ID: 950255352

View in Genome Browser
Species Human (GRCh38)
Location 3:11500252-11500274
Sequence TCTAACATGTAGAATTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950255347_950255352 6 Left 950255347 3:11500223-11500245 CCCCATGCCAAAATATTAAAAAT 0: 1
1: 1
2: 4
3: 74
4: 877
Right 950255352 3:11500252-11500274 TCTAACATGTAGAATTTGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 221
950255346_950255352 7 Left 950255346 3:11500222-11500244 CCCCCATGCCAAAATATTAAAAA 0: 1
1: 1
2: 7
3: 76
4: 820
Right 950255352 3:11500252-11500274 TCTAACATGTAGAATTTGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 221
950255349_950255352 4 Left 950255349 3:11500225-11500247 CCATGCCAAAATATTAAAAATTT 0: 1
1: 0
2: 12
3: 126
4: 1168
Right 950255352 3:11500252-11500274 TCTAACATGTAGAATTTGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 221
950255350_950255352 -1 Left 950255350 3:11500230-11500252 CCAAAATATTAAAAATTTGAATT 0: 1
1: 1
2: 16
3: 177
4: 1597
Right 950255352 3:11500252-11500274 TCTAACATGTAGAATTTGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 221
950255348_950255352 5 Left 950255348 3:11500224-11500246 CCCATGCCAAAATATTAAAAATT 0: 1
1: 1
2: 5
3: 92
4: 892
Right 950255352 3:11500252-11500274 TCTAACATGTAGAATTTGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950255352 Original CRISPR TCTAACATGTAGAATTTGGT TGG Intronic
904978098 1:34473763-34473785 TCTAACATGCAGACTTGGGCAGG + Intergenic
908608049 1:65822531-65822553 TCTAACATGCAAATTTTGGAGGG - Intronic
909272359 1:73639681-73639703 GCTGACATGTAGAATTTCCTGGG - Intergenic
911441199 1:97927637-97927659 TTTAACATGTAAATTTTGGGAGG + Intergenic
911953497 1:104207338-104207360 TTTAAAATGTACAATTTAGTGGG - Intergenic
911970434 1:104428655-104428677 TCTAACATCTAGAATTTACAAGG - Intergenic
916571811 1:166034498-166034520 TTTAACAAGGAGAATTAGGTTGG - Intergenic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
922304112 1:224329388-224329410 TCCAACATTTACAAGTTGGTAGG + Intronic
922513676 1:226190374-226190396 TTTAACATATTGAATATGGTTGG + Intergenic
923166820 1:231372469-231372491 TCTAACTTCTAGATTTTGTTAGG - Intronic
923237706 1:232050334-232050356 TCTAACATTTAGAAGTCTGTAGG + Intergenic
923734209 1:236586860-236586882 TCTATCATGTAGGATGTGCTTGG - Intronic
923796044 1:237156693-237156715 AGTAATATGTAGAATGTGGTGGG + Intronic
1063075486 10:2712525-2712547 TCTAACATGTAAAATTTATATGG + Intergenic
1066354719 10:34671319-34671341 TATAAAATGTTGATTTTGGTAGG + Intronic
1067784294 10:49231875-49231897 CAAAACATGTAGAATTTGTTTGG + Intergenic
1068359597 10:55959645-55959667 TCTAAGATGAAAAATTTGCTAGG + Intergenic
1068366316 10:56055073-56055095 TTTAACATATAAATTTTGGTGGG + Intergenic
1068720736 10:60243263-60243285 TCTAACATATAAAATTAGGGGGG - Intronic
1069313234 10:67065592-67065614 TCTAACATGAAGGAAGTGGTGGG + Intronic
1069614244 10:69796739-69796761 TATAACATGTAGAGATTGATGGG - Intergenic
1069963392 10:72092695-72092717 TTCAACATGTAGATTTTGGGTGG + Intergenic
1071868889 10:89769779-89769801 TCTGGCATGTAGAATGTGGAAGG + Intronic
1073122093 10:101128367-101128389 TTTAAAATGTATAATTCGGTGGG + Intronic
1073487778 10:103831526-103831548 TTTAACGTGTACAATTTGGCTGG + Intronic
1074689150 10:115988769-115988791 TTAAACATGTACAGTTTGGTTGG + Intergenic
1074898291 10:117795601-117795623 TGAAACATGTAGGATTTGGGGGG + Intergenic
1078116530 11:8457924-8457946 AATAACATGGAGAACTTGGTAGG + Intronic
1078122791 11:8527270-8527292 TCTATCTTTTAGAATTTGGCTGG - Intronic
1078670561 11:13361255-13361277 TCTTCCATGAAGAATTAGGTCGG + Intronic
1078968196 11:16372023-16372045 TATAAAATGTTGAATTTGGGAGG - Intronic
1080155047 11:29100170-29100192 TCTCAAATTTAGAATTGGGTTGG - Intergenic
1080481608 11:32657179-32657201 TGTAACATGTAGAACTTTGAAGG - Intronic
1083243994 11:61411572-61411594 TGTAACATCTGGAATCTGGTGGG - Intronic
1083316566 11:61818210-61818232 TATAAAATGAAGAATTTGGATGG - Intronic
1084614584 11:70227073-70227095 TCTATCCTGAACAATTTGGTTGG - Intergenic
1086494260 11:87386097-87386119 TGTATCTTGAAGAATTTGGTTGG - Intergenic
1087296700 11:96385872-96385894 TCTAACATGTAGTTTGAGGTCGG - Intronic
1089162480 11:116450043-116450065 TTTAAAATATACAATTTGGTGGG - Intergenic
1091835288 12:3581571-3581593 TCAAGCATGCAGAATTTGATGGG - Intronic
1092702650 12:11249144-11249166 ACTGACATGTTGCATTTGGTCGG - Intergenic
1093120596 12:15266619-15266641 TTCAACATGAAGAATTGGGTTGG + Intronic
1095761919 12:45849208-45849230 TTTAACATGTAAAAGTAGGTAGG - Intronic
1097555035 12:61126366-61126388 TCAAACATGTAATATTTTGTTGG + Intergenic
1098544386 12:71695141-71695163 TCTAAAATGTAGACATAGGTAGG + Intronic
1099622642 12:85024478-85024500 TATAAGATTTAGAATTTGGCTGG + Intronic
1100912647 12:99383002-99383024 TCTAAGATGTAGAATTTACTAGG - Intronic
1101644865 12:106621966-106621988 TCTAGCTTTTACAATTTGGTGGG + Intronic
1103526339 12:121571588-121571610 TTTAAAATGTAGAAGTTGGTTGG - Intronic
1105249813 13:18688310-18688332 TCTAACATGGGGAATGAGGTAGG + Intergenic
1106296877 13:28422524-28422546 TCTAAAATGTTGAATGTGTTTGG - Intronic
1106464648 13:30002184-30002206 TCCAACATGTGAAATTTGGGGGG + Intergenic
1107077036 13:36333395-36333417 TCTAACTTCTAGTATTTAGTTGG + Intronic
1108647470 13:52445117-52445139 TCTGACATGTTGAAGTTTGTTGG - Intronic
1109162802 13:58996987-58997009 TCTATCATTTACAATTTAGTAGG - Intergenic
1109851724 13:68074748-68074770 TCTAACATCTAGAATATTGGAGG - Intergenic
1109979497 13:69888277-69888299 TTTAACATATGGAATTTGGGGGG + Intronic
1111081552 13:83316517-83316539 TTTAACACGTGGAATTTGGGAGG + Intergenic
1112903841 13:104392642-104392664 TATAACATGTTGATTATGGTAGG + Intergenic
1113123048 13:106944682-106944704 ACCAACATCAAGAATTTGGTAGG + Intergenic
1113188448 13:107716759-107716781 TCATAAATGTTGAATTTGGTAGG + Intronic
1115697693 14:35918391-35918413 TTTAAAATATAGAATTTAGTTGG - Intronic
1116731733 14:48631208-48631230 TCTAACATCTAGAATTTACAAGG - Intergenic
1116744750 14:48803618-48803640 CCTAACATATAAAATATGGTTGG - Intergenic
1117474955 14:56084586-56084608 TCCAACATTTAGAGTTTGGAGGG - Intergenic
1117514443 14:56486481-56486503 TCTAACATATGGATTTTGGAGGG + Intergenic
1118067595 14:62208509-62208531 TCTAACATATAAACTTTGGGGGG + Intergenic
1121599775 14:95194743-95194765 TCTAACATGCCTACTTTGGTTGG + Intronic
1122831346 14:104398360-104398382 TCAAACACGAAGAATTTGTTTGG + Intergenic
1125105310 15:35963970-35963992 TCTAACATATAAAATTTAGTAGG + Intergenic
1125774675 15:42201469-42201491 TTTAAAATGTACAATTTGGCTGG - Intronic
1126372798 15:47964852-47964874 TTTAACATATAGATTTGGGTGGG + Intergenic
1126687735 15:51263107-51263129 TCAAGAATTTAGAATTTGGTAGG + Intronic
1127513477 15:59667582-59667604 TATCACATGTAGAATTTGACTGG + Intronic
1128407938 15:67362887-67362909 TTTAACATGTCAAATCTGGTGGG + Intronic
1129810406 15:78505764-78505786 TCTGAAATATAGTATTTGGTAGG - Intergenic
1130731254 15:86494361-86494383 TATAAAGTGTAGAATTTTGTAGG + Intronic
1131371984 15:91890084-91890106 TTTAACATGTGGAATATAGTAGG + Intronic
1134124054 16:11604236-11604258 TCTAAAATGTGGAATATGCTTGG + Intronic
1135642920 16:24136606-24136628 TCTCACATGTAGAATATCCTAGG + Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1140290991 16:73657158-73657180 TTTAAAATGTACAATTTGGCTGG + Intergenic
1141572723 16:84943947-84943969 TCTAACAAATAGAACATGGTGGG + Intergenic
1149131129 17:53303511-53303533 TCTAACCTGTTGCATTTGCTTGG - Intergenic
1149206609 17:54254865-54254887 TCCAACATGTGAAATTTGGGGGG - Intergenic
1149335758 17:55634028-55634050 TTCAACATGTAAATTTTGGTGGG + Intergenic
1149638484 17:58188192-58188214 TCTTCCATGTGGAAGTTGGTTGG + Intergenic
1150925061 17:69524145-69524167 TTTAACCTGTGGATTTTGGTGGG + Intronic
1153814557 18:8781432-8781454 TATCACATGAAGGATTTGGTTGG - Intronic
1154439020 18:14370580-14370602 TCTAACATGGGGAATGAGGTAGG - Intergenic
1156224945 18:35095564-35095586 TGAAACATGAGGAATTTGGTTGG + Intronic
1159233943 18:65646466-65646488 TCTAACATGTTTTATTTGGGAGG - Intergenic
1159370419 18:67521168-67521190 TCCAACATGTAAATTTTGGAGGG - Intergenic
1159402536 18:67956485-67956507 CCTAAAATTTAGAATTTGGCTGG + Intergenic
1159989569 18:74888184-74888206 TCTTACATGTAAAATTTGCCAGG + Intronic
1166371766 19:42305753-42305775 TCTGACCTGTAAAATTGGGTTGG - Intronic
925270446 2:2602917-2602939 TCAAACATCTAGAATGTGATGGG - Intergenic
926841171 2:17082075-17082097 TCTAATTTGTAGAATTTGTTTGG - Intergenic
928600142 2:32896602-32896624 TCCAACATGCAGATTTTGGGAGG - Intergenic
930224711 2:48780501-48780523 TTTAAAATGTATAATTTGGTGGG - Intergenic
933338384 2:80989303-80989325 TTTAACATGTATCATTAGGTTGG - Intergenic
934551093 2:95262237-95262259 TCTGACAGGGAGAATTTGCTTGG + Intergenic
934731839 2:96663744-96663766 TTTAAAATGTACAATTTGGCTGG + Intergenic
936391367 2:112077567-112077589 TTTAACATGTAGAAATGTGTAGG + Intronic
937191616 2:120106655-120106677 TTTAACATCTTGAATTAGGTTGG + Intronic
937305824 2:120870000-120870022 TCTAACATGTATAAATATGTTGG + Intronic
937773484 2:125748695-125748717 TTCAACATATAGATTTTGGTAGG + Intergenic
939065963 2:137483707-137483729 TCTAACAAGTAGAAAATGGGAGG + Intronic
939101836 2:137903877-137903899 TCTACCCAATAGAATTTGGTAGG + Intergenic
940971007 2:159896777-159896799 TCTGACATGTAGAACTTAGATGG + Intronic
941659014 2:168175577-168175599 AGGAACATGTATAATTTGGTTGG - Intronic
943147028 2:184058603-184058625 TCTAGTATGTATAATTTTGTCGG + Intergenic
943279414 2:185912137-185912159 TCAAAGATGCAGAATTTGCTAGG - Intergenic
943809374 2:192164847-192164869 TCTAGCATCTAAAATATGGTTGG + Intronic
943878608 2:193108507-193108529 TATAACATTCAAAATTTGGTGGG + Intergenic
944234233 2:197426807-197426829 TCTAAATTGGAAAATTTGGTAGG - Intronic
944382791 2:199131015-199131037 TTTAACATGTAGAGTTTGAAAGG + Intergenic
1170213410 20:13867975-13867997 TCTGACATGAAGGACTTGGTGGG + Intronic
1170878978 20:20277998-20278020 TCTAGCAAATAGAATGTGGTGGG - Intronic
1171138499 20:22720040-22720062 TATAACATGCAGAACTTGTTTGG - Intergenic
1171198858 20:23225138-23225160 TATAACATATATGATTTGGTTGG - Intergenic
1171344362 20:24454586-24454608 TTAAACATGTAGAAGATGGTTGG + Intergenic
1174096033 20:48090203-48090225 TCAAAGATGTTGTATTTGGTTGG - Intergenic
1174642285 20:52054946-52054968 TCTAAAATGAGGAATTTGGCCGG - Intronic
1176453705 21:6888559-6888581 TCTACCCAATAGAATTTGGTAGG + Intergenic
1176456664 21:6918849-6918871 TCTAACATGGGGAATGAGGTAGG + Intergenic
1176831880 21:13753607-13753629 TCTACCCAATAGAATTTGGTAGG + Intergenic
1176834836 21:13783908-13783930 TCTAACATGGGGAATGAGGTAGG + Intergenic
1176909666 21:14549454-14549476 TCTAACATGAAGAGTTGGTTGGG + Intronic
1178635890 21:34302822-34302844 TCTAACATGTGGAAGGTGTTAGG + Intergenic
1181896362 22:26111385-26111407 TCTAACAAGTAGAATGTAGTGGG + Intergenic
949217613 3:1588538-1588560 TCTAACATGGAGAATTTATAAGG + Intergenic
950255352 3:11500252-11500274 TCTAACATGTAGAATTTGGTTGG + Intronic
950490286 3:13300523-13300545 TCCAACATGTAAATTTTGGAGGG + Intergenic
951326979 3:21314139-21314161 TCAAACATGTAAAGTTTGGAGGG - Intergenic
952345776 3:32483719-32483741 TCTCAAATGGAGATTTTGGTGGG - Exonic
955011773 3:55024394-55024416 TCCAACAAGTAGATTTTGGGGGG - Intronic
955591579 3:60541470-60541492 CCCCACATGTAGAATATGGTGGG - Intronic
956732356 3:72208191-72208213 TGTAAAAAGTGGAATTTGGTGGG - Intergenic
956822882 3:72969771-72969793 TAAAACATGTAGAATTTATTAGG + Intronic
956878281 3:73485192-73485214 TCTATCATGTAATATTAGGTTGG - Intronic
959351612 3:105272141-105272163 TCTAACATATAAATTTTGGAGGG - Intergenic
959994513 3:112665604-112665626 TATAACTGGTAGAATTTAGTTGG + Intergenic
960714937 3:120565539-120565561 TCACACATGTAGGATGTGGTAGG + Intergenic
963040006 3:141063268-141063290 TCTTATATGTAGCATATGGTTGG + Intronic
963589045 3:147233442-147233464 TCAAATATGTGGAATTTGATGGG + Intergenic
963749719 3:149164039-149164061 TCTAGAATGTAGAATTTTGAGGG + Intronic
965587665 3:170333455-170333477 TCTACCATGTACAATCTGGCAGG - Intergenic
969366672 4:6699157-6699179 TCTAACATCTACACTTTGGGAGG - Intergenic
971437044 4:26638627-26638649 TTAAACATGTTGAATTTGGGGGG - Intronic
975161461 4:71129226-71129248 TCTAACATCCAGAATCTGTTAGG + Intergenic
975404944 4:73978323-73978345 TCTAAAAAGTGGAATATGGTAGG + Intergenic
975566038 4:75755196-75755218 TCTAACAACTAGAATATGATGGG - Intronic
976638138 4:87308772-87308794 TCTAAGTTGTAGAATTTCTTTGG - Intronic
976795894 4:88931834-88931856 GATAACATATAGATTTTGGTGGG + Intronic
977110638 4:92949634-92949656 TCTTTCAGGTAGAATTTGGTAGG + Intronic
977133930 4:93278102-93278124 TCTGGCATGTAAAATTTGGTAGG - Intronic
978630904 4:110742951-110742973 TCTAACATATAAATTTTGGGGGG + Intergenic
978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG + Intronic
978827680 4:113044407-113044429 TCTAACCTGTAGAATGTAGGTGG - Intronic
979113706 4:116793746-116793768 TCAAAAATTTAGAATGTGGTAGG - Intergenic
979668632 4:123339703-123339725 TTTGAAATGTAGAATTTGCTGGG - Intergenic
980909528 4:138981345-138981367 TATAACATGTAGATTTTGTCAGG + Intergenic
981302697 4:143207241-143207263 TATGAAATGTCGAATTTGGTTGG + Intronic
983320859 4:166194627-166194649 TTTAAACTGTAGAATTTTGTAGG + Intergenic
984610251 4:181829328-181829350 TCTAAAATGTTGTATTTGCTAGG + Intergenic
988944596 5:36183561-36183583 TTTAAGAAGTAGAATTTGGCTGG - Exonic
991461639 5:66864779-66864801 TCTAACATGAAGATGTTGGCAGG - Intronic
992535458 5:77697576-77697598 TATAACATGTCAAATTTTGTGGG + Intronic
993635085 5:90333276-90333298 TCTCACATGTCCAAGTTGGTGGG - Intergenic
993962669 5:94319287-94319309 TCCAACATTTAGAAGTTGGAAGG - Intronic
996155139 5:120090166-120090188 TCTCACCTGTAAAATGTGGTAGG + Intergenic
996989003 5:129605281-129605303 TAGAACATGTAGAACTTGGTGGG - Intronic
997804234 5:136898984-136899006 TCTAATATCTAGAATTTTCTAGG - Intergenic
1000108285 5:158081867-158081889 TCTTTTATGTAGAATTTTGTGGG + Intergenic
1000132293 5:158311310-158311332 TCTAACATGGAAAGTTTGTTTGG - Intergenic
1000132813 5:158316235-158316257 TCTTACATGGAGATGTTGGTTGG + Intergenic
1001847226 5:174932984-174933006 TCTGACATGTAAATTTTGGAGGG + Intergenic
1005272219 6:24178791-24178813 TGTAACATGTGGCATGTGGTAGG - Intronic
1006574015 6:35030434-35030456 TCTAAAATTTGGAATTTGGAAGG + Intronic
1008796249 6:55306569-55306591 TTTAACACTTAGAATTTGGAGGG + Intergenic
1011015292 6:82747918-82747940 TCAAAAATGGAGAATTTGTTTGG + Intergenic
1014125348 6:117770565-117770587 TCCAACATGTAAAATTTAATTGG + Intergenic
1014145610 6:117994741-117994763 ACTGACATGAATAATTTGGTGGG + Intronic
1015334237 6:132018925-132018947 TCTATCATTAAGAATTTGGCTGG + Intergenic
1016173011 6:141042202-141042224 TCTGACAACTAGAATTAGGTAGG - Intergenic
1016445069 6:144123245-144123267 TTTAGCATGTACACTTTGGTGGG + Intergenic
1021406915 7:20280772-20280794 TCTCACAGCTAGTATTTGGTAGG - Intergenic
1023697069 7:42858363-42858385 ACTAACATTTAGAATGTGCTGGG - Intergenic
1023700357 7:42886398-42886420 TCTAACATGTAACTTTTAGTGGG - Intergenic
1025781862 7:64609020-64609042 CCAAACATGTAGAATTTGGGAGG + Intergenic
1026140547 7:67702209-67702231 ACTTACATGTTGGATTTGGTTGG - Intergenic
1026316957 7:69235428-69235450 AATAACATGTAGCATTTGTTCGG + Intergenic
1028969312 7:96839781-96839803 TCTAACTTTGAGAATTTGATTGG + Intergenic
1030137967 7:106276246-106276268 TCCAACATGTATAATGTGTTTGG + Intronic
1031159633 7:118150865-118150887 TCTAAACTGTAGAGGTTGGTAGG + Intergenic
1031320438 7:120319915-120319937 TTTAACATGCAGAGTTTAGTTGG + Intronic
1033507621 7:142021319-142021341 GATAACATGTGGAATATGGTAGG + Intronic
1036938208 8:13025837-13025859 ACTGGCATGTAGAATTTGGAAGG - Exonic
1037355309 8:18013073-18013095 ACTAACATTTAGAAGTTTGTAGG - Intronic
1038015741 8:23513084-23513106 TCTTACATTTAGAATGTGGCAGG + Intergenic
1039290369 8:36088255-36088277 TCCAACATTTAGAAATTGGGTGG - Intergenic
1039789756 8:40865863-40865885 TCTAAAATCTAAAAATTGGTTGG - Intronic
1041072796 8:54141728-54141750 TATAACATGTAATATTAGGTTGG + Intronic
1041200346 8:55447765-55447787 TCTAACCTGTAGAATTTTAAGGG + Intronic
1044005863 8:86936415-86936437 TGGAACATGTAGAATTTGTTTGG + Intronic
1044451798 8:92344281-92344303 TCTAACATTTAAATTTTGATTGG - Intergenic
1044975382 8:97659726-97659748 ACTAACATGTTGAATTTGAGGGG + Intronic
1045807945 8:106187440-106187462 TGTAGCATGCAGAATTTGATAGG + Intergenic
1046863383 8:119119332-119119354 GCTCAGATGTATAATTTGGTAGG - Intergenic
1048242174 8:132753495-132753517 TGGAACAAGCAGAATTTGGTGGG - Intronic
1048753559 8:137706922-137706944 TTTAAAGTGTGGAATTTGGTAGG + Intergenic
1052017532 9:23486608-23486630 TCTAACATGTCAGAGTTGGTAGG + Intergenic
1052679972 9:31678243-31678265 TTTAAAATGTACAATTTGATGGG - Intergenic
1053546328 9:39026808-39026830 TCTCACATGTATAATTGGGAAGG - Intergenic
1053810643 9:41848470-41848492 TCTCACATGTATAATTGGGAAGG - Intergenic
1054619950 9:67338969-67338991 TCTCACATGTATAATTGGGAAGG + Intergenic
1055019143 9:71650243-71650265 TCCAACATGTAAATTTTGGAGGG - Intergenic
1056165357 9:83935859-83935881 TCTAACCTGTTTACTTTGGTTGG + Intergenic
1057839566 9:98474794-98474816 TCTAACATATAGGAGTTGTTGGG - Intronic
1058489875 9:105486354-105486376 TCTGACATGTAGAATTTCATTGG + Intronic
1062470231 9:136699907-136699929 TCTAAAGTGTACAATTTGGCCGG + Intergenic
1185846504 X:3442304-3442326 TTCAACTTGTAGAATATGGTGGG + Intergenic
1186588786 X:10905599-10905621 TTTAAAATATAGAACTTGGTTGG - Intergenic
1186722051 X:12315459-12315481 TCTCATATATTGAATTTGGTGGG + Intronic
1186762717 X:12740189-12740211 TGTAACCAATAGAATTTGGTGGG - Intergenic
1189504081 X:41593680-41593702 ACAAAAATGTAGAAATTGGTGGG - Intronic
1190393258 X:49953778-49953800 TCTAAAAAGTAGAATTGGATAGG + Intronic
1195488150 X:105434591-105434613 TCTAATATCCAGAATTTGGAAGG - Intronic
1196013420 X:110912534-110912556 TCTTACATGCAGAATATGTTAGG + Intergenic
1197428987 X:126335812-126335834 TATAAAATGTATAAGTTGGTGGG + Intergenic
1198633741 X:138672799-138672821 CCTAACCTGTAAACTTTGGTGGG - Intronic
1200818014 Y:7554059-7554081 TTCAACTTGTAGAATATGGTGGG - Intergenic
1201447261 Y:14071261-14071283 TCTAACATGTAATACTTGCTAGG - Intergenic