CTGCACAGCAGGAGGTGAGCTGG - Intergenic
956838095 3:73112236-73112258 CTGTACATCAGCAGCTAATCGGG + Intergenic
957052517 3:75421290-75421312 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
960827585 3:121807335-121807357 CTACAGATCAACAGGTGACTTGG - Exonic
961214273 3:125147563-125147585 CTGCGGATGAGGAGGGGATCCGG - Intronic
961302325 3:125930264-125930286 CTGCAGTTTAGGAAGTGATCAGG - Intronic
961771889 3:129256062-129256084 CTGCACTTCAGCAGGTGCTGTGG - Exonic
961886134 3:130097521-130097543 CTGCAGTTTAGGAAGTGATCAGG + Intronic
964251673 3:154725119-154725141 CTGCATATAAGCAAGTTATCGGG - Intergenic
964857699 3:161164901-161164923 GTGCAGTTCAGCAGGTGAACAGG - Intronic
967986019 3:195095806-195095828 CTGCAGGTCAGCAGCTCAACAGG + Intronic
968331491 3:197874200-197874222 CTGCACAGCAGGAGGTGAACAGG + Intronic
968359105 3:198134070-198134092 CTGCAGATCAGGAGGTCCCCTGG - Intergenic
969230422 4:5826663-5826685 CTGGAGAACAGCATGTGTTCAGG + Intronic
969818632 4:9704591-9704613 CTGCAGTTTAGGAAGTGATCAGG - Intergenic
971025447 4:22584767-22584789 CTGCAGATCAGCGTGAGAACCGG + Intergenic
971419618 4:26463706-26463728 CTGCAGATAAGAACCTGATCTGG + Intergenic
976510593 4:85904462-85904484 TTGCAATTCAGCATGTGATCTGG + Intronic
976555704 4:86449108-86449130 CTGCACAGCAGGAGGTGAGCAGG - Intronic
976831774 4:89323270-89323292 CTGCAGCTCAGCAGGGCATATGG - Intergenic
981410419 4:144423879-144423901 CTGGAGATAAGCAGGTTATAAGG - Intergenic
982994801 4:162329335-162329357 CTGCAGCTAAGCTGTTGATCAGG - Intergenic
987852314 5:23372391-23372413 ATGAAGACCAGCAGCTGATCAGG + Intergenic
992140731 5:73794421-73794443 CAGCAGATCAGCAGCTGAAAAGG + Exonic
992151191 5:73905077-73905099 CTGCACAGCAGGAGGTGAGCTGG + Intronic
996045013 5:118862177-118862199 CTTCAGATCATCAGATCATCAGG - Intronic
998139424 5:139691451-139691473 CAGAAGATCAGCAAGTGAACAGG - Intergenic
998755993 5:145379901-145379923 CAGCAGACCAACAGGTGGTCAGG + Intergenic
1004365115 6:15006238-15006260 CTGCTAATCACCAGGTGAACTGG - Intergenic
1005326738 6:24709233-24709255 CTCCACAACAGCAGTTGATCAGG + Intronic
1006304445 6:33210761-33210783 CTGAAGATCTACAGGTAATCTGG - Intronic
1006804038 6:36777117-36777139 TTGCAGAGCAGCAGGGGAACTGG - Intronic
1008709710 6:54210171-54210193 CTGCAGACAAGCAGCTGCTCTGG - Intronic
1009499978 6:64399966-64399988 CTGCAGAACAGCAATGGATCAGG + Intronic
1010455157 6:76045752-76045774 CTGGAGAACAGCATCTGATCTGG - Intronic
1018376958 6:163221982-163222004 CTGAATATCGCCAGGTGATCAGG - Intronic
1018473306 6:164115273-164115295 CTGCAGGTCAGCAAGTTTTCAGG + Intergenic
1018850528 6:167587253-167587275 CTGCAGCTCCACAGGTGAGCCGG - Intergenic
1018910283 6:168097656-168097678 CTGCAGCCCAGCAGGAGAGCCGG - Intergenic
1020319599 7:6929989-6930011 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1022862882 7:34386124-34386146 CTGCACATCAGTAGGTGTCCTGG + Intergenic
1023277854 7:38539647-38539669 GTGCTGCTCAGCAGATGATCTGG - Intronic
1024310797 7:47967059-47967081 CTGCAGATCTGAAGGGGATGAGG + Intronic
1024322033 7:48080055-48080077 CTGCACACCAGGAGGTGAGCAGG + Intergenic
1026313785 7:69210893-69210915 CTGCAGAACAGGAGATGAGCAGG + Intergenic
1029206385 7:98871388-98871410 CTGCACAGCAGGAGGTGAGCAGG + Intergenic
1029648114 7:101870994-101871016 CTGCAGATGAGTAGGAGAGCGGG + Intronic
1031395029 7:121263272-121263294 CTGGAGATCAGGAGGAGATTTGG + Intronic
1034374117 7:150628166-150628188 ATGAGGATCAGCAGGTGGTCAGG - Exonic
1034393258 7:150801646-150801668 GCGCAGAGCAGCAGGTGAGCAGG - Exonic
1034786569 7:153931871-153931893 CAGCAGATCCTCAGCTGATCAGG - Intronic
1035791713 8:2312174-2312196 CTGCAGAGCAGGAGGTGAGTGGG - Intergenic
1035801092 8:2409531-2409553 CTGCAGAGCAGGAGGTGAGTGGG + Intergenic
1036234565 8:7027021-7027043 CTGCACATCAGCCAGTGAGCAGG - Intergenic
1038406107 8:27324224-27324246 CAGCAGGTCAGAAGGTGGTCAGG - Intronic
1039489278 8:37935634-37935656 CTGCAGATCAGCAGGTCTGCAGG + Intronic
1041645124 8:60243691-60243713 CTGCTGCAGAGCAGGTGATCTGG - Intronic
1042818869 8:72908707-72908729 CTGCAGAGCAGCAGGAGCGCAGG + Intronic
1044479876 8:92672883-92672905 CTTTAGATAAGCAGGTGATATGG - Intergenic
1045702298 8:104880969-104880991 CTGCAGAGCCGCAGGTGCTCAGG - Intronic
1048481056 8:134793667-134793689 CTGCACAGCAGGAGGTGAGCAGG - Intergenic
1048570503 8:135650922-135650944 CTGCAACACAGCAGGTGTTCAGG - Intronic
1049596051 8:143483849-143483871 CTGCTGTTCAGCAGGGGCTCCGG + Intronic
1049882494 8:145075813-145075835 CTGCAGATCAGGAGGTCCCCTGG - Intergenic
1050131266 9:2415180-2415202 CCACAGATCAGGAGGTGAGCAGG - Intergenic
1057607817 9:96513533-96513555 CTGCAGAGAAGAAGGTGAACTGG - Intronic
1057986576 9:99722509-99722531 AAGCAGATCAGCAGTTGATTGGG + Intergenic
1058884229 9:109311250-109311272 GTGCAGCTCAGCAAGTGAACAGG + Intronic
1059956033 9:119516767-119516789 CTGCAGATAATCATGTCATCTGG + Intronic
1060222658 9:121772858-121772880 CTGCAGCTCAGCTGGTGGCCGGG + Exonic
1186086890 X:6000464-6000486 CTGCTGGTCAGCAGCTGACCTGG + Intronic
1186939717 X:14492225-14492247 CTGCAGAACAGCAGGCTGTCAGG + Intergenic
1191199747 X:57767147-57767169 CAGCAGAGCAGCAGATCATCAGG - Intergenic
1194098274 X:89671207-89671229 CTGCTGCTCAGTAGGTGCTCAGG + Intergenic
1194579206 X:95650995-95651017 CTGCACAGCAGGAGGTGAGCTGG - Intergenic
1196024078 X:111021306-111021328 CTGCATACCAGCAGCTGCTCTGG - Intronic
1196104075 X:111877525-111877547 ATGGTGTTCAGCAGGTGATCAGG + Intronic
1199687848 X:150280291-150280313 CTGGAGATCTGAGGGTGATCTGG + Intergenic
1200451291 Y:3332585-3332607 CTGCTGCTCAGTAGGTGCTCAGG + Intergenic
1201509259 Y:14739866-14739888 CTGGTGATCAGCAGCTGACCTGG - Intronic