ID: 950253108

View in Genome Browser
Species Human (GRCh38)
Location 3:11483230-11483252
Sequence CCATCCTCTCTGGTCAGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 159}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950253096_950253108 18 Left 950253096 3:11483189-11483211 CCTGCCCCTAACCCAGGTCATGG 0: 1
1: 0
2: 1
3: 25
4: 265
Right 950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 159
950253099_950253108 13 Left 950253099 3:11483194-11483216 CCCTAACCCAGGTCATGGAGAGG 0: 1
1: 0
2: 1
3: 7
4: 136
Right 950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 159
950253094_950253108 20 Left 950253094 3:11483187-11483209 CCCCTGCCCCTAACCCAGGTCAT 0: 1
1: 0
2: 0
3: 32
4: 402
Right 950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 159
950253103_950253108 6 Left 950253103 3:11483201-11483223 CCAGGTCATGGAGAGGTAAAGTG 0: 1
1: 0
2: 0
3: 15
4: 140
Right 950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 159
950253098_950253108 14 Left 950253098 3:11483193-11483215 CCCCTAACCCAGGTCATGGAGAG 0: 1
1: 0
2: 1
3: 10
4: 151
Right 950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 159
950253093_950253108 21 Left 950253093 3:11483186-11483208 CCCCCTGCCCCTAACCCAGGTCA 0: 1
1: 0
2: 3
3: 33
4: 552
Right 950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 159
950253095_950253108 19 Left 950253095 3:11483188-11483210 CCCTGCCCCTAACCCAGGTCATG 0: 1
1: 0
2: 2
3: 23
4: 377
Right 950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 159
950253089_950253108 27 Left 950253089 3:11483180-11483202 CCCCGTCCCCCTGCCCCTAACCC 0: 1
1: 0
2: 8
3: 99
4: 1534
Right 950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 159
950253091_950253108 25 Left 950253091 3:11483182-11483204 CCGTCCCCCTGCCCCTAACCCAG 0: 1
1: 1
2: 15
3: 305
4: 3674
Right 950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 159
950253102_950253108 7 Left 950253102 3:11483200-11483222 CCCAGGTCATGGAGAGGTAAAGT 0: 1
1: 0
2: 0
3: 15
4: 218
Right 950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 159
950253090_950253108 26 Left 950253090 3:11483181-11483203 CCCGTCCCCCTGCCCCTAACCCA 0: 1
1: 1
2: 7
3: 118
4: 1888
Right 950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 159
950253101_950253108 12 Left 950253101 3:11483195-11483217 CCTAACCCAGGTCATGGAGAGGT 0: 1
1: 0
2: 1
3: 10
4: 188
Right 950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950253108 Original CRISPR CCATCCTCTCTGGTCAGTCT TGG Intronic
900368399 1:2320736-2320758 CCATCCTCCCTGGTCAATGCGGG + Intergenic
901206406 1:7499176-7499198 CCATCCTCTCTGCACACTCATGG - Intronic
902613135 1:17608732-17608754 CCATCCCCTCTGCTCAGTCAGGG - Intronic
904778390 1:32925879-32925901 CCAGCCTCTCCGTTAAGTCTAGG - Intergenic
905149830 1:35919007-35919029 CCATCTTCTCTGCCCAGCCTGGG + Intronic
905253578 1:36665601-36665623 CCCTGCACTCTGGTCATTCTGGG + Intergenic
905506177 1:38481354-38481376 CCAGCCACTCTGGTCAGGCTAGG - Intergenic
907511770 1:54966860-54966882 ACCTCCTCTCTGGTCAGGCATGG - Intergenic
908182708 1:61622145-61622167 TCTTCTTCTTTGGTCAGTCTCGG - Intergenic
915758411 1:158286191-158286213 CCAGCCCCTCTGTTCAGGCTGGG + Intergenic
917059667 1:171023077-171023099 CAATCCTCCCATGTCAGTCTTGG - Intronic
917266092 1:173222485-173222507 CCTTCCTCTGAGGTCAGTCTTGG - Intergenic
917370670 1:174290131-174290153 CCATACTCCCTGGCCAGACTGGG + Intronic
919925560 1:202190138-202190160 CCTCCCTCCCTGGTCAGGCTGGG + Intergenic
920305589 1:205016216-205016238 CCATCCTCTCTGAGCTGTGTAGG + Intronic
922974977 1:229777065-229777087 CCTTACTCTCTGGTGAGACTGGG - Intergenic
1062957903 10:1552304-1552326 CCCTCCTCTCTGGCTAGTTTGGG + Intronic
1067006824 10:42672395-42672417 CCTTCATCTCAGGACAGTCTGGG + Intergenic
1067582541 10:47454583-47454605 CCATCCTCCCTGCCCAGCCTAGG - Intergenic
1068629025 10:59280606-59280628 GCATCCTCTCTAGACAGTCTAGG - Intronic
1070273644 10:74983016-74983038 CCATGTTCTCTGATCAGTCTTGG - Intronic
1072608895 10:97003871-97003893 CCATCCTCCTTGGTCAGTCTGGG + Intronic
1073071116 10:100793779-100793801 CCTTCCTCTCTGGCCTCTCTGGG + Intronic
1077478250 11:2801100-2801122 CCACCATCTCTAGTCTGTCTGGG - Intronic
1078100709 11:8328829-8328851 CCATCCTCTCTGCTCACTCCTGG + Intergenic
1078792249 11:14556420-14556442 CCCTCCTCTCTGGAAAGTTTTGG + Intronic
1079064419 11:17276920-17276942 CCATCCTCTCTGCTCTGGCAAGG - Intronic
1080039049 11:27739614-27739636 TCATCCTCTCTTCTCAGTCCTGG + Intergenic
1080763155 11:35272183-35272205 CCATCCTCTCTGATCTCTCTAGG - Intronic
1083924363 11:65796939-65796961 CCTTCCTCTCAGGTCAGCCCAGG - Exonic
1085419778 11:76345956-76345978 GCATTGTCTCTGGTCAGTCAGGG + Intergenic
1086388469 11:86335358-86335380 CCAACCTTTCTGGTTAGTTTTGG - Intronic
1089194406 11:116685614-116685636 CCATCCTCTCTGCTCTCTCCTGG + Intergenic
1089839067 11:121398545-121398567 CCATCTTCTCTTCTCAGCCTTGG + Intergenic
1091578710 12:1765928-1765950 CCTTCCACTCTTGACAGTCTAGG - Intronic
1093410502 12:18859773-18859795 CCATCCTTTCTGGTCATGCAGGG - Intergenic
1094148834 12:27259460-27259482 CCTGCCTCTCTTCTCAGTCTAGG - Intronic
1095951052 12:47782153-47782175 CCTTCCTCTCTGCTTAGGCTGGG + Exonic
1096072021 12:48780687-48780709 CCTTCCTCTCTGGCCAGGCATGG - Intronic
1098085636 12:66839740-66839762 GTATCCTACCTGGTCAGTCTGGG + Intergenic
1099481183 12:83168647-83168669 CCAATGTCTCTAGTCAGTCTGGG + Intergenic
1101328275 12:103735953-103735975 CAACCCTCTCTTGTCAGTCAGGG + Intronic
1103024093 12:117559249-117559271 CCACTCTCTCAGGTAAGTCTTGG + Intronic
1110936445 13:81295980-81296002 ACATCAACTCTTGTCAGTCTTGG - Intergenic
1113490101 13:110684623-110684645 GCGTCCTCTCTGGTCATTCAGGG + Intronic
1114605101 14:23989580-23989602 CCCACCTCTCTTGTCAGTCCTGG + Intronic
1118247588 14:64126432-64126454 CCATCCTCCCTGTAAAGTCTGGG - Exonic
1119859379 14:77925335-77925357 CCATCACCTCTGGTGAGGCTTGG - Intronic
1125726567 15:41871292-41871314 CCATCCTCTCTTACCACTCTGGG + Intronic
1128086361 15:64889218-64889240 CCCTCCTATCTGGTCCCTCTAGG - Intronic
1129219298 15:74122138-74122160 CCAGCCTATCTGGGCAGTCTGGG - Intronic
1129256719 15:74337959-74337981 CCATCCTCTCTGATCACTGCTGG + Exonic
1131275522 15:90977478-90977500 CCATCCTCTCTAGTAACTATTGG - Intronic
1134568040 16:15267951-15267973 CCATCCTCTTTGGTTTATCTAGG + Intergenic
1134734396 16:16488404-16488426 CCATCCTCTTTGGTTTATCTAGG - Intergenic
1134850094 16:17471766-17471788 CCATCCTGACTGGTCTGTCCCGG + Intergenic
1134933106 16:18223876-18223898 CCATCCTCTTTGGTTTATCTAGG + Intergenic
1136557103 16:31013730-31013752 CCACCACCTCAGGTCAGTCTAGG + Intergenic
1138247948 16:55480734-55480756 CCATGCCCTCTGGTCACCCTAGG + Intronic
1138984414 16:62310396-62310418 CCATACTCTGTAGTTAGTCTTGG - Intergenic
1139947854 16:70653981-70654003 CCTTCCAGTCTGGTCATTCTAGG - Intronic
1141489033 16:84359479-84359501 CCATCCCCTGGGGTCAGTCATGG + Intergenic
1142816309 17:2428796-2428818 CCACCCTCTTTGGTCACTTTTGG + Intronic
1143309948 17:5979736-5979758 TCATCCTCTGGGGTCAGTGTTGG + Intronic
1143314372 17:6020966-6020988 CCAACCTTTCTGGTTTGTCTGGG + Intronic
1147134179 17:38425740-38425762 CCTTCCTCTCTCGACACTCTGGG - Intergenic
1150069877 17:62141335-62141357 CTATCATCTCTGGCCAGTCGCGG + Intergenic
1151538424 17:74751578-74751600 CCATCCCCGCTGGGGAGTCTAGG + Intronic
1152326906 17:79646926-79646948 CCATCCTCTCTGCTAAGGCCAGG - Intergenic
1153537703 18:6120195-6120217 CGGTCCTCCCAGGTCAGTCTCGG + Intronic
1158113107 18:53963590-53963612 TCATCCTCTCTGGTCACTGATGG + Intergenic
1161152676 19:2717870-2717892 CCCTCCTCTCTGCACAGGCTCGG - Exonic
1161379273 19:3956074-3956096 TCAGCCCCTCTGGTCAGTCAAGG - Intergenic
1163397664 19:17073544-17073566 CCCTCCTCTCTTCTCAGTTTGGG - Intronic
1166516263 19:43449295-43449317 CCATCCTCCCTCCTCAGCCTTGG - Intergenic
1166975556 19:46603134-46603156 CCATCCTCCCTGGCAAGGCTGGG + Intronic
925104387 2:1277924-1277946 CCATCCTCTCTGGAAAGGCGGGG + Intronic
925261011 2:2528670-2528692 CCGGCCTCACTGGTCACTCTAGG - Intergenic
925298665 2:2794848-2794870 GCAGCCCTTCTGGTCAGTCTAGG - Intergenic
925716048 2:6785388-6785410 CCATCCGCTTTGGTGAGGCTGGG + Intergenic
925888931 2:8417716-8417738 CCCAGCTCTCTGGTTAGTCTAGG - Intergenic
928304781 2:30159387-30159409 CCATTCTTCCTTGTCAGTCTTGG + Exonic
928366260 2:30705762-30705784 CCACCCTCTCTGTTCTGGCTGGG + Intergenic
932817568 2:74874167-74874189 CCATCCTGGCCGGGCAGTCTCGG + Intronic
933078025 2:77954198-77954220 ACATCCTCTCTGGTCGCTCCTGG - Intergenic
933757098 2:85648312-85648334 CCAGCCTCCCTGATGAGTCTAGG - Intronic
935447814 2:103175380-103175402 CCATTCTCTCTGGTCTATCATGG - Intergenic
936013014 2:108936982-108937004 CCAGCCTCTCTGGCCAGGCAGGG + Intronic
937051461 2:118894735-118894757 CCATCCTCTCTTTTAGGTCTTGG + Intergenic
939999245 2:148950484-148950506 CCATCCTCTGTGCTAGGTCTTGG + Intronic
940581546 2:155586133-155586155 TCAACCTCTCTGGTGAGTTTGGG - Intergenic
940734474 2:157434093-157434115 CCAACCTAGCTGATCAGTCTGGG + Intronic
941990842 2:171555461-171555483 AGATCTTCTCTGGTCAGACTTGG + Exonic
946349890 2:219143214-219143236 ACATCCTTTCAGTTCAGTCTTGG + Intronic
948594380 2:239070024-239070046 CCATCCTCTCTTCTGAGACTGGG + Intronic
1169871139 20:10249624-10249646 CCATCCTTCCTGCTCAGTGTGGG + Intronic
1170177348 20:13487124-13487146 TCTTCCTGTCTGGTTAGTCTAGG + Intronic
1171423113 20:25032193-25032215 CCTTCCTCTCTGGCCACTCTGGG + Intronic
1173349872 20:42234858-42234880 CCATCCCCTCTGCTCAGTGTGGG - Intronic
1175676052 20:60947873-60947895 CCAGCCTGGCTGGACAGTCTGGG - Intergenic
1176090659 20:63316989-63317011 CCATCGCCTCAGGTCAGTCTGGG - Intronic
1179156216 21:38853407-38853429 CCAGCCTCTCTTGTGTGTCTGGG - Intergenic
1180138167 21:45874912-45874934 GCATGCTCTCTCGTGAGTCTAGG - Intronic
1180158487 21:45988935-45988957 CCATCACATCTGGTCAGCCTGGG - Intronic
1181484908 22:23224535-23224557 CCAGCGTCTCTGGGCAGACTTGG - Intronic
1183173001 22:36201731-36201753 CCATCCTCCTTGGTCATTGTTGG + Intronic
1183180273 22:36255239-36255261 CCATCCTCCTTGGTCATTGTTGG - Intronic
1183357456 22:37367338-37367360 CGATCCTCTCTGGTCCTTCGGGG - Intergenic
1183661309 22:39223136-39223158 TCATCCTCTCTGGCCAGAGTGGG + Intergenic
1184125606 22:42484487-42484509 CCATCCTCTCTGTGAAGTCCAGG - Intergenic
1184286136 22:43472736-43472758 CCACCCTCCCTGGCCAGGCTGGG + Intronic
1184856613 22:47149882-47149904 CCCTCATCTCTGGTCTCTCTGGG + Intronic
1185358371 22:50389152-50389174 CCATCCTCAGTGGTCCATCTGGG - Intronic
950253108 3:11483230-11483252 CCATCCTCTCTGGTCAGTCTTGG + Intronic
951649703 3:24937544-24937566 CCTTCCTCTTTAGTCAGTCCAGG - Intergenic
953542358 3:43833095-43833117 CCATTCCCTCTGGGCAGTGTTGG - Intergenic
953678976 3:45025638-45025660 ACATCCTCTCTGGTACCTCTGGG + Intronic
953917834 3:46931815-46931837 CCAGTCTCTCTGGTCAGTGGTGG - Intronic
957873656 3:86117061-86117083 CCAACATCTCTGGTCTGCCTTGG + Intergenic
960452708 3:117829959-117829981 ACATCCTATCTTGTCAATCTTGG + Intergenic
961682758 3:128609970-128609992 CCATTCTCTCTGGTCAGAACTGG - Intergenic
961772599 3:129260887-129260909 CCAGCCCCTCAGGTCAGTCCTGG - Intronic
962410431 3:135136778-135136800 CCATCATCTTTGGTCAGGATTGG + Intronic
964078405 3:152721017-152721039 CTCTCCTCTCTGGTGAGTTTTGG - Intergenic
967675837 3:192298064-192298086 CCATGCACTGTGTTCAGTCTCGG - Intronic
968706063 4:2078321-2078343 CCAACCTCTCTGGTCTTTTTAGG + Intronic
970109587 4:12622871-12622893 CAATCCTCTCTCCTCAGCCTGGG + Intergenic
975398236 4:73902936-73902958 CAATTCTATCAGGTCAGTCTAGG + Intergenic
975736012 4:77381964-77381986 TCCTGCACTCTGGTCAGTCTGGG + Intronic
976134520 4:81921538-81921560 AACTCCTCTCTGGTCACTCTGGG + Intronic
976213297 4:82692853-82692875 CCAACCTCTCAGGTCTGCCTTGG + Intronic
977581714 4:98732350-98732372 CCATCTTCTCAGCTCAGTCCAGG + Intergenic
979738461 4:124118836-124118858 ACACCCTCTCCTGTCAGTCTTGG - Intergenic
981563833 4:146076618-146076640 ACATCCTCTCAGTTCAGACTTGG - Intergenic
982851555 4:160323016-160323038 CAGTCCTCTCTTGTCAGTCAAGG - Intergenic
985910495 5:2876161-2876183 CCATGCTCTATGGTTCGTCTCGG + Intergenic
986097386 5:4573215-4573237 ACATGCTCTCTGGTCAGTCTGGG + Intergenic
990245357 5:53858758-53858780 CCATGCTTTCTGTTCAGTCTTGG + Intergenic
992991389 5:82287364-82287386 GCATGCTCTGTGGTCAGGCTGGG - Intronic
995188907 5:109299664-109299686 CCATCCTCTCAGGGCACTCTGGG + Intergenic
995872288 5:116756072-116756094 CCAACTTCTCTGTGCAGTCTTGG + Intergenic
995973348 5:118000761-118000783 CCTTCCGCTCTGGACACTCTGGG + Intergenic
996847793 5:127919982-127920004 ACTTCCTCTCTGGTTATTCTTGG + Intergenic
997392461 5:133528262-133528284 CCAACCTTTCTGGTAACTCTTGG + Intronic
997446733 5:133945773-133945795 CCTCCCTCTCTGGTGAGCCTTGG + Intergenic
997473127 5:134127732-134127754 CCATCCTCTCTGGTCATTGCGGG + Intronic
999366473 5:151026929-151026951 CCATTCGGTCTGGTCATTCTGGG + Exonic
999777114 5:154820321-154820343 CCATCCTCTTTGGGGAGTCTGGG + Exonic
1001022127 5:168191809-168191831 CCACCCTCGCTGGGCTGTCTCGG - Intronic
1001110037 5:168888130-168888152 CCATCCTCACTGGTCTCTCCCGG - Intronic
1003150372 6:3542933-3542955 CTGTGCTCTATGGTCAGTCTGGG - Intergenic
1004188642 6:13445149-13445171 CCCTCCTCCCTGTTCAGCCTCGG - Intronic
1008420396 6:51292466-51292488 CCATGCTCCCTTGACAGTCTGGG + Intergenic
1011791587 6:90904697-90904719 CCATCTACTCTGGTCATTGTAGG - Intergenic
1012069058 6:94588422-94588444 CCAGTCTCACTGGTAAGTCTTGG + Intergenic
1015031238 6:128598328-128598350 CCAAACTCTATGGTAAGTCTTGG - Intergenic
1019463300 7:1172751-1172773 CCGTCCTCTCTGGTCCCTCTTGG + Intergenic
1022459851 7:30594888-30594910 CCACCCTCTCTGGACAGCCCAGG + Exonic
1025027882 7:55533219-55533241 CCATCCTCACTGGTCTGACCTGG - Intronic
1031378357 7:121054753-121054775 CCATCCTCACCCGTCAGTCATGG + Intronic
1032693812 7:134316506-134316528 CCGTCCTGTCTGGGCAGCCTGGG - Intronic
1033848370 7:145463165-145463187 CCCTCCTCTCTGGTGACTCGGGG - Intergenic
1036711041 8:11078755-11078777 CTGTCCTCTCTCGTCATTCTGGG - Intronic
1037528419 8:19750243-19750265 CCATCCTCTTTGGCCAGCTTAGG + Intronic
1037883640 8:22585260-22585282 GCATCCTCCCTGGGCAGGCTGGG + Intronic
1046098654 8:109589447-109589469 TCATCCTGTCTGTTCAGTCCTGG - Intronic
1046875299 8:119248533-119248555 TCCTCCTCTATGGGCAGTCTTGG - Intergenic
1046906729 8:119581680-119581702 CCATCCACCCTGCTCAGCCTTGG + Intronic
1047926596 8:129688649-129688671 GCATCCTCTCTGATTTGTCTGGG + Intergenic
1052322105 9:27179048-27179070 CCTTTCTCTCTGGTCCTTCTTGG + Intronic
1053306906 9:36991002-36991024 CCATCCTCCCAGCTCAGCCTCGG - Intronic
1055364503 9:75528146-75528168 CCACCCTCTCTGCTCCTTCTTGG - Intergenic
1057999302 9:99848866-99848888 TCATTCTTTCTGGTCAGACTGGG + Intronic
1061511012 9:131060981-131061003 CCACCATCTCTGGGCATTCTGGG + Intronic
1191631081 X:63322832-63322854 CCTTCCTCTATGGTAAGTCAAGG - Intergenic
1191851954 X:65591753-65591775 CTATCCTTTCTGGTCACTCCGGG - Intronic
1198313149 X:135438994-135439016 CCCTTGTCTCTGGTCAGCCTTGG + Intergenic
1198710404 X:139495497-139495519 GCCTCCTCACTGGTCAGCCTCGG + Intergenic