ID: 950253091

View in Genome Browser
Species Human (GRCh38)
Location 3:11483182-11483204
Sequence CTGGGTTAGGGGCAGGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3996
Summary {0: 1, 1: 1, 2: 15, 3: 305, 4: 3674}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950253091_950253108 25 Left 950253091 3:11483182-11483204 CCGTCCCCCTGCCCCTAACCCAG 0: 1
1: 1
2: 15
3: 305
4: 3674
Right 950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 159
950253091_950253104 15 Left 950253091 3:11483182-11483204 CCGTCCCCCTGCCCCTAACCCAG 0: 1
1: 1
2: 15
3: 305
4: 3674
Right 950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG 0: 1
1: 1
2: 1
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950253091 Original CRISPR CTGGGTTAGGGGCAGGGGGA CGG (reversed) Intronic
Too many off-targets to display for this crispr