ID: 950256126

View in Genome Browser
Species Human (GRCh38)
Location 3:11507775-11507797
Sequence TCCTTCCCACATCTAGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950256126_950256130 15 Left 950256126 3:11507775-11507797 CCACACTCTAGATGTGGGAAGGA 0: 1
1: 0
2: 0
3: 4
4: 155
Right 950256130 3:11507813-11507835 GGCAACCATTTCCTGCTTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 100
950256126_950256129 -6 Left 950256126 3:11507775-11507797 CCACACTCTAGATGTGGGAAGGA 0: 1
1: 0
2: 0
3: 4
4: 155
Right 950256129 3:11507792-11507814 GAAGGAAGAGAGGAAATGGAAGG 0: 1
1: 2
2: 33
3: 559
4: 3541
950256126_950256128 -10 Left 950256126 3:11507775-11507797 CCACACTCTAGATGTGGGAAGGA 0: 1
1: 0
2: 0
3: 4
4: 155
Right 950256128 3:11507788-11507810 GTGGGAAGGAAGAGAGGAAATGG 0: 1
1: 6
2: 22
3: 310
4: 2647
950256126_950256132 20 Left 950256126 3:11507775-11507797 CCACACTCTAGATGTGGGAAGGA 0: 1
1: 0
2: 0
3: 4
4: 155
Right 950256132 3:11507818-11507840 CCATTTCCTGCTTAAAGGACTGG 0: 1
1: 0
2: 1
3: 23
4: 169
950256126_950256134 26 Left 950256126 3:11507775-11507797 CCACACTCTAGATGTGGGAAGGA 0: 1
1: 0
2: 0
3: 4
4: 155
Right 950256134 3:11507824-11507846 CCTGCTTAAAGGACTGGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950256126 Original CRISPR TCCTTCCCACATCTAGAGTG TGG (reversed) Intronic
902717558 1:18283078-18283100 ACCTGCCCACATGTGGAGTGTGG + Intronic
903283760 1:22264674-22264696 TCCTTGCCACTTCTAGGCTGGGG - Intergenic
904916620 1:33975106-33975128 TCCTTCCTACACCTAGCCTGGGG - Intronic
904945143 1:34193660-34193682 TTCTTCCCATATGTAAAGTGGGG + Intronic
904945335 1:34195045-34195067 TCCTTCCCATGTCTAGACTTAGG - Intronic
905016572 1:34782204-34782226 TCCTTCCCAAGTCTAGGCTGGGG - Intronic
905379777 1:37553673-37553695 TCCCTCCCACAAATGGAGTGTGG - Intronic
905416136 1:37805741-37805763 CCATTCCCAGACCTAGAGTGGGG - Intronic
905870137 1:41398876-41398898 TCTTTCCCAGATCCAGTGTGAGG + Intergenic
907954425 1:59214700-59214722 TCCTCCCCTCATATACAGTGAGG - Intergenic
908519495 1:64927333-64927355 TCTTTCCCTCATCTCTAGTGAGG - Intronic
911463332 1:98218460-98218482 TCCTTCCCATATGGAGAGTGTGG + Intergenic
914354932 1:146876647-146876669 TCCTACCCACATGTGGAGTAGGG + Intergenic
914838042 1:151224561-151224583 TCCTTCAAACAACTACAGTGAGG + Intronic
915556130 1:156661765-156661787 TCCTTCCCACGTCTAAACAGGGG + Intergenic
919259114 1:195167024-195167046 TCCATCTCCCATCTAGAGAGAGG + Intergenic
921188923 1:212692970-212692992 TCCTCCTCAAATCTGGAGTGAGG - Intronic
921559351 1:216638866-216638888 TCTTTACAACATCTAGAGTTGGG - Intronic
923753820 1:236772144-236772166 TCCTTCCCAAGTGTAGACTGTGG + Intergenic
1065103323 10:22353776-22353798 TCATTCCCAAATCTTGAGTAAGG - Intronic
1069712908 10:70501199-70501221 TCCTCCCCACAATTGGAGTGTGG - Intronic
1073350429 10:102815778-102815800 TCCTTTCCCCAGTTAGAGTGGGG + Exonic
1073792641 10:106955567-106955589 TGCTTCACACATATAGAGTATGG - Intronic
1075822729 10:125328656-125328678 CCCTTCCCTCATGCAGAGTGTGG + Intergenic
1076816846 10:132919250-132919272 CCCTTCCCACACCCAGAGGGCGG + Intronic
1081940205 11:46935200-46935222 TGCTTCCCCCATCTAGCTTGAGG - Intergenic
1084323248 11:68385110-68385132 TCCTGCCCTCAGCTAGAGAGGGG + Intronic
1085510234 11:77084430-77084452 CCCTCCCCACCTCTAGAGAGTGG - Intronic
1086145272 11:83544738-83544760 TCCTTCCCTCATCTATAAAGTGG - Intronic
1087170020 11:95040968-95040990 TCCTCCCCACAGCTACACTGAGG - Intergenic
1089013139 11:115146484-115146506 TAATTCCCACATGTTGAGTGAGG + Intergenic
1089695264 11:120212499-120212521 TCCTTCCCCCAGCTAAAGAGAGG + Intronic
1090397252 11:126427189-126427211 CCCTTCTCACATCTAGGCTGTGG + Intronic
1090554367 11:127858154-127858176 CCCTTCCTACATCTTCAGTGTGG - Intergenic
1091322227 11:134659865-134659887 TGCTGCCCACATCTGGACTGTGG + Intergenic
1096616717 12:52837259-52837281 CCGTTACCACACCTAGAGTGAGG - Intergenic
1097200437 12:57273680-57273702 TCCTCTCCACTACTAGAGTGGGG - Intronic
1103875041 12:124120431-124120453 ACCTTTCCACATTCAGAGTGGGG + Intronic
1104760807 12:131296702-131296724 CCCTTCCCACAGCTGCAGTGAGG - Intergenic
1104818968 12:131664090-131664112 CCCTTCCCACAGCTGCAGTGAGG + Intergenic
1106201911 13:27545192-27545214 TTGTTCCCATATCTGGAGTGAGG - Intergenic
1107821547 13:44290175-44290197 TCCTTCCCAAGGCTGGAGTGTGG - Intergenic
1108691566 13:52863804-52863826 TCCTTCCCACATGGATAATGTGG + Intergenic
1111097006 13:83529627-83529649 TCCTTCTCAAATCTAGAATCAGG + Intergenic
1111344532 13:86933320-86933342 TCCTTTCCCCAGTTAGAGTGGGG - Intergenic
1111702173 13:91704649-91704671 TCCTTGTCCCATCTTGAGTGAGG - Intronic
1111815201 13:93144309-93144331 TGTTTCCCACAGCTAGAATGTGG + Intergenic
1115471759 14:33775284-33775306 TCCTTCCCACACCTGGTATGTGG - Intronic
1117324358 14:54655242-54655264 TCCTTCCCACAGCTGGAGGTAGG + Intronic
1118867968 14:69718182-69718204 GCCTTCCCACTACCAGAGTGGGG - Intergenic
1119760921 14:77151380-77151402 TCCTTCCCACTTAAGGAGTGAGG + Intronic
1121428108 14:93867685-93867707 TCCTTCCCACATGTGGGCTGTGG + Intergenic
1122044556 14:99014097-99014119 TCATTCTCAGATCTCGAGTGAGG - Intergenic
1125627007 15:41116679-41116701 ACCTTCCCACCTCTAGCCTGCGG - Intergenic
1126561274 15:50047031-50047053 TCCCTTTCACATCTACAGTGTGG - Intronic
1130066560 15:80609576-80609598 TGCTTCCCCCATCTAGGGCGAGG - Intergenic
1131616084 15:94018686-94018708 TTCTCCCCACCTCCAGAGTGGGG - Intergenic
1132089062 15:98933089-98933111 TCCTTCCCACAGTCAGTGTGTGG + Intronic
1132385403 15:101396865-101396887 TCCTTCTCACATTTAGTGTCTGG + Intronic
1132650284 16:1018461-1018483 TCACTCCCCCAGCTAGAGTGCGG + Intergenic
1132723883 16:1330522-1330544 TCCTTGCCCCATCAAGAGAGGGG - Intergenic
1133551421 16:6858435-6858457 TCCTTCCCATAACGAGATTGTGG - Intronic
1138890515 16:61138497-61138519 TCCTTCCCACATGTGCAATGGGG + Intergenic
1139828422 16:69776314-69776336 TACTTCCCACAACTAGAGCTAGG + Intronic
1139979088 16:70838882-70838904 TCCTACCCACATGTGGAGTAGGG - Intronic
1140381147 16:74488970-74488992 TACTTTCCAAATCTAGAGGGTGG - Intronic
1140792716 16:78407820-78407842 TTCTTACCACATCTTGAGTCTGG + Intronic
1142814007 17:2411263-2411285 TCCTTCCCACCTCTTAAGGGAGG - Intronic
1143854159 17:9836210-9836232 TCCTTGACTCATCTAGAGAGTGG + Intronic
1148451600 17:47781560-47781582 TCCTTCCAACCCCTAGGGTGAGG + Intergenic
1149546965 17:57510936-57510958 TCCCTCCCACCTCCAGAGAGCGG - Intronic
1151487697 17:74411757-74411779 TACTGGCCACAGCTAGAGTGAGG + Intergenic
1156419897 18:36940284-36940306 TCGAATCCACATCTAGAGTGCGG + Intronic
1157920307 18:51707431-51707453 TCCTTCCTACATCAAGGATGAGG + Intergenic
1158314825 18:56200201-56200223 CCCTTCCCAAATCTAGAGAAAGG + Intergenic
1162023274 19:7878735-7878757 CCCTTCCCTGCTCTAGAGTGGGG + Intergenic
1163587587 19:18172579-18172601 TCTTCCCCACAACTAGAGGGGGG + Intronic
1164583906 19:29453517-29453539 TCCTTCCCACCTCCTCAGTGAGG - Intergenic
1165067945 19:33240035-33240057 CCCCTCCCCCATCTAAAGTGGGG + Intergenic
1165166503 19:33860837-33860859 TCCTTCCAGCGTCTAGAATGTGG - Intergenic
1165263114 19:34637383-34637405 TCCTTCCCACAGCCAGGCTGTGG - Intronic
1166157355 19:40924046-40924068 CCCTGCCAACATCTAGAGAGTGG + Intergenic
1167516923 19:49929038-49929060 TCCTTCCCACTCCTAGGGTCCGG - Exonic
926985967 2:18623787-18623809 TCCTTCCCATCTTTAGAGTCAGG + Intergenic
935173500 2:100628728-100628750 GCCTTCCCACATCGAGGCTGTGG + Intergenic
938186958 2:129240344-129240366 TCCTTCCCTCACAGAGAGTGTGG - Intergenic
939173493 2:138723087-138723109 TCTTTCCCACAACAAGACTGAGG + Intronic
939636990 2:144594190-144594212 CCCTGCCCACATTTAGAGTTGGG + Intergenic
945016630 2:205525263-205525285 TCCTTACCACTCCAAGAGTGGGG + Intronic
945674628 2:212841150-212841172 TCCTTTCCCCAGCTATAGTGTGG + Intergenic
948863400 2:240763685-240763707 TCCTTCTCACATCCAGTCTGGGG + Intronic
1169543548 20:6627991-6628013 TCCTTCCCATATCTGGGTTGTGG - Intergenic
1170196557 20:13694887-13694909 CCCTTCCCACATCTAGTCAGTGG + Intergenic
1170524982 20:17228019-17228041 TTCTTTCCAAATCTAGAGTCAGG - Intronic
1171150941 20:22826035-22826057 TGCTTCTCACATCCACAGTGAGG - Intergenic
1174090183 20:48040410-48040432 TCCTTCCCTCCTTTAGAGTCTGG - Intergenic
1175345222 20:58268282-58268304 TCTTTCCGACATCCACAGTGGGG - Intergenic
1175768195 20:61605808-61605830 TCCTTGCAACATCTAGAATCTGG + Intronic
1176171802 20:63699564-63699586 TCCTGCCCACAGCCAGACTGAGG + Exonic
1181476223 22:23169236-23169258 TCCTGCCCCCAGCCAGAGTGCGG - Intergenic
1181803402 22:25361313-25361335 TCTTTCCCTCAGCTAGAGAGGGG - Exonic
1182089103 22:27581920-27581942 TCTCTCCCACATCTGGATTGGGG - Intergenic
1182167099 22:28186852-28186874 TCCTACTCCCATCTGGAGTGGGG - Intronic
1183420666 22:37709655-37709677 TCCTCCCCACCTCTGGAGAGCGG - Intronic
1184251263 22:43261665-43261687 TCATTTCCACAGCTAGGGTGAGG + Intronic
950256126 3:11507775-11507797 TCCTTCCCACATCTAGAGTGTGG - Intronic
952174684 3:30848958-30848980 TTCTTCCCACATCTTGGGTCTGG + Intronic
953821794 3:46213234-46213256 TCACTCCCACATCTAGGGTTGGG + Intronic
954289795 3:49643569-49643591 TGCGTCCCACATCCAGGGTGGGG + Intronic
964727576 3:159830696-159830718 TCTGTTCCACATCTATAGTGTGG + Intronic
966917768 3:184594345-184594367 TCCTACCCACCTCCAGTGTGGGG + Intronic
969328273 4:6456709-6456731 GCCTTCCCACTTCCACAGTGAGG + Intronic
970366523 4:15364483-15364505 TCCTTCCCCCATCTACATGGTGG - Intronic
971093444 4:23371730-23371752 CCCTTCCCACATGTGTAGTGAGG + Intergenic
971892475 4:32543249-32543271 TCATCCCCACATGTAGAGAGAGG + Intergenic
973127772 4:46609535-46609557 TCTCTCCCACCTCTAGAGTTGGG + Intergenic
973331661 4:48915495-48915517 TCCCTCCCACAGCTAGTCTGTGG + Intergenic
982218898 4:153107730-153107752 TCTTTCCCACTTCCACAGTGTGG + Intergenic
986494395 5:8328129-8328151 TCTTTCCCATATTTAGTGTGAGG - Intergenic
986611405 5:9571470-9571492 CACATCCCACATCCAGAGTGGGG - Intergenic
998748361 5:145288158-145288180 TCCTTCCAAAGACTAGAGTGTGG - Intergenic
1008545445 6:52579239-52579261 TCGTTCCCCCACCTTGAGTGTGG + Intergenic
1011311206 6:85981525-85981547 ACCTTCCCATATGTAGATTGAGG - Intergenic
1014444905 6:121515730-121515752 TCCTTACCAAGTCTAGAGTATGG - Intergenic
1015680988 6:135808223-135808245 TCCTTCCTAAATCTACAGAGTGG - Intergenic
1016087128 6:139927834-139927856 GCCTCATCACATCTAGAGTGAGG - Intergenic
1019228472 6:170535816-170535838 TCCGTCCCACATCTTCAGTCTGG - Intronic
1019884761 7:3894063-3894085 TCCTTGCCATATTTAGAATGGGG - Intronic
1021542831 7:21779112-21779134 TAATTCCAACATTTAGAGTGCGG + Intronic
1024291463 7:47807507-47807529 TCCTTTTCCCATCTAGAGGGTGG - Intronic
1024482291 7:49876395-49876417 TCGTTTCCACATCTATAGTGTGG + Intronic
1025997778 7:66539005-66539027 TCCTGACCACCTCCAGAGTGTGG - Intergenic
1026990657 7:74583539-74583561 TCCTGACCACCTCTGGAGTGTGG - Intronic
1027229071 7:76261701-76261723 TCCTTCCCACAGCCAGGCTGCGG + Intronic
1027260933 7:76464130-76464152 TCCTACCCACATCCAGAAAGGGG + Intronic
1027312311 7:76962242-76962264 TCCTACCCACATCCAGAAAGGGG + Intergenic
1028312600 7:89357584-89357606 TCCTTCCCTCATCCAGAGTCAGG + Intergenic
1029168749 7:98616731-98616753 TCCTTCCCGCCTCGAGAGTGAGG + Intergenic
1030267122 7:107632002-107632024 TCCTTTCCCCAGTTAGAGTGGGG + Intergenic
1032730848 7:134641521-134641543 ACCTTCCAACTTGTAGAGTGAGG + Intergenic
1034227426 7:149494767-149494789 TCCTACCCACACCTACACTGTGG + Intronic
1037810037 8:22081566-22081588 TCCTTTCCTCAGGTAGAGTGGGG + Exonic
1038111255 8:24501258-24501280 TTCTTCCCACATCAAGAATCAGG + Intronic
1038401658 8:27288593-27288615 TCCTTCCAACATCTGGATTTTGG + Intronic
1042773202 8:72401089-72401111 TCTATTCCAAATCTAGAGTGTGG + Intergenic
1045306892 8:100965415-100965437 TAATTCCCACATGTAGAGGGAGG - Intergenic
1048048046 8:130791727-130791749 TCCTCCCCACACCTGGAGAGAGG - Intronic
1049232369 8:141491180-141491202 TGCTTCCCACTTCCACAGTGCGG - Intergenic
1050874879 9:10621555-10621577 TTCTTCCCACTTCTCCAGTGTGG - Intergenic
1050894900 9:10873827-10873849 TCATTCCCACATATTGAGAGAGG - Intergenic
1051476856 9:17517743-17517765 TCCTTCACACTTCTAGAGGCTGG - Intergenic
1055574511 9:77648043-77648065 TCCTCCCCAGAGCGAGAGTGGGG - Exonic
1058647112 9:107140999-107141021 TCCTTCCAAAATGTACAGTGTGG + Intergenic
1058647691 9:107145839-107145861 TCCTTCCCACCTGTAAAATGGGG + Intergenic
1059720117 9:116951614-116951636 TCCTACTCATCTCTAGAGTGTGG - Intronic
1062710740 9:137973956-137973978 CCCCTCCCAGATCTAGGGTGTGG + Intronic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1196716985 X:118821802-118821824 TCCTTCTCTCATGTAAAGTGTGG - Intergenic
1198574031 X:137990482-137990504 TCTTTCCCAGATATAGAGTCTGG + Intergenic
1200236951 X:154472376-154472398 TCCTCTCCACAGCTAGGGTGCGG - Intronic