ID: 950258070

View in Genome Browser
Species Human (GRCh38)
Location 3:11522104-11522126
Sequence AGGGATAGACAGATCTGAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 259}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950258070_950258079 21 Left 950258070 3:11522104-11522126 CCGTTTCAGATCTGTCTATCCCT 0: 1
1: 0
2: 1
3: 22
4: 259
Right 950258079 3:11522148-11522170 AGCATTACAAGGTTATTCTTGGG 0: 1
1: 0
2: 0
3: 18
4: 159
950258070_950258080 24 Left 950258070 3:11522104-11522126 CCGTTTCAGATCTGTCTATCCCT 0: 1
1: 0
2: 1
3: 22
4: 259
Right 950258080 3:11522151-11522173 ATTACAAGGTTATTCTTGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 178
950258070_950258078 20 Left 950258070 3:11522104-11522126 CCGTTTCAGATCTGTCTATCCCT 0: 1
1: 0
2: 1
3: 22
4: 259
Right 950258078 3:11522147-11522169 AAGCATTACAAGGTTATTCTTGG 0: 1
1: 0
2: 3
3: 12
4: 165
950258070_950258074 10 Left 950258070 3:11522104-11522126 CCGTTTCAGATCTGTCTATCCCT 0: 1
1: 0
2: 1
3: 22
4: 259
Right 950258074 3:11522137-11522159 CCCTTAACCCAAGCATTACAAGG 0: 1
1: 0
2: 0
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950258070 Original CRISPR AGGGATAGACAGATCTGAAA CGG (reversed) Intronic
905121336 1:35684361-35684383 AGAGATAGACAGTTCAAAAAAGG - Intergenic
905251932 1:36654858-36654880 AAGGACAGGCAGATCTGAAGGGG - Intergenic
907980366 1:59474326-59474348 AGCGATTGTCAGAGCTGAAAGGG + Intronic
908508999 1:64836039-64836061 AGGGATGGACACATTTTAAATGG + Intronic
909278103 1:73714627-73714649 AGGAATAAACAGATCTCAAGAGG - Intergenic
911124811 1:94331403-94331425 AGTGATAGACAGTTATGAGAAGG + Intergenic
913126604 1:115796268-115796290 AGAGATAAAGAGAGCTGAAAAGG - Intergenic
914960767 1:152204440-152204462 AGGCTTAGAAAGATCTGAAAAGG - Intergenic
916584414 1:166138010-166138032 AGGGCTAGAGAGATCTAAGAGGG - Intronic
918405577 1:184208692-184208714 GAGGAAAGACAGGTCTGAAATGG + Intergenic
919585038 1:199427111-199427133 AAATATTGACAGATCTGAAAGGG + Intergenic
919596855 1:199574913-199574935 AGGTATAGACAGTTCAGAGATGG + Intergenic
920566703 1:206979954-206979976 TGGGATAGAGAGATCTGCCAGGG - Intergenic
921103567 1:211952989-211953011 AGACATAAACACATCTGAAAAGG + Intronic
921387564 1:214586375-214586397 AGGGACAAATAGATCTGAACAGG - Intergenic
921877353 1:220213550-220213572 AGGGACAGTCAGAGCTAAAAAGG - Intronic
922017486 1:221665582-221665604 GGTGATAGAAAGTTCTGAAAGGG - Intergenic
923638860 1:235731031-235731053 AGGGATAGACAGAAATCAGAAGG - Exonic
923964982 1:239127509-239127531 AGGGACAGACAGATGAGAACAGG + Intergenic
1063269130 10:4487178-4487200 GGAGATAGACAGATCTCACAAGG + Intergenic
1063663405 10:8048636-8048658 AGGGAGGGAGAGAGCTGAAAAGG + Intergenic
1064418437 10:15169365-15169387 ATGGATAGATAGATGCGAAATGG - Intergenic
1064889093 10:20148940-20148962 AGGAATAGAAATATCTGACATGG - Intronic
1065048812 10:21769268-21769290 ATGGATCCTCAGATCTGAAAAGG + Intronic
1067723964 10:48752132-48752154 AGGGATTGACAGAGCAGGAATGG - Intronic
1068481835 10:57599579-57599601 AGCATTAGACAGATATGAAATGG + Intergenic
1069310770 10:67033681-67033703 AGGTACAGACAGATCCTAAATGG + Intronic
1070290777 10:75111861-75111883 CGGGATAGTCAGCTCTGGAATGG + Intronic
1072793298 10:98335211-98335233 AGGGATTGACATATATGGAAAGG - Intergenic
1072836502 10:98720217-98720239 AGGAAAAGACTGATCTAAAACGG + Intronic
1073736677 10:106355530-106355552 AGGGAGATACAGATCAGAAAGGG - Intergenic
1074801782 10:117006982-117007004 AGGGGTAGAATGATCTAAAAGGG + Intronic
1075336204 10:121610434-121610456 AGGGTTAGACAGAGCTGCAGAGG - Intergenic
1078169991 11:8922429-8922451 AGGAATAGACCAATCTAAAAGGG + Intronic
1078370220 11:10738074-10738096 AGGGAGAGAAGGATGTGAAATGG - Intergenic
1078846000 11:15119004-15119026 GGAGTTAGACAGATCTGGAAAGG - Intronic
1079125468 11:17715178-17715200 AGGCATGGAGAGGTCTGAAATGG + Intergenic
1079171869 11:18104488-18104510 AGGGATAGTCATATTAGAAAAGG + Intronic
1079755228 11:24250898-24250920 AGGCATAGAAAGAGTTGAAAAGG + Intergenic
1081338326 11:41895811-41895833 AGGGAAAGAGTGATCTTAAAAGG + Intergenic
1082983907 11:59150123-59150145 AGATATAGACACTTCTGAAAGGG - Intronic
1085795794 11:79538331-79538353 AGGGAAAGACAGTTTTGGAAGGG - Intergenic
1087610999 11:100433902-100433924 AGCCATAGGCACATCTGAAAAGG + Intergenic
1090869857 11:130734520-130734542 AGAGATAGACATATCTTATAAGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091160086 11:133411990-133412012 ATGGATAGACAGATCTGGAGGGG - Intronic
1097396585 12:59082491-59082513 AGTGAGAGACAGAACTGGAAAGG - Intergenic
1098078768 12:66761120-66761142 AGGGGTAGGGAGAGCTGAAAAGG - Intronic
1098504663 12:71235828-71235850 AGGGACAGACAGATATGGAAAGG - Intronic
1099219775 12:79899375-79899397 TGGGAGAGACAGACCAGAAAGGG - Intronic
1100233581 12:92634742-92634764 AGTGAAAGAAACATCTGAAAAGG + Intergenic
1101557631 12:105825050-105825072 AGGGATAAACAGCTGTGAAGTGG - Intergenic
1102663063 12:114546456-114546478 AGAGATCCACAGATCTGGAAAGG - Intergenic
1103268189 12:119648612-119648634 TGGGAAAGACAGATATTAAATGG - Intergenic
1104696801 12:130870529-130870551 AGGGTTAGATAGATGTCAAAAGG - Intergenic
1105915001 13:24906209-24906231 AGGGATCAACAGATCTGCAAAGG - Exonic
1105945007 13:25181642-25181664 AGGAATAGGGAGGTCTGAAATGG - Intergenic
1108081755 13:46744498-46744520 AGGGAGAGACACTTATGAAATGG + Intronic
1108880131 13:55103496-55103518 AGAGAAAGCCATATCTGAAAAGG - Intergenic
1109018368 13:57050600-57050622 AGGGATGGAGAGTTCTGTAAAGG - Intergenic
1110666644 13:78125071-78125093 AGAGAGAGAGAGATCTGAAAGGG + Intergenic
1112007582 13:95267366-95267388 AGGGAAAGACACATCTCACATGG - Intronic
1112238695 13:97659703-97659725 AGGGCCAGAAAGCTCTGAAAAGG + Intergenic
1112417489 13:99215860-99215882 AGGAATAGTAAGAACTGAAAAGG - Intronic
1113210950 13:107980166-107980188 AAGGATAGACATATCAAAAATGG - Intergenic
1116551762 14:46249228-46249250 AGGGTCAGACAGCTCAGAAAAGG - Intergenic
1117497470 14:56319878-56319900 AGGGTAAGACAGCACTGAAAGGG - Intergenic
1118577958 14:67263299-67263321 AGGGATATTCAGATTTGTAAAGG + Intronic
1118681072 14:68242100-68242122 AGTGAGAGACAGATCTGGAAAGG - Intronic
1118854329 14:69609841-69609863 AGTGATGGACAGATCTGCATAGG + Intergenic
1123487783 15:20756327-20756349 AGGGCTAGACAGATGGGAATTGG + Intergenic
1123544282 15:21325405-21325427 AGGGCTAGACAGATGGGAATTGG + Intergenic
1125082376 15:35690266-35690288 AGTGAAAGATAGGTCTGAAATGG + Intergenic
1126861261 15:52885207-52885229 AGGGAGAAACAGATTTGGAATGG - Intergenic
1126989943 15:54362853-54362875 GGGGATAGACAGATCATGAAAGG + Intronic
1127490650 15:59459474-59459496 AGGGATTTAGAGATCTGGAAAGG - Intronic
1127742013 15:61918164-61918186 TGGGATAGCCAGACCTGAAGAGG - Exonic
1128773659 15:70302472-70302494 ATGGATAGATAGATATGAGATGG + Intergenic
1129386038 15:75196543-75196565 AGGGCTATGCACATCTGAAAGGG - Intronic
1130300988 15:82679943-82679965 AGAGCTAGTCAGATCTGAGATGG - Intronic
1131408113 15:92183331-92183353 AGGTGTAGATAGATATGAAATGG + Intergenic
1132378895 15:101352062-101352084 TGGGCTAGACAGAAGTGAAAAGG + Intronic
1202952628 15_KI270727v1_random:52676-52698 AGGGCTAGACAGATGGGAATTGG + Intergenic
1136657343 16:31717965-31717987 ATGGAAAGACAGAGCTGGAATGG - Intronic
1136673647 16:31879739-31879761 ATGGAAAGACAGAGCTGGAATGG - Intronic
1137862008 16:51856169-51856191 AGGGATAGGGAGATTAGAAAAGG + Intergenic
1140697752 16:77551782-77551804 AGTGACAGACAAATCTGAGAGGG + Intergenic
1142790035 17:2256783-2256805 ATAGATAGACAGATTTGATACGG + Intronic
1143233766 17:5380215-5380237 GGGGATCCACAGAGCTGAAAGGG + Intronic
1148715503 17:49712840-49712862 AGGGTGAGACAGATATGACAAGG - Intronic
1149529972 17:57387326-57387348 AGGGATAAACAGAAGAGAAAAGG - Intronic
1149785848 17:59434276-59434298 AGGGATGGAAAGATGTCAAAAGG - Intergenic
1150159054 17:62878888-62878910 AGGGATAGTGTGATCTCAAAAGG - Intergenic
1150245875 17:63674694-63674716 AGGGATAAAGACAGCTGAAAAGG + Intronic
1150279362 17:63920056-63920078 AGCTCTATACAGATCTGAAAAGG - Intergenic
1150472561 17:65449480-65449502 AGGGATGGACAGATTTTAAGGGG + Intergenic
1150774247 17:68066389-68066411 AGGGCTAGAAAGATCTGTCATGG + Intergenic
1152093628 17:78260133-78260155 ATAGATAGACAGATTTGAGATGG + Intergenic
1152275646 17:79355193-79355215 AGGGAGAGTCAGCTCTGAACAGG - Intronic
1154445424 18:14431577-14431599 AGGGCTAGACAGATGGGAATTGG + Intergenic
1155592970 18:27449083-27449105 AGTTATAGACTGAGCTGAAAAGG + Intergenic
1156512026 18:37645309-37645331 AAGAATAGACATAGCTGAAAAGG + Intergenic
1157489044 18:48109443-48109465 AGTTCTAGAAAGATCTGAAAGGG - Intronic
1160095554 18:75869075-75869097 AGAGATAGAAAGATCTTGAAAGG + Intergenic
1160244689 18:77147705-77147727 AGGGGTTTACAGATCTGAGATGG + Intergenic
1161868601 19:6853207-6853229 AGGGATAGACAGGAGTGGAAAGG - Intronic
1162182212 19:8877908-8877930 AAGGATAGACAGATGTTAGAAGG - Intronic
1162828173 19:13267214-13267236 AGGGAGAGACAGATCGTAAGTGG + Intronic
1163783455 19:19262210-19262232 AGGGAAAGACAGAGATGGAAAGG + Intronic
1164698858 19:30267909-30267931 AGAGAGAGAGAGATCTGCAACGG + Intronic
1164848502 19:31458057-31458079 AGGGATACACATATCTAAAAAGG - Intergenic
1168724627 19:58574007-58574029 AGAGAGAGGCAGATCAGAAAGGG + Intergenic
927222728 2:20728883-20728905 AGGGATTAAAAGATCAGAAAAGG + Intronic
927268646 2:21182015-21182037 AGGGATAGACCTCTCAGAAAGGG - Intergenic
927476850 2:23420219-23420241 AGCTGTAGACAGCTCTGAAATGG - Intronic
929194814 2:39173994-39174016 AGAAATATACAAATCTGAAAAGG + Intergenic
930597070 2:53402013-53402035 AGGGATAGAGAGTGCTGAAGTGG + Intergenic
932552248 2:72783644-72783666 ATGGATAGACATTTCTCAAAAGG - Intronic
933887866 2:86736892-86736914 AGGTACAGAAAGATCAGAAATGG + Intronic
933922312 2:87059820-87059842 AGGTACAGAAAGATCAGAAATGG - Intergenic
935554696 2:104496367-104496389 AGAGAGAGAGAGAACTGAAATGG - Intergenic
935965210 2:108466080-108466102 ATGAATAGACATTTCTGAAAAGG - Intronic
936369933 2:111895368-111895390 AGCTGTAGACAGAGCTGAAAGGG + Intergenic
936809198 2:116375808-116375830 GGGGAAAGACAGATGTTAAATGG - Intergenic
941652748 2:168110694-168110716 AGGGATAGACAAATGATAAAGGG - Intronic
943710460 2:191088744-191088766 CAGAATAGACAGTTCTGAAATGG + Intronic
944788284 2:203096456-203096478 AGGGAGAGACAGATTTATAAAGG - Intronic
946687456 2:222284985-222285007 AAGGCAAGAAAGATCTGAAAAGG + Intronic
947868128 2:233415594-233415616 AGGCATAGATAAATTTGAAAAGG + Intronic
949060632 2:241954984-241955006 AGGGAAAGAAAGAGCAGAAAGGG - Intergenic
1169580297 20:7015284-7015306 ATGGATACACAGATCACAAATGG - Intergenic
1169905691 20:10600977-10600999 ATGGACAGACAGATGAGAAAAGG + Intronic
1170282121 20:14661348-14661370 ATGAACAGACAGTTCTGAAAAGG - Intronic
1170389340 20:15854762-15854784 AGGGATAAACAGAGCAGCAAAGG - Intronic
1172805348 20:37607864-37607886 AGAGAGAGACAGCCCTGAAAGGG - Intergenic
1172987923 20:39007821-39007843 AGGGAGAGCCAGGACTGAAAGGG + Intronic
1173081085 20:39868119-39868141 AGGGATAGACACTTTTGGAAGGG - Intergenic
1173391384 20:42637597-42637619 AGGGACAGACAGTAATGAAAGGG - Intronic
1174127691 20:48319338-48319360 AAGGAGAGACAGATCTAGAATGG - Intergenic
1174538965 20:51274510-51274532 AGAGAGAGACAGATCTCTAATGG - Intergenic
1176450557 21:6858282-6858304 AGGGCTAGACAGATGGGAATTGG - Intergenic
1176828726 21:13723300-13723322 AGGGCTAGACAGATGGGAATTGG - Intergenic
1176960892 21:15157688-15157710 AGGGATGGAGAGAGCTGAAATGG + Intergenic
1177888204 21:26771747-26771769 TGGGAGAAACAGATTTGAAAGGG + Intergenic
1179033561 21:37741092-37741114 AGGGAAAGAAAGATCTGACCTGG - Intronic
1179521015 21:41944625-41944647 AGGACTAGGCAGATCAGAAAAGG - Intronic
1181175733 22:21033777-21033799 AGGGTTAGGCAGATTTGTAATGG + Intergenic
1182380350 22:29882959-29882981 ATGGCTAGACAGATGGGAAATGG - Intergenic
1184936137 22:47723447-47723469 AGGGATGCACAGATGTTAAATGG + Intergenic
1203307545 22_KI270736v1_random:119914-119936 AGGGATAGAGAGGACTGGAATGG + Intergenic
949833084 3:8237363-8237385 AGAAATAAAGAGATCTGAAATGG + Intergenic
949912158 3:8920607-8920629 AGGGGTACACAGATGTCAAATGG + Intronic
950250740 3:11463184-11463206 ATGGATAGAAATATCTGAGAGGG - Intronic
950258070 3:11522104-11522126 AGGGATAGACAGATCTGAAACGG - Intronic
950858337 3:16126073-16126095 GGGGCTAGACAGATCTAAGATGG + Intergenic
951465779 3:22999175-22999197 AGGGATAGAGAGATATGAATTGG - Intergenic
952506180 3:34008597-34008619 AAGGAGAGACAGCTCTGAGATGG + Intergenic
953238267 3:41125243-41125265 AGGGATAGAGGGATCTGGAAAGG - Intergenic
953713657 3:45296938-45296960 AGGGATTGAGAGAACAGAAAGGG - Intergenic
955180881 3:56668305-56668327 GGGGACAGAGAGAACTGAAAGGG + Intronic
955471289 3:59288993-59289015 AGGTGTAAACAGATCAGAAAAGG - Intergenic
956413017 3:68997969-68997991 AGGGAAAGACAGTACTGAAGCGG + Intronic
956610184 3:71114699-71114721 AGGGAGAGACAGATTCGACAAGG + Intronic
956897005 3:73672660-73672682 ATGGGTAGAAAGAACTGAAAGGG - Intergenic
957335401 3:78821512-78821534 AAGGATAGGCACATCTGAACAGG - Intronic
957514730 3:81235353-81235375 AAAGAAAGACAGATCTTAAAGGG - Intergenic
958969485 3:100595757-100595779 AGGAATAGACAATTCTCAAAAGG - Intergenic
959209462 3:103358406-103358428 AGGCAGAGACAGTTCTGAAGAGG - Intergenic
960367581 3:116791837-116791859 AGATATTGACAAATCTGAAAAGG - Intronic
960552372 3:118990217-118990239 TGTGGTAGACAGATTTGAAAGGG + Intronic
961437419 3:126928960-126928982 AGGGCTATACAGAGATGAAATGG - Intronic
964203769 3:154147917-154147939 GGGGAGAGAATGATCTGAAAAGG - Intronic
964488623 3:157210666-157210688 AGGGACAGACAGCTCTCCAATGG - Intergenic
965578539 3:170243699-170243721 AGGCATAGACAGTTTTTAAAAGG - Intronic
965822470 3:172698535-172698557 TGGGACAGGCAGCTCTGAAAAGG + Intronic
966115534 3:176457036-176457058 AGGGATAGACTGACATGTAATGG + Intergenic
966298951 3:178457024-178457046 TAGGATAGACAGGGCTGAAAAGG + Intronic
966578522 3:181531854-181531876 ATGGAAAGACAGATCTTAAAGGG - Intergenic
966884943 3:184372368-184372390 AGGGATACACAGGACTGAAAAGG - Exonic
968755783 4:2415926-2415948 GGCCAGAGACAGATCTGAAATGG + Intronic
970009805 4:11446640-11446662 AAGTACAGACAGATCAGAAATGG + Intergenic
970411883 4:15816854-15816876 AGGGATACAGAGATAGGAAAGGG + Intronic
971291991 4:25351421-25351443 GGGAATAGACAGGTTTGAAATGG + Intronic
971356943 4:25903666-25903688 ATGGATAGACAGAGATGAGAGGG + Intronic
972775783 4:42239180-42239202 AGGTATAGAAAGAACTGAAAGGG - Intergenic
975603308 4:76125887-76125909 AGGGAGAGACCTATCTCAAAAGG + Intronic
976103403 4:81590158-81590180 AAGGACAGAAAGATCTGTAAGGG - Intronic
980187540 4:129481073-129481095 AGGGATAGGCAAAACAGAAATGG - Intergenic
981068167 4:140507245-140507267 AGGGAGAAACAGATTTAAAAAGG - Intergenic
982269571 4:153572649-153572671 AGAGCTAGACACAGCTGAAATGG - Intronic
983018443 4:162643809-162643831 GGGGATAGACAGAACTGCAATGG + Intergenic
983450844 4:167909186-167909208 AATGATAGACAAATCTAAAAAGG + Intergenic
984637229 4:182124423-182124445 AGGGAAAGAGAGATCTGAACTGG + Intergenic
986142696 5:5046594-5046616 AGGTCTAAACAGATCTGCAAAGG - Intergenic
987233699 5:15921440-15921462 ATGGACAGACAGATCTGAAAAGG - Intronic
987843590 5:23253462-23253484 AGGGATATTCAAAACTGAAAGGG - Intergenic
988390394 5:30620664-30620686 AGGGAGCAACAGATCAGAAAAGG - Intergenic
988696099 5:33623993-33624015 AGTGAGATAGAGATCTGAAATGG - Intronic
989793336 5:45434356-45434378 AGGTTTACACAGCTCTGAAATGG + Intronic
990647300 5:57858842-57858864 ATGGATAGACACATATGGAAAGG + Intergenic
993239652 5:85365717-85365739 ATTGATGGACATATCTGAAAGGG - Intergenic
994083578 5:95733926-95733948 AAGGACACACAGACCTGAAATGG - Intronic
995076583 5:107991702-107991724 AGGGAAACTTAGATCTGAAAGGG - Intronic
995425524 5:112017785-112017807 AGGCATAGAAATGTCTGAAATGG - Intergenic
995444785 5:112230528-112230550 ACGAATAGACAGTTCTCAAAAGG - Intronic
995524539 5:113039955-113039977 GGTGAGAGACAGATCTGAGATGG + Intronic
996123498 5:119698443-119698465 AGGAATAGAAAGAACTCAAATGG - Intergenic
997509223 5:134441951-134441973 GTGGATACACAGGTCTGAAATGG + Intergenic
1000720499 5:164700263-164700285 AGGGAAAGAATCATCTGAAAGGG + Intergenic
1001197026 5:169682488-169682510 AGGTGGAGACAGATCTCAAAGGG + Intronic
1004009238 6:11665979-11666001 AGGGATAGAGAGAGCTATAAAGG + Intergenic
1005143228 6:22658165-22658187 GGGAATAGAAAGATCAGAAAAGG + Intergenic
1006903532 6:37518097-37518119 AGAGAAAGGCGGATCTGAAAAGG - Intergenic
1007080284 6:39096046-39096068 AGGGATGTACACATCTGAGAGGG + Intergenic
1007745405 6:44040241-44040263 AGGGATGGACAGATGTCAGAGGG - Intergenic
1008242746 6:49131607-49131629 AGGGATAGACAGATCTAGGCTGG + Intergenic
1010616858 6:78023564-78023586 AGGGATATGCAGAGTTGAAATGG - Intergenic
1011700280 6:89949248-89949270 TGGGATACACAGCTCTGAGAAGG + Intronic
1014280581 6:119438705-119438727 AAGGATATACAAATGTGAAAGGG - Intergenic
1014388753 6:120834312-120834334 AGGGATAAACTCAGCTGAAATGG + Intergenic
1014398156 6:120952858-120952880 AGGGTTAGATACATATGAAACGG + Intergenic
1015418124 6:132973769-132973791 ATGAATGGACAGATCTAAAAAGG + Intergenic
1016912195 6:149209955-149209977 TGGAAGAGACAGAGCTGAAAGGG + Intergenic
1019316690 7:390274-390296 AGGGAGAGACAGACCAGGAAGGG + Intergenic
1020921124 7:14265654-14265676 AGGGAAAGGCAGATATGAACAGG - Intronic
1021177505 7:17467036-17467058 AGGGATAGACTGAAGTTAAATGG + Intergenic
1021670694 7:23032289-23032311 AGGGATACCCAGTTATGAAAGGG + Intergenic
1022198865 7:28096131-28096153 AGGGATAAGCAGAACTGAGAGGG + Intronic
1022673969 7:32481027-32481049 TGGGATGGACAGATATGACAGGG + Intergenic
1023431811 7:40101141-40101163 AGGAATAGAAAACTCTGAAAAGG - Intergenic
1023452295 7:40300391-40300413 AGGGCTAGACAGTTCTGAAGAGG - Intronic
1026139259 7:67691183-67691205 AGGAAGAGGCAGATTTGAAAAGG - Intergenic
1026494114 7:70888023-70888045 AGGGATAGAGAGATGGGGAAAGG + Intergenic
1028628187 7:92901461-92901483 AGTGGTAGACAGAAGTGAAAAGG - Intergenic
1030623216 7:111815219-111815241 AGGGCTAGAAAGATCTTAAAAGG + Intronic
1030899380 7:115103662-115103684 AGATATATACTGATCTGAAATGG - Intergenic
1032360318 7:131249266-131249288 AGGGATAGCCAGAGCTGAGCTGG + Intronic
1032382194 7:131496995-131497017 AAGGAAAGACTGAACTGAAATGG + Intergenic
1032388547 7:131540852-131540874 TGGGATAGTCACCTCTGAAACGG + Intronic
1032890847 7:136193073-136193095 AGGAATAGACAGTTCATAAAAGG - Intergenic
1033410333 7:141111719-141111741 AGGAATGGTCAGAACTGAAAAGG + Intronic
1033669633 7:143478691-143478713 AGGGATGGACAGATATGCACAGG - Exonic
1033730736 7:144176369-144176391 AGGGATAAACACATGTGGAAGGG + Intergenic
1036635980 8:10549698-10549720 GGGGAGAGACACAGCTGAAAAGG - Intronic
1037165535 8:15823907-15823929 ACGGATAGTATGATCTGAAATGG + Intergenic
1039593085 8:38767248-38767270 ATGGATACACAGGTGTGAAAAGG - Intronic
1040387535 8:46923703-46923725 GAGTATAGACAGATCTGAAGTGG - Intergenic
1048670405 8:136712765-136712787 AGGGATAGAGTGATGTCAAAGGG + Intergenic
1050507715 9:6364710-6364732 AGGGTTAGACGGATCTGTAAAGG + Intergenic
1050594964 9:7195803-7195825 AGCGTTAGACAGATCTGAGTGGG + Intergenic
1052121048 9:24716731-24716753 AGAGATAATCATATCTGAAATGG - Intergenic
1052885103 9:33638681-33638703 ATGGACAGACAGTTCTGAAAAGG + Intergenic
1052885104 9:33638700-33638722 AAGGACAGACAGTTCTGAAAAGG + Intergenic
1053276681 9:36788458-36788480 ATGGATAGACAGATGTGTGAAGG + Intergenic
1053791016 9:41686288-41686310 AGGCCTTGACAGAACTGAAAAGG + Intergenic
1054179362 9:61897982-61898004 AGGCCTTGACAGAACTGAAAAGG + Intergenic
1054658176 9:67682839-67682861 AGGCCTTGACAGAACTGAAAAGG - Intergenic
1054996919 9:71401950-71401972 GGGGAGAGACAGTTCTAAAAAGG + Intronic
1056443865 9:86645671-86645693 AGGGATTGACAGATCTGTGAAGG + Intergenic
1056740777 9:89253125-89253147 AGGGATGGAGAGGTCTGAAGGGG - Intergenic
1057295126 9:93830285-93830307 AGGGATGGACAAATCTGGGAGGG + Intergenic
1057939927 9:99273044-99273066 AGGTGTAGACAGCTCTGTAAAGG - Intergenic
1058349642 9:104006726-104006748 AGGGATACACAGAGAGGAAAAGG + Intergenic
1059333740 9:113555139-113555161 AGGAATAGACAGATCAAAGAGGG - Intronic
1203518625 Un_GL000213v1:26235-26257 AGGGCTAGACAGATGGGAATTGG + Intergenic
1187428462 X:19200374-19200396 AGGGACAGAAAAATATGAAATGG + Intergenic
1188267869 X:28099954-28099976 AGGGATAGACTTAACTAAAAGGG + Intergenic
1188638987 X:32474659-32474681 ATGAATAGACAGTTCTCAAAAGG - Intronic
1189076165 X:37917318-37917340 AGGAAGAGACAAATCTTAAAGGG - Intronic
1190363769 X:49672885-49672907 AGGGAAAGAGAAAACTGAAAAGG - Intergenic
1191818144 X:65271801-65271823 TGGGATAGCCAGAGTTGAAAAGG + Intergenic
1192144278 X:68670642-68670664 GTGGAAAGACAGGTCTGAAAAGG + Intronic
1193976374 X:88124591-88124613 ATGGATAAACATATCTGTAATGG - Intergenic
1194649505 X:96498481-96498503 ATGGATAGACCTATCTGAATGGG + Intergenic
1194764427 X:97832913-97832935 AGGGAGATACAGATATGGAAAGG - Intergenic
1194798878 X:98246670-98246692 AGGGAAAGAGAGATCTGAGTTGG - Intergenic
1195397851 X:104430299-104430321 AGGGCTAGTCAGAGCTGGAAGGG - Intergenic
1195677697 X:107519893-107519915 AGGAATACACAGGTCTGAACCGG + Intergenic
1195682968 X:107562533-107562555 AGGGATGGATAGATTGGAAAAGG + Intronic
1196890067 X:120283053-120283075 AGGGAAAGACAGATCGGGGAAGG + Intronic
1198512005 X:137361472-137361494 AGTGAGAGAAAGCTCTGAAAAGG - Intergenic
1199100114 X:143789789-143789811 AGAGACAGATAGATATGAAAGGG + Intergenic
1201196343 Y:11498228-11498250 AGGAATGGACAGAACTGGAAAGG + Intergenic