ID: 950253104

View in Genome Browser
Species Human (GRCh38)
Location 3:11483220-11483242
Sequence AGTGATATCCCCATCCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 122}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950253093_950253104 11 Left 950253093 3:11483186-11483208 CCCCCTGCCCCTAACCCAGGTCA 0: 1
1: 0
2: 3
3: 33
4: 552
Right 950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG 0: 1
1: 1
2: 1
3: 9
4: 122
950253098_950253104 4 Left 950253098 3:11483193-11483215 CCCCTAACCCAGGTCATGGAGAG 0: 1
1: 0
2: 1
3: 10
4: 151
Right 950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG 0: 1
1: 1
2: 1
3: 9
4: 122
950253096_950253104 8 Left 950253096 3:11483189-11483211 CCTGCCCCTAACCCAGGTCATGG 0: 1
1: 0
2: 1
3: 25
4: 265
Right 950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG 0: 1
1: 1
2: 1
3: 9
4: 122
950253102_950253104 -3 Left 950253102 3:11483200-11483222 CCCAGGTCATGGAGAGGTAAAGT 0: 1
1: 0
2: 0
3: 15
4: 218
Right 950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG 0: 1
1: 1
2: 1
3: 9
4: 122
950253095_950253104 9 Left 950253095 3:11483188-11483210 CCCTGCCCCTAACCCAGGTCATG 0: 1
1: 0
2: 2
3: 23
4: 377
Right 950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG 0: 1
1: 1
2: 1
3: 9
4: 122
950253090_950253104 16 Left 950253090 3:11483181-11483203 CCCGTCCCCCTGCCCCTAACCCA 0: 1
1: 1
2: 7
3: 118
4: 1888
Right 950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG 0: 1
1: 1
2: 1
3: 9
4: 122
950253103_950253104 -4 Left 950253103 3:11483201-11483223 CCAGGTCATGGAGAGGTAAAGTG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG 0: 1
1: 1
2: 1
3: 9
4: 122
950253094_950253104 10 Left 950253094 3:11483187-11483209 CCCCTGCCCCTAACCCAGGTCAT 0: 1
1: 0
2: 0
3: 32
4: 402
Right 950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG 0: 1
1: 1
2: 1
3: 9
4: 122
950253089_950253104 17 Left 950253089 3:11483180-11483202 CCCCGTCCCCCTGCCCCTAACCC 0: 1
1: 0
2: 8
3: 99
4: 1534
Right 950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG 0: 1
1: 1
2: 1
3: 9
4: 122
950253099_950253104 3 Left 950253099 3:11483194-11483216 CCCTAACCCAGGTCATGGAGAGG 0: 1
1: 0
2: 1
3: 7
4: 136
Right 950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG 0: 1
1: 1
2: 1
3: 9
4: 122
950253091_950253104 15 Left 950253091 3:11483182-11483204 CCGTCCCCCTGCCCCTAACCCAG 0: 1
1: 1
2: 15
3: 305
4: 3674
Right 950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG 0: 1
1: 1
2: 1
3: 9
4: 122
950253101_950253104 2 Left 950253101 3:11483195-11483217 CCTAACCCAGGTCATGGAGAGGT 0: 1
1: 0
2: 1
3: 10
4: 188
Right 950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG 0: 1
1: 1
2: 1
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950253104 Original CRISPR AGTGATATCCCCATCCTCTC TGG Intronic
903736490 1:25532971-25532993 ATTCATAACCCCATCCTCTAAGG + Intergenic
906382142 1:45339736-45339758 ACTGAGCTCTCCATCCTCTCTGG + Exonic
907751169 1:57264687-57264709 CGTGATCTCCCCACCCTCCCAGG + Intronic
907782948 1:57583801-57583823 AATCATATCTCCATCTTCTCTGG + Intronic
909832130 1:80205288-80205310 AGTGGTATCCCCAATCTCTGAGG - Intergenic
915142657 1:153776813-153776835 AATGAAATCAGCATCCTCTCTGG - Intronic
920490424 1:206410130-206410152 TGTGAGCTACCCATCCTCTCTGG - Intronic
920977491 1:210799860-210799882 ACTTATATCCCCACCCCCTCAGG + Intronic
921572446 1:216795744-216795766 TGTGATGTCTCCTTCCTCTCAGG + Intronic
921832327 1:219742043-219742065 AGTGATATCATCATCCTGTGAGG + Intronic
922168445 1:223135213-223135235 AGTGAAATCATCTTCCTCTCAGG - Intronic
1063191130 10:3696015-3696037 AATGAGATCGCCATCATCTCAGG - Intergenic
1064550628 10:16497218-16497240 AGCCATATGCCCAGCCTCTCTGG + Intronic
1068390510 10:56390324-56390346 ATTGATAACCCCAACTTCTCTGG - Intergenic
1073123927 10:101138009-101138031 AAAGAAATCCACATCCTCTCAGG - Intergenic
1081594010 11:44446799-44446821 AGTGAGACCCCCTTCCTCTCTGG + Intergenic
1084066754 11:66708715-66708737 TGTGATTCTCCCATCCTCTCAGG - Intronic
1084312530 11:68325240-68325262 AGGGATGTCCCCAGCCTCACTGG + Intronic
1085170225 11:74443488-74443510 AGAGAAAACCCGATCCTCTCTGG + Intergenic
1090206563 11:124887529-124887551 AGTGGCATCCCCATCTGCTCTGG + Intronic
1091602342 12:1925496-1925518 AGTGCTCTCTCCATCCTCCCAGG - Intergenic
1091793138 12:3282962-3282984 TGTGACATCCCAAGCCTCTCGGG + Intronic
1092099121 12:5868866-5868888 ATTTATATCCCTGTCCTCTCTGG - Intronic
1094484704 12:30915214-30915236 TGTGACATCACCTTCCTCTCTGG + Intergenic
1097712473 12:62932261-62932283 AGGGCTCCCCCCATCCTCTCTGG - Intronic
1102474492 12:113179873-113179895 AGTGACATGGCCCTCCTCTCTGG - Intronic
1106580701 13:31015974-31015996 AGGGAAATGCCCAACCTCTCCGG - Intergenic
1111897485 13:94159177-94159199 AGTGATATGCCCAATGTCTCAGG - Intronic
1112196428 13:97231043-97231065 AGTGATATCTCCAATCACTCTGG - Intronic
1114720358 14:24874837-24874859 AGGAGCATCCCCATCCTCTCAGG - Intronic
1115553159 14:34522737-34522759 TGGGATATCCCTATCCTCTTTGG - Intronic
1120360308 14:83492968-83492990 AGAAATAGCCACATCCTCTCAGG - Intergenic
1120399211 14:84006869-84006891 ATTGTTATCCACATCCTCTCTGG + Intergenic
1120508801 14:85387083-85387105 AAAGGTATCCCCATCCTCTTGGG + Intergenic
1120846579 14:89131473-89131495 ATTCATATCCCCACCCTCTGTGG + Intronic
1121822473 14:96982592-96982614 ACTGAAATCTACATCCTCTCAGG - Intergenic
1121856912 14:97278568-97278590 AGAGTTATCCCCATTTTCTCTGG - Intergenic
1124200074 15:27671896-27671918 AGTGACAGCCCCATCCTTCCTGG + Intergenic
1129165141 15:73772802-73772824 TGTGATGTCCCGCTCCTCTCTGG - Intergenic
1129675589 15:77631332-77631354 AGAGCTCTTCCCATCCTCTCAGG + Intronic
1129795448 15:78372944-78372966 AGAGAGACCCCCTTCCTCTCAGG + Intergenic
1132233611 15:100202687-100202709 AGAGATACCCCCACCGTCTCAGG + Intronic
1132389729 15:101429425-101429447 AGTGATGTCCCCTACCTCACAGG - Intronic
1133000740 16:2850249-2850271 AGAGAAATCCCCACCCTCCCTGG + Intergenic
1135222155 16:20622785-20622807 AGTGAGAGCCCCAACCTCTAGGG - Intronic
1137807072 16:51317318-51317340 AGTGATATCCCAATGCTGTTTGG - Intergenic
1142183676 16:88684417-88684439 AATGCTTTCCCCATACTCTCTGG + Intronic
1143088825 17:4436457-4436479 AGTGATGTCTTCAGCCTCTCGGG + Intronic
1146462002 17:33053650-33053672 AATTATATCATCATCCTCTCTGG + Intronic
1147448384 17:40488795-40488817 AGTGAGAGCCTCATCTTCTCTGG - Exonic
1148027685 17:44599950-44599972 AGCCCTCTCCCCATCCTCTCGGG + Intergenic
1160118043 18:76100329-76100351 AGTGTTCTCCCCACCCTGTCAGG + Intergenic
1163256250 19:16157674-16157696 AGTGAGAGCCCTATCCTCCCAGG + Exonic
1165154441 19:33778475-33778497 AGTGACATCCACAACCTCCCCGG + Intergenic
1166340129 19:42132446-42132468 TGTCATCTCCCCACCCTCTCTGG + Intronic
1167040494 19:47020459-47020481 AGGGATCCCCCCAGCCTCTCGGG - Intronic
925842801 2:8008209-8008231 AGTGATAACACCATCTTCACGGG + Intergenic
926151217 2:10426647-10426669 AGAGCTGTCCCCATCCTCTCTGG + Intronic
926912197 2:17861656-17861678 AGTGATATTCCTATCTTCTTGGG - Intergenic
928072780 2:28234048-28234070 ATTAAAATCCCCCTCCTCTCAGG + Intronic
935077521 2:99759977-99759999 AGTTATATCCCCATTTCCTCTGG - Intronic
937150774 2:119684088-119684110 AGAGACATCCCCATGCTTTCTGG + Intronic
941689923 2:168490270-168490292 CGTGATTCCCCCATCCTCTTTGG + Intronic
948752891 2:240142606-240142628 GATGATAGGCCCATCCTCTCTGG - Intronic
1170761281 20:19253638-19253660 ACTGTTACCCCCATCCTCACAGG + Intronic
1172608514 20:36231871-36231893 AGTGGTGGCTCCATCCTCTCTGG + Exonic
1179033568 21:37741208-37741230 ATTGTTATCCCCATGCTGTCTGG + Intronic
1181030535 22:20147202-20147224 AGTCTTTTCCCCAGCCTCTCGGG + Exonic
1183694328 22:39412741-39412763 AGTGGTTTCCACATCCTTTCTGG + Intronic
1184708673 22:46234150-46234172 AGTTATAGCCCCAGCCACTCTGG + Intronic
1185296276 22:50056907-50056929 AACGATAGCCCCTTCCTCTCTGG + Exonic
950253104 3:11483220-11483242 AGTGATATCCCCATCCTCTCTGG + Intronic
951567503 3:24026051-24026073 AGTGATATTCCCCTGCCCTCAGG + Intergenic
955415387 3:58686720-58686742 AGAGATATCCCCCTCCTCCAAGG + Intergenic
957077183 3:75611431-75611453 AGTAATATCCCCTCCCTTTCAGG - Intergenic
960329519 3:116341492-116341514 AGTCATATTACTATCCTCTCTGG - Intronic
961074582 3:123970086-123970108 AGAGATCTCCCCATCCACTTTGG + Exonic
961807352 3:129498985-129499007 AGTGGTATGCCCAGCTTCTCTGG - Intronic
962958694 3:140290346-140290368 AGGGATCTTCCCATCCTCTGGGG + Intronic
965396409 3:168164834-168164856 AATGATATCACCATCCACTCAGG - Intergenic
965894852 3:173563026-173563048 AGTGGAATCCCTATCATCTCAGG - Intronic
969721915 4:8896694-8896716 AGTGAGTTCCCTAACCTCTCTGG - Intergenic
975523737 4:75327290-75327312 AGTCATATCCCTTTGCTCTCAGG + Intergenic
975594892 4:76040670-76040692 AGGGATAGCCCCCTCCTCTAGGG - Intronic
984166202 4:176305825-176305847 AGTAATATCCCCCTACACTCTGG + Intergenic
984911021 4:184674215-184674237 AATGATTTCCCCATCCTCTCTGG - Intronic
985828650 5:2212399-2212421 ACTGATATCCACCTCCTCACTGG - Intergenic
986305995 5:6517355-6517377 ACTGAGATGCCCATCCTATCTGG + Intergenic
988538711 5:32090323-32090345 AATGATATCCCCTTCATCTGTGG - Exonic
988947097 5:36215148-36215170 AGTCATCTCCTCCTCCTCTCTGG + Intronic
994044924 5:95296593-95296615 AATGATAAACCCATCCTGTCTGG - Intergenic
995407340 5:111813796-111813818 ATTTATTTCACCATCCTCTCAGG + Intronic
997669059 5:135655549-135655571 AGTGAGTTTCCTATCCTCTCAGG + Intergenic
998091233 5:139371129-139371151 AGTGATATGCCCATGATCACAGG - Intronic
1003665875 6:8110926-8110948 AGTGATTTCATCATCCTCTAAGG + Intergenic
1006065790 6:31461870-31461892 ACTGCCATCCCCATCCTCTGGGG + Intergenic
1007430735 6:41775309-41775331 AGTGTTATCCCCATCACCTGTGG - Intronic
1007753734 6:44085400-44085422 AGTGACAGCCCCATCCCCACAGG + Intergenic
1012412875 6:98979601-98979623 AGTGCCATCCCCATGGTCTCAGG + Intergenic
1017455136 6:154594673-154594695 AGTGATTTCCCCATCCTCTCTGG + Intergenic
1017927072 6:158919926-158919948 AGTGACAGCACCTTCCTCTCAGG - Intergenic
1018876860 6:167827895-167827917 CGTGATTTCCTCCTCCTCTCAGG - Intronic
1019372159 7:668050-668072 ACAGATATCCCCATCATCACAGG - Intronic
1020116371 7:5478578-5478600 AGGGAGAGCCCCAACCTCTCTGG - Intronic
1020334954 7:7056163-7056185 AGTGATATCCTTTCCCTCTCTGG - Intergenic
1020354844 7:7264913-7264935 AGTGATATCTCAATCTTCACAGG - Intergenic
1026297948 7:69072245-69072267 TGTGGTTTCCCCATCCTCTCAGG + Intergenic
1031049148 7:116927612-116927634 AGTAATATTCCCTTCCTCTAGGG - Intergenic
1032144708 7:129368540-129368562 AGTGAACTCACCATCCACTCAGG - Intronic
1032363383 7:131276475-131276497 GCTGCTGTCCCCATCCTCTCGGG - Intronic
1034040984 7:147876456-147876478 ATTGCTGTCCCCATTCTCTCTGG - Intronic
1037832171 8:22196252-22196274 AGTGCTGTCCCCAGCATCTCGGG - Intronic
1038387230 8:27159990-27160012 AGTGACCTCCCTATCCTCTTTGG + Intergenic
1038602925 8:28965858-28965880 AGAGAACTCTCCATCCTCTCAGG - Intronic
1041398372 8:57416116-57416138 CCTGATATCCCCATTCTCTGAGG + Intergenic
1042462794 8:69090721-69090743 TGTGATTTCCCCACCCTATCAGG + Intergenic
1045300110 8:100903530-100903552 ACTGATATCCCCAAGCTCTAGGG - Intergenic
1045927059 8:107586476-107586498 AGTAATATCCTCTCCCTCTCTGG + Intergenic
1048508547 8:135042252-135042274 ATTCATATCCCCATCCTCCCAGG - Intergenic
1049431260 8:142566361-142566383 AATTACATCCCCACCCTCTCAGG + Intergenic
1051458928 9:17292197-17292219 GGTGATCTCCCCTTTCTCTCTGG + Intronic
1055371453 9:75604211-75604233 AGTGTTTTCCCCACCCTTTCTGG + Intergenic
1055749645 9:79490784-79490806 GGTGATATCCTTATCTTCTCAGG + Intergenic
1056858591 9:90158506-90158528 AGTGATACCCCCATCTTCCCTGG - Intergenic
1058269783 9:102956815-102956837 AATGAATTACCCATCCTCTCAGG - Intergenic
1059063047 9:111053532-111053554 AGTGCAATCACCATCCTTTCAGG + Intergenic
1059196753 9:112377791-112377813 TGTGTTATCACCATCCTCCCAGG + Intergenic
1185951825 X:4445882-4445904 ACTGAAATCCCCACCCTTTCTGG - Intergenic
1186902142 X:14068117-14068139 AGTGACATCCACATCTTCTCAGG + Intergenic
1192547211 X:72023971-72023993 AGTCAAATCTCCATCCTCTTTGG - Intergenic
1194516048 X:94855169-94855191 GGTGATCTCCCCTTCCTCTAGGG - Intergenic
1195493949 X:105507987-105508009 AATGAGATCCCCATCCTATTAGG + Intronic
1195634867 X:107102707-107102729 AGCTATAGCCCCATCCTCTCTGG - Intronic
1201738470 Y:17297694-17297716 ACTGAAATCCCCAGCCTTTCTGG - Intergenic