ID: 950256347

View in Genome Browser
Species Human (GRCh38)
Location 3:11509904-11509926
Sequence CAGGATCCTGATAGTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950256343_950256347 10 Left 950256343 3:11509871-11509893 CCATACTTATTTACTGGGTCTTG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 950256347 3:11509904-11509926 CAGGATCCTGATAGTGATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 160
950256340_950256347 18 Left 950256340 3:11509863-11509885 CCAGCGCTCCATACTTATTTACT 0: 1
1: 0
2: 0
3: 5
4: 86
Right 950256347 3:11509904-11509926 CAGGATCCTGATAGTGATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950256347 Original CRISPR CAGGATCCTGATAGTGATCT TGG Intronic
900395995 1:2453484-2453506 CGGAATGCTGACAGTGATCTGGG + Intronic
904577274 1:31513076-31513098 CTGGAACCTGACAGTGACCTGGG - Intergenic
905369355 1:37474840-37474862 CAGGTTCCTGATCGGGATCGCGG + Intronic
907831750 1:58070912-58070934 CAGGTGCCTGAGAGTGATCCAGG + Intronic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
911410106 1:97493516-97493538 CAGGATCTTGCTAGTAAACTTGG + Intronic
912032920 1:105272660-105272682 CAGTGTCGTGATCGTGATCTTGG + Intergenic
918878283 1:190080152-190080174 CAGGATACTTATGGTGATCTGGG + Intergenic
920384943 1:205564420-205564442 CAGGATCCTCTTAGTGACCTGGG - Intergenic
921281926 1:213575853-213575875 CAGCATCCTCATATTGAGCTGGG - Intergenic
921325684 1:213984707-213984729 CAGGGTGCTGATAGTGATGGTGG + Intronic
921747575 1:218754871-218754893 GTGGATCCTGAGAGTGCTCTGGG - Intergenic
922340040 1:224647787-224647809 CAGGTTCCTTATGCTGATCTGGG - Intronic
1065231177 10:23599847-23599869 AAGGATACTAAAAGTGATCTTGG + Intergenic
1065794437 10:29292827-29292849 CAGGATCCTGAGTGTCACCTTGG - Intronic
1065948121 10:30625933-30625955 CAGGATCCTGAGTGTCACCTTGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1075665303 10:124225530-124225552 CAGGATCCTGGCAGTGTTCATGG + Intergenic
1078848404 11:15142062-15142084 CAGCCTCCTGAGAGAGATCTGGG + Intronic
1079122170 11:17693966-17693988 CAGGGTGCTGATGTTGATCTGGG + Intergenic
1079204522 11:18402677-18402699 CAGGATCTTGATATTGATCATGG - Intronic
1080164252 11:29217868-29217890 ATGGAACCTGAGAGTGATCTTGG - Intergenic
1082622758 11:55444470-55444492 CAGGATCCTGAGAGAGGCCTGGG - Intergenic
1082834663 11:57642786-57642808 CTGGACCCTGAGAGGGATCTTGG + Intergenic
1085779875 11:79398385-79398407 CAGGGTCCTGAGAGAGAGCTGGG + Intronic
1087643188 11:100777355-100777377 TAGAAGCCTGAGAGTGATCTTGG + Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1089802239 11:121042741-121042763 CATGGTCCTGGTAGTAATCTAGG + Intronic
1090130324 11:124135270-124135292 CAAGATGCTGACAGGGATCTGGG + Intronic
1095254991 12:40024088-40024110 CAGAATCCTGATAGAGACATAGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100650475 12:96583346-96583368 CAGGATTCTGATCTTGACCTTGG + Intronic
1101166917 12:102047236-102047258 CAGCATCCTGATTGTATTCTGGG + Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1107319467 13:39170010-39170032 AAGGATCCTCATTGTCATCTGGG + Intergenic
1108212760 13:48154953-48154975 CAGGTTCCTGGAAGTGATGTGGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114451469 14:22829211-22829233 CAATATCCTGATAGAGCTCTCGG - Intronic
1116213285 14:41975779-41975801 AAGGAAGCTCATAGTGATCTAGG - Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117648957 14:57882291-57882313 CTGGATTCTGAAAATGATCTTGG - Intronic
1118685152 14:68283586-68283608 CGGCATCCTGTCAGTGATCTTGG - Intronic
1118986431 14:70759595-70759617 CAGAAGCCTGAAAGTGATGTGGG - Intronic
1119843506 14:77810908-77810930 CAAGATCATGAGAGTGATCCAGG - Intronic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1122365272 14:101191442-101191464 CAGGGTCCTGAGAGTCAGCTTGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1125326481 15:38540720-38540742 CAGGATCCTTAAAGATATCTGGG - Intronic
1125511109 15:40292878-40292900 CAGGCTCCTGCTGCTGATCTTGG + Intronic
1126420746 15:48469723-48469745 AATGATGTTGATAGTGATCTGGG + Intronic
1126540144 15:49813344-49813366 AAGTATCCTAATAGTAATCTTGG - Intergenic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1135130210 16:19847429-19847451 CTGGATCCAGATAGTGAACATGG + Intronic
1139561294 16:67744035-67744057 CAGTATCCTGGTCGTGATCTTGG - Intronic
1142663424 17:1447260-1447282 CAGGATTCTCATAGCTATCTGGG + Intronic
1142976027 17:3645016-3645038 CAGGATGCTGAAAGTGATGCTGG - Intronic
1143627378 17:8118274-8118296 CAGGCTCCTGATATCCATCTGGG - Exonic
1144326572 17:14187802-14187824 CTGGATGCTGAGAGTGATCATGG + Intronic
1144475451 17:15584668-15584690 CTGGATGCTGAGAGTGATCATGG + Intronic
1144507253 17:15842995-15843017 CAGGATCCAGACACTGACCTGGG - Intergenic
1145171382 17:20660600-20660622 CAGGATCCAGACACTGACCTGGG - Intergenic
1149442574 17:56687110-56687132 CAGTGTCCTGAAAGTGATCATGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1162333413 19:10045001-10045023 AAGGATATTGATAATGATCTTGG + Intergenic
1166125014 19:40709879-40709901 CATGACCCTGATAGTGGTTTAGG + Intronic
1166734648 19:45076769-45076791 TAGGTGCCTGATAGTAATCTGGG + Intergenic
1168502713 19:56906867-56906889 CAGGATCCTGGAAGTGAGGTGGG + Intergenic
925631924 2:5903226-5903248 CAGGTTCCTTAAAGTAATCTAGG - Intergenic
926231509 2:11007736-11007758 CATCATCCTGATAGTGTCCTGGG + Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
932021713 2:68094367-68094389 CAGTATCCTGATAGTGACAGTGG + Intronic
935069827 2:99684290-99684312 CAGGAGCCAGATGGTCATCTTGG - Intronic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937315980 2:120932371-120932393 CAGGATCCTGAGAGGGAACGGGG - Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
941443894 2:165575829-165575851 CAGGATCCTGAGACTAATTTAGG + Intronic
942080485 2:172395567-172395589 CAGCATCTTGATAGTCAGCTGGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1169282756 20:4280991-4281013 CAGCATCATGATAGTGCTGTGGG + Intergenic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1173382628 20:42559936-42559958 CAGGATGCTGAAAGAGAGCTCGG - Intronic
1174034480 20:47659953-47659975 CAGGGTCCTGAAACTGATCATGG - Intronic
1176994546 21:15540478-15540500 CACTCTCCTGAAAGTGATCTTGG - Intergenic
1177009102 21:15709841-15709863 CAGGATCCTGAGAATGAGGTTGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178730981 21:35102454-35102476 CAGGATTCCGATAGGGCTCTTGG - Intronic
1181731764 22:24852327-24852349 CTGTATCCTGATGGTGATGTGGG - Intronic
1182042459 22:27249086-27249108 CATGATCCTGAAAGCCATCTGGG - Intergenic
1182935183 22:34215498-34215520 CAAGATCGTCATAGTGATTTAGG - Intergenic
950256347 3:11509904-11509926 CAGGATCCTGATAGTGATCTTGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
955066376 3:55536784-55536806 CAGCATTCTGAGAGTGATCTAGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
960012314 3:112847651-112847673 CAGGATATTGTTAGAGATCTTGG - Intergenic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962593951 3:136920632-136920654 TAGGATGATGATACTGATCTTGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
964118414 3:153159828-153159850 CCAGATCCTGAAAGTGAACTTGG + Intergenic
965667477 3:171110734-171110756 CTGGATCCTGCTTGTGATCCAGG + Exonic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967652609 3:192005220-192005242 CAGGACTCTGATAGTGACCTAGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970189091 4:13493721-13493743 CATGATCCTAATAGTGCTTTTGG - Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973567678 4:52204669-52204691 CAGCATCCTGTTGATGATCTGGG - Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
975185800 4:71400923-71400945 CAGTGTCCTGGAAGTGATCTTGG + Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
979910028 4:126352991-126353013 GAGGGTCCTCATAGTGAACTTGG + Intergenic
981045787 4:140263801-140263823 CAGGCTCCTGAAAGTGTCCTCGG - Intronic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
986476050 5:8134634-8134656 CAGGATGCTGATGGTGGTCAGGG + Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990868420 5:60404881-60404903 CTGGTTCCTGATGGTGATCTGGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
996143424 5:119943604-119943626 CATGTCCCTGACAGTGATCTTGG + Intergenic
1000668298 5:164026709-164026731 CAGGATCTTGATAGTCATGATGG + Intergenic
1001267346 5:170283499-170283521 CAAGATCCTGCCAGTGAGCTAGG - Intronic
1004220462 6:13742458-13742480 CAAGATCCTGAAAGTCAACTAGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019120810 6:169802051-169802073 CAGGAGGCTGATGGTGAGCTTGG + Intergenic
1019232298 6:170577783-170577805 CAGGATGATTATAGGGATCTTGG + Intronic
1022622976 7:32004145-32004167 CAAGATCTTTCTAGTGATCTTGG - Intronic
1023868729 7:44251577-44251599 CAGGATCCGGGCAGTGATTTTGG - Intronic
1029109359 7:98204649-98204671 CAGCATCCTGAGTGTGCTCTCGG + Intronic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1041791513 8:61701004-61701026 CTAGATCTTGATAGGGATCTGGG - Intronic
1043380781 8:79699870-79699892 CAGGATCCTGGAATTGAACTGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1047087800 8:121538318-121538340 CTGGATCCTGATAGGGAAGTTGG - Intergenic
1048142864 8:131811719-131811741 CAGCAACCTGATAGTCATGTAGG - Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1050326547 9:4503440-4503462 CAGGATCATGTTAGTGATTGTGG - Intronic
1050463586 9:5897569-5897591 CGGCATCCTGACAGTGATCCTGG + Exonic
1050802197 9:9629473-9629495 CAGGATGCTGATTGTAATTTGGG + Intronic
1052337044 9:27330677-27330699 AAGGATCCTGAAAATGCTCTTGG + Intronic
1056971850 9:91211255-91211277 CAGGATACAGATTGTGATTTGGG - Intergenic
1059278102 9:113111989-113112011 CATCTTCCTGATAGTGATCAAGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1060138796 9:121185472-121185494 CTGTATCCTGATAGTGATGATGG - Intronic
1060351219 9:122862346-122862368 TAGAATCCTGAAAGTCATCTAGG - Intronic
1062394606 9:136347786-136347808 CAGGCTCCTGAGAGTGCTCAGGG + Intronic
1062637848 9:137500869-137500891 CAGCATCCTGTTCGTGGTCTCGG - Exonic
1186402065 X:9269286-9269308 CAGGGTTCTGAAAGGGATCTGGG + Intergenic
1187738341 X:22327707-22327729 CAGGAGACTGGTAGTGATCTTGG + Intergenic
1188314005 X:28651493-28651515 AAGGATCCTAATAATCATCTAGG - Intronic
1188399393 X:29726459-29726481 GAGTATCCTTATAGTGATCCTGG + Intronic
1188488360 X:30708275-30708297 AAGGAACCTGAAACTGATCTGGG + Intronic
1188641690 X:32513573-32513595 CAGAAACCTGAAAGTGAACTGGG - Intronic
1188830221 X:34887493-34887515 TGGTATCCTGATTGTGATCTTGG - Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1190264270 X:48818038-48818060 CAGGATCCTGATTGTGGATTGGG + Exonic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192968780 X:76208374-76208396 CATTACCCTGATAGTGTTCTCGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1200735846 Y:6794557-6794579 CAAGATCCTGCTACAGATCTAGG + Intergenic