ID: 950259887

View in Genome Browser
Species Human (GRCh38)
Location 3:11536099-11536121
Sequence CCTGAGAAAACAGCCTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 329}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950259887_950259899 19 Left 950259887 3:11536099-11536121 CCCAGCCAGGCTGTTTTCTCAGG 0: 1
1: 0
2: 0
3: 32
4: 329
Right 950259899 3:11536141-11536163 GAATTAGAAAGGACTGCCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 119
950259887_950259903 27 Left 950259887 3:11536099-11536121 CCCAGCCAGGCTGTTTTCTCAGG 0: 1
1: 0
2: 0
3: 32
4: 329
Right 950259903 3:11536149-11536171 AAGGACTGCCCCCGGGCCAGGGG 0: 1
1: 0
2: 0
3: 17
4: 144
950259887_950259902 26 Left 950259887 3:11536099-11536121 CCCAGCCAGGCTGTTTTCTCAGG 0: 1
1: 0
2: 0
3: 32
4: 329
Right 950259902 3:11536148-11536170 AAAGGACTGCCCCCGGGCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 107
950259887_950259898 8 Left 950259887 3:11536099-11536121 CCCAGCCAGGCTGTTTTCTCAGG 0: 1
1: 0
2: 0
3: 32
4: 329
Right 950259898 3:11536130-11536152 GTGAGGGGGAGGAATTAGAAAGG 0: 1
1: 0
2: 1
3: 46
4: 447
950259887_950259901 25 Left 950259887 3:11536099-11536121 CCCAGCCAGGCTGTTTTCTCAGG 0: 1
1: 0
2: 0
3: 32
4: 329
Right 950259901 3:11536147-11536169 GAAAGGACTGCCCCCGGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 154
950259887_950259896 -6 Left 950259887 3:11536099-11536121 CCCAGCCAGGCTGTTTTCTCAGG 0: 1
1: 0
2: 0
3: 32
4: 329
Right 950259896 3:11536116-11536138 CTCAGGGCTGGTCTGTGAGGGGG 0: 1
1: 0
2: 4
3: 43
4: 398
950259887_950259897 -3 Left 950259887 3:11536099-11536121 CCCAGCCAGGCTGTTTTCTCAGG 0: 1
1: 0
2: 0
3: 32
4: 329
Right 950259897 3:11536119-11536141 AGGGCTGGTCTGTGAGGGGGAGG 0: 1
1: 0
2: 8
3: 56
4: 520
950259887_950259895 -7 Left 950259887 3:11536099-11536121 CCCAGCCAGGCTGTTTTCTCAGG 0: 1
1: 0
2: 0
3: 32
4: 329
Right 950259895 3:11536115-11536137 TCTCAGGGCTGGTCTGTGAGGGG 0: 1
1: 0
2: 4
3: 32
4: 278
950259887_950259900 20 Left 950259887 3:11536099-11536121 CCCAGCCAGGCTGTTTTCTCAGG 0: 1
1: 0
2: 0
3: 32
4: 329
Right 950259900 3:11536142-11536164 AATTAGAAAGGACTGCCCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 104
950259887_950259894 -8 Left 950259887 3:11536099-11536121 CCCAGCCAGGCTGTTTTCTCAGG 0: 1
1: 0
2: 0
3: 32
4: 329
Right 950259894 3:11536114-11536136 TTCTCAGGGCTGGTCTGTGAGGG 0: 1
1: 0
2: 3
3: 21
4: 364
950259887_950259893 -9 Left 950259887 3:11536099-11536121 CCCAGCCAGGCTGTTTTCTCAGG 0: 1
1: 0
2: 0
3: 32
4: 329
Right 950259893 3:11536113-11536135 TTTCTCAGGGCTGGTCTGTGAGG 0: 1
1: 0
2: 6
3: 102
4: 575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950259887 Original CRISPR CCTGAGAAAACAGCCTGGCT GGG (reversed) Intronic
900271482 1:1791667-1791689 CCTCAGAGGAAAGCCTGGCTGGG + Intronic
900343497 1:2199669-2199691 CCTGAGAAAGTGGCCTCGCTCGG + Intronic
900813364 1:4825161-4825183 CCTCAGCACACAGCCTGGTTTGG - Intergenic
901459672 1:9384080-9384102 CATGAAAACACAGACTGGCTTGG - Intergenic
902544904 1:17184092-17184114 CCTGGGATGCCAGCCTGGCTCGG - Intergenic
903172845 1:21564297-21564319 CCGGAGAAAGCAGCCTGGCCTGG + Intronic
905210621 1:36371577-36371599 CAAGAAAAAACAGTCTGGCTGGG + Intronic
905890279 1:41514562-41514584 CCTCAGATAAGAGCGTGGCTGGG - Intronic
906941116 1:50256361-50256383 CCTGAGAACACAGCCTTATTTGG - Intergenic
907250336 1:53133966-53133988 CCAGTGATCACAGCCTGGCTTGG - Intronic
907330814 1:53669946-53669968 TCTGACAAAACAAGCTGGCTGGG - Intronic
909256092 1:73424280-73424302 CTTGAGAAAATACCTTGGCTTGG - Intergenic
910010144 1:82451625-82451647 CCTCAGAAAACTGCATGGCTGGG - Intergenic
910427209 1:87129899-87129921 CCTCAGAAAGCAGCCCCGCTGGG - Intronic
910996792 1:93113724-93113746 CCTGAGAAAACATCAAGACTAGG - Intronic
911624416 1:100104759-100104781 CCTGAGAAAAAAGGGAGGCTGGG - Intronic
913094526 1:115503630-115503652 CCTGTGAAAGCAGCCAGGCAGGG + Intergenic
914802409 1:150971301-150971323 CCTGAGACCACAGCTGGGCTGGG + Intronic
916925928 1:169520922-169520944 GCTCAGAAGACAGACTGGCTAGG + Intronic
917284169 1:173407152-173407174 GCAGACCAAACAGCCTGGCTGGG + Intergenic
920012605 1:202880214-202880236 CCTGAGTAAACAGCCAGGGCTGG + Exonic
920066338 1:203272559-203272581 CCAGAGAACCCAGCCTGGCCTGG + Intronic
920079099 1:203359340-203359362 GCTTACCAAACAGCCTGGCTGGG - Intergenic
920327862 1:205180758-205180780 CTTAAAAGAACAGCCTGGCTGGG - Intronic
922752827 1:228078876-228078898 CCTGAGAAGCCAGCCTGCCTGGG + Intergenic
924378021 1:243433547-243433569 CCTGAGGAACCAGCCTCCCTTGG + Intronic
924590035 1:245394986-245395008 ACTAAGAAAACACCTTGGCTGGG - Intronic
1064297554 10:14092155-14092177 CCTAAGAAACCTGCCTGACTCGG - Intronic
1064390772 10:14940233-14940255 CCTCAGAACACAGTCTGGATGGG + Intronic
1064401139 10:15022223-15022245 CCTCAGAACACAGTCTGGATGGG + Intergenic
1064659397 10:17591241-17591263 CCTGAGAAAACAGGATAGCCAGG - Intronic
1065817133 10:29492422-29492444 CCTCAGAACACAGTCTGTCTTGG - Intronic
1065955719 10:30692051-30692073 CCTCAGAACACAGTCTGTCTTGG + Intergenic
1065970019 10:30798785-30798807 TCTGAGTACACAGCCTGGCTGGG - Intergenic
1066441183 10:35440482-35440504 CTTATGAAAACAGCCTGGCCTGG + Intronic
1067426783 10:46216793-46216815 CACCAGAACACAGCCTGGCTAGG - Intergenic
1068086303 10:52377266-52377288 CATAAGAAAACAGCATGGCAAGG + Intergenic
1069844938 10:71364474-71364496 CCTTGGAAAACAGCATGGCACGG + Intergenic
1069874357 10:71552609-71552631 CCAGAGCAAAGAGGCTGGCTTGG + Intronic
1070146889 10:73781096-73781118 CTTGAGAAACAAGTCTGGCTGGG + Intergenic
1070752916 10:78974320-78974342 CCTGTGAAAACAGCCTGGGAGGG + Intergenic
1070783568 10:79150699-79150721 CCTGTGAAGACAGCCAGGCTTGG + Intronic
1071990520 10:91097022-91097044 CCTGTGAAAGCAGCCAGGATGGG - Intergenic
1073613134 10:104964560-104964582 CCTTAGAATAGAGCCTGGCATGG + Intronic
1074959555 10:118429075-118429097 GCTGAAATAGCAGCCTGGCTCGG + Intergenic
1076727358 10:132419845-132419867 CCTGGGAAGACAGCCAGGGTTGG - Intergenic
1077138004 11:1011124-1011146 CCTGGGAAAACAGTCCAGCTGGG - Exonic
1077354895 11:2111145-2111167 CGCGTGTAAACAGCCTGGCTCGG - Intergenic
1077474082 11:2778241-2778263 GATGAGAAACCAGCCTGGCCTGG - Intronic
1078577976 11:12517484-12517506 CCCGAGCTAGCAGCCTGGCTGGG + Intronic
1079380291 11:19932115-19932137 TCTGAGAAAAGAGTCTGGCCAGG + Intronic
1080605563 11:33862170-33862192 CCTGAGGATACAACTTGGCTTGG - Intronic
1083485484 11:62980940-62980962 ACTGAGACAAAAGGCTGGCTGGG - Intronic
1084051512 11:66603190-66603212 GCTGAGGAAACAGCCTGGAAAGG + Intronic
1086742033 11:90380088-90380110 CCAGATAAAACCCCCTGGCTTGG - Intergenic
1087468186 11:98537218-98537240 CTTAAGAAATCAGCCTGGCCGGG + Intergenic
1088037416 11:105334359-105334381 CCTAAGGAAACAGTCTGGCCAGG - Intergenic
1089789806 11:120934471-120934493 CCTGGGACATGAGCCTGGCTGGG - Intronic
1090246009 11:125216467-125216489 CCTGAGAAACCCGCCTGGGGAGG + Intronic
1091421323 12:343197-343219 GCTGAGGCAGCAGCCTGGCTGGG + Intronic
1091743785 12:2977942-2977964 ACTGAGTACACAGCCTGGCCCGG + Intronic
1092835324 12:12482611-12482633 CATTCGAAAACAGCCTGCCTTGG + Intronic
1093967214 12:25340426-25340448 CCTGTGAAAGCAGCCTGGAAAGG - Intergenic
1093971620 12:25381404-25381426 CCTTAAAAAACAACCAGGCTGGG + Intergenic
1094536688 12:31327566-31327588 CCTGAAAAGATAGCCTGGCGTGG + Intergenic
1094669209 12:32552709-32552731 CCTAAGAAAACAGCATGCCAAGG + Intronic
1095640838 12:44483330-44483352 CCTGTGAAAACAGCCAGGAGGGG - Intergenic
1096916047 12:55034648-55034670 GGTGAGAAAACAGCTTGCCTTGG - Intergenic
1097725844 12:63075152-63075174 CCTGAGGAAGCTGCCTGGCATGG + Intergenic
1097889576 12:64763928-64763950 CTTTAAAAAACAGCTTGGCTAGG - Intergenic
1098944349 12:76573551-76573573 CCTGTGAAAGCAGCCAGGATGGG - Intergenic
1100643094 12:96501545-96501567 GCTGAGACCACAGCATGGCTGGG + Intronic
1101663512 12:106788282-106788304 CCTGTGAAAACAGCCAGGTGTGG - Intronic
1102743705 12:115231153-115231175 CCTGAGAAAGGAGTCAGGCTTGG + Intergenic
1104597845 12:130132106-130132128 AGTGAGAAAACAGGCAGGCTTGG - Intergenic
1105003117 12:132703886-132703908 ACTGAGAAGACAGACTGGCCGGG + Intronic
1105950723 13:25227472-25227494 CCAGTGAAAACATCCTCGCTCGG - Intergenic
1106722880 13:32454088-32454110 TCTGAGCATACAGCCTGACTTGG - Intronic
1106734849 13:32578313-32578335 CCTGTGAAAGCAGCCTGGAGGGG + Intergenic
1108147857 13:47498595-47498617 CCTGAAAAAAGAGACTGTCTGGG + Intergenic
1108902914 13:55435284-55435306 CCTCAGAAATCACCCTGGTTGGG - Intergenic
1109905242 13:68831286-68831308 CCTGTGAAAACAGCCAGGAGTGG + Intergenic
1109963886 13:69667146-69667168 CCCAAGAAGGCAGCCTGGCTGGG + Intergenic
1111154983 13:84310062-84310084 CCTGTGAAAACAGCCAGGAGGGG + Intergenic
1111189606 13:84790523-84790545 CCTGTGAAAACAGCCAGGGATGG + Intergenic
1112998361 13:105601300-105601322 CCTGAGCAATCTGCCTGTCTTGG - Intergenic
1113481937 13:110627741-110627763 CATGAGAAAACAGTCGGGCCCGG - Intronic
1114672674 14:24420073-24420095 CCTCAGGAAACAGCCTGCATAGG - Intergenic
1115932091 14:38508530-38508552 CCTGTGAAAGCAGCCAGGATGGG - Intergenic
1116241105 14:42344165-42344187 CCTGAGAATACAGACTGACAAGG - Intergenic
1116400515 14:44500776-44500798 TCTGAGTAATCGGCCTGGCTCGG + Intergenic
1117426261 14:55600951-55600973 CCTGAGAAAATGGGCTGGTTTGG + Intronic
1118003916 14:61548273-61548295 CCTGAGAAAGCAGAGTGGGTAGG + Intronic
1118363241 14:65073232-65073254 CCTCTGAAAGCAGACTGGCTGGG - Intronic
1118485073 14:66206936-66206958 CCTGTGAAAGCAGCCAGGCAGGG + Intergenic
1120527233 14:85591285-85591307 CCTGAGAAAACGGCCTGGGAAGG - Intronic
1121731961 14:96193554-96193576 TCTGGGAAAAGAGCCTAGCTCGG + Intergenic
1121904199 14:97724570-97724592 CATGAGGAAACAGCATTGCTTGG + Intergenic
1122069455 14:99196207-99196229 CCTGAGAAGAGGGCTTGGCTGGG - Intronic
1122848481 14:104513665-104513687 CCTGAGGGAACAGCTTAGCTAGG - Intronic
1122971964 14:105156018-105156040 CCAGAGAAACCAGCCCGGCCAGG + Intronic
1123002788 14:105305103-105305125 CCTCAGAAAAGTGGCTGGCTGGG + Exonic
1123050248 14:105537960-105537982 CCTGAGAACCCTACCTGGCTGGG + Intergenic
1123696805 15:22884559-22884581 CCTGTGAAAACAGCCAGGAGGGG - Intronic
1124058080 15:26260871-26260893 AGTGAGAAAACAGCCAGGGTGGG + Intergenic
1124783721 15:32659608-32659630 GCTGAGGAAACAGCCAGGCCAGG + Intronic
1124950303 15:34312546-34312568 GCTGAGAAAACAGAATGGGTAGG + Intronic
1125342564 15:38689247-38689269 CTTGATAAATCAGCCTGTCTGGG + Intergenic
1125637973 15:41205242-41205264 CTTGAGAAAACAGCCTGCATTGG + Intronic
1125652647 15:41330213-41330235 CCTGGGATTACAGCCTAGCTGGG + Intronic
1127397576 15:58554971-58554993 CCTCAGAAAGCATGCTGGCTTGG + Intronic
1127824710 15:62692634-62692656 ACTGAGAAGACAGACTGGCTGGG - Intronic
1128301398 15:66568265-66568287 CCTGAGGACACAGCCTTGCCTGG - Intergenic
1128569802 15:68725978-68726000 GCTTAGAAAACAGCCCAGCTGGG - Exonic
1128591082 15:68898021-68898043 ACTGGGAGAAGAGCCTGGCTGGG + Intronic
1129774919 15:78230259-78230281 CCGGAGGAAACAGCCAGGCCAGG - Intronic
1130689308 15:86066718-86066740 ACGGATAAAACAGCCTGGGTGGG + Intergenic
1130747127 15:86666930-86666952 CCTGAGAAGATAGCCTGGCATGG - Intronic
1132773340 16:1577579-1577601 CTTAAGAACACAGCCTGGCCGGG + Intronic
1133500439 16:6361327-6361349 GCTGAGAAAAGATCATGGCTGGG + Intronic
1137719859 16:50621613-50621635 CCTGAGAAGACTGACGGGCTGGG + Exonic
1137956852 16:52840226-52840248 CAAGAGAAAACTGCCTGTCTAGG + Intergenic
1138565296 16:57828527-57828549 CCTCAGAAGACAGCCTGGGTGGG + Intronic
1141886792 16:86897807-86897829 AGAGAGAAAACAGCCTGCCTCGG + Intergenic
1141960641 16:87405332-87405354 CCTGAGAAAACTGCCTTCCCAGG + Intergenic
1142681992 17:1555430-1555452 CCTGGGAAAGCAGCCAGACTCGG + Intronic
1143059418 17:4187403-4187425 GCTGAGAAAACTGCCTGGGATGG - Intronic
1144763287 17:17719375-17719397 CCTGAGGCAGCAGCCAGGCTGGG - Intronic
1148694011 17:49548395-49548417 CCTGAGCAAGCAGGCTGGCCAGG + Intergenic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1148848883 17:50544786-50544808 CCTGAGGGGCCAGCCTGGCTGGG - Intronic
1148887438 17:50784154-50784176 CCTAAGAAAACAGACAGGCCTGG - Intergenic
1149015467 17:51904079-51904101 CCTGAGCAAACAGGGTGGGTTGG - Intronic
1150653603 17:67025378-67025400 CCTGTGACAGGAGCCTGGCTGGG + Intronic
1151951362 17:77356046-77356068 CCTCAGAAGAAAACCTGGCTGGG + Intronic
1152134225 17:78494543-78494565 CCGGAGAAGCCTGCCTGGCTGGG - Intronic
1152208212 17:78987924-78987946 GCTGATAAAACAGGCTGGCCGGG + Intergenic
1152778788 17:82217410-82217432 CTTGGGAGGACAGCCTGGCTTGG - Intergenic
1153817139 18:8800304-8800326 CTTGGGAAAACGGCTTGGCTAGG - Intronic
1155152240 18:23132665-23132687 AGAGACAAAACAGCCTGGCTGGG + Intergenic
1155498602 18:26465703-26465725 TCTGAAACAACACCCTGGCTTGG + Intronic
1155600191 18:27537191-27537213 CCTGGGGAAACAGCCTGCCCGGG - Intergenic
1158075734 18:53526637-53526659 CATGTGAAAACAGCCTCCCTTGG + Exonic
1158163056 18:54507735-54507757 ACTGAGATAACAGAGTGGCTTGG + Intergenic
1159868630 18:73735520-73735542 CCTGAAAAAAGAGCATGCCTGGG + Intergenic
1160043024 18:75362559-75362581 CCTGTGAGAACACCGTGGCTTGG + Intergenic
1160812700 19:1019859-1019881 CCTCAGAAAACAAGCTGGCCGGG - Intronic
1162878014 19:13635390-13635412 CCTGAAAAAACCGTCCGGCTAGG + Intergenic
1163411883 19:17160054-17160076 ACAGAGAAAACATCCAGGCTGGG - Intronic
1163636891 19:18441177-18441199 CCTGGGAGAACAGCGTGGCCAGG + Intergenic
1164843631 19:31413313-31413335 CCTGAGACCACAGCTTGACTAGG - Intergenic
1166110932 19:40622557-40622579 CATGTGACAACATCCTGGCTCGG + Exonic
1167411318 19:49345647-49345669 TCTGAGAAGAAAGCCTGGCTAGG - Intronic
1168152358 19:54455945-54455967 CCTGAGAATACAGCAGGGCAGGG - Exonic
1202647050 1_KI270706v1_random:152598-152620 CCTGTGCAGACCGCCTGGCTTGG + Intergenic
925408324 2:3623972-3623994 CTTTACAAAACAGCCTGGCTAGG + Intronic
926612233 2:14958103-14958125 CCTGACTTCACAGCCTGGCTGGG - Intergenic
926803562 2:16683932-16683954 GTTGAGGAAGCAGCCTGGCTGGG - Intergenic
926838509 2:17051675-17051697 CCTGAGAGAAAAGACTGGCAAGG + Intergenic
927283619 2:21334065-21334087 GCTGAGAAAACAGTCTGGATTGG + Intergenic
928821486 2:35366749-35366771 CCTGTGAAAACAGCCAGGAGGGG + Intergenic
929668002 2:43848718-43848740 ACAAAGAAAACAGCCAGGCTGGG + Intronic
931859983 2:66345030-66345052 CCAGAGAAAACGTCATGGCTTGG - Intergenic
932715923 2:74100809-74100831 TCTGTGGGAACAGCCTGGCTGGG - Exonic
934113062 2:88760005-88760027 CCTGCGAAAGCAGCCAGGATGGG + Intergenic
934775510 2:96934658-96934680 CCTGAGAAAACCGTGTGTCTAGG + Intronic
936038858 2:109133889-109133911 CCAGAGACTACAGCCTGGCAAGG - Intronic
937613876 2:123896642-123896664 CATGTGAAATCATCCTGGCTTGG - Intergenic
937937934 2:127260966-127260988 CCTGAGAAAGCAGCCCTGCGGGG + Intronic
939630688 2:144523771-144523793 CGTGAGAAAACCGTTTGGCTTGG - Intronic
940897004 2:159090478-159090500 CCAGTTAAAACAGCCTCGCTCGG + Intronic
941307721 2:163892023-163892045 CCTGTGAAAGCAGCCAGGATGGG - Intergenic
942220930 2:173768289-173768311 TCTGAGAAATCAGCCGGGCGCGG - Intergenic
942617525 2:177809469-177809491 CTTCAGATAACTGCCTGGCTGGG - Intronic
943596141 2:189859384-189859406 ACTCTGAAGACAGCCTGGCTTGG - Intronic
943702025 2:190996969-190996991 CTTAAGAAAAAAGCCTGCCTTGG + Intronic
946394704 2:219437347-219437369 GCTGAGCAAACAGCCCTGCTGGG - Intronic
946834654 2:223761060-223761082 CTTGAGTAACCAGCCTGGCTCGG - Intronic
947383275 2:229565202-229565224 CCTGAGAAAACAGCAATGCCAGG + Intronic
948264412 2:236626636-236626658 CCTCAGGGAACAGCCTGGCCAGG + Intergenic
948881115 2:240857632-240857654 CCTGAGGAAACACCCTCCCTTGG + Intergenic
948942315 2:241202724-241202746 CCTGAGAAAACAGCCACTGTGGG + Intronic
1169269183 20:4186440-4186462 CTTGAGAAAGCAGGCTGTCTAGG - Intronic
1170085851 20:12530911-12530933 CCTGAAACAACACCCTTGCTTGG - Intergenic
1170530664 20:17287939-17287961 CCTGAAAGAGCAGCCTGACTGGG + Intronic
1171237244 20:23536868-23536890 CATCTGAAAACAGCCTGGCCTGG - Intergenic
1172734150 20:37113287-37113309 CCTGAGATAAAATACTGGCTTGG - Intronic
1173068463 20:39737285-39737307 CCTGAAAAAACAGCCTTGCATGG - Intergenic
1173482939 20:43417176-43417198 CCTGAAGAAGCAGCCTGGCAAGG + Intergenic
1173573356 20:44092922-44092944 CCTGAGAAATCTGCCTACCTTGG + Intergenic
1174932340 20:54829548-54829570 CCTCTGCAAACAGCCTGCCTGGG + Intergenic
1175156241 20:56973450-56973472 CCTGAGAACTCAGCATGACTTGG + Intergenic
1175727950 20:61332312-61332334 TCTAGGGAAACAGCCTGGCTTGG - Intronic
1175770560 20:61620969-61620991 CGAGAGCAAACAGCCTGACTTGG - Intronic
1176604815 21:8820176-8820198 CCTGGGCAGACCGCCTGGCTTGG - Intergenic
1177606077 21:23379231-23379253 CCTGTGAAATCAGCCTGGAGTGG + Intergenic
1177811904 21:25933977-25933999 CCTAAGAATACAGCCTTACTTGG + Intronic
1178393123 21:32215428-32215450 TCTGGGAAATCAGCCTTGCTGGG - Intergenic
1178857519 21:36262595-36262617 CCTGAGAGATCAGCCGGGCACGG + Intronic
1179087964 21:38237271-38237293 CCAGAGAAGAGAGACTGGCTTGG + Intronic
1180347105 22:11711781-11711803 CCTGGGCAGACCGCCTGGCTTGG - Intergenic
1180354855 22:11829871-11829893 CCTGGGCAGACCGCCTGGCTTGG - Intergenic
1180383396 22:12162460-12162482 CCTGGGCAGACCGCCTGGCTTGG + Intergenic
1180897262 22:19345765-19345787 CCTAAGAACAGGGCCTGGCTGGG + Intronic
1180950040 22:19716838-19716860 CCTGAGATGCCAGCCTGTCTGGG + Intronic
1181904584 22:26184251-26184273 CCAGTGAAGACAGCCTGACTTGG - Intronic
1182887716 22:33789568-33789590 CCTGTGAAAGCAGCCAGGATGGG + Intronic
1183648094 22:39138417-39138439 CCGGGGAAGACAGCCTGGGTGGG - Intronic
1184331192 22:43828997-43829019 GCAGAGAAAGCAGCCTGGCTGGG + Intronic
1184999876 22:48238839-48238861 CCTCAGAATGCAGCCTTGCTGGG - Intergenic
1185216047 22:49600574-49600596 CCCAACACAACAGCCTGGCTGGG - Intronic
950259887 3:11536099-11536121 CCTGAGAAAACAGCCTGGCTGGG - Intronic
950913721 3:16621432-16621454 CCTGGGAGAGCAGCCTGGCTTGG + Intronic
953364263 3:42328810-42328832 CCTGTGAATACAGCCTTACTTGG - Intergenic
953891777 3:46756405-46756427 CCTGAGAAAACTGCCTTCCAAGG + Exonic
955240173 3:57170780-57170802 CAGGAGATAACATCCTGGCTTGG + Intergenic
957017384 3:75083874-75083896 CCTGAGAAAACAGCTGGGAGAGG - Intergenic
957160243 3:76601180-76601202 CCTGTGAAAGCAGCCAGGATTGG - Intronic
957246379 3:77721833-77721855 CTTAAGACAATAGCCTGGCTTGG + Intergenic
957409148 3:79815090-79815112 CCTAAGAAAACAGATTGGCCGGG - Intergenic
958528433 3:95292225-95292247 CCTGTGAAAACAGCCAGGAGGGG + Intergenic
958819314 3:98954296-98954318 CCAGAGAAAACAGACTGGTTAGG - Intergenic
958836285 3:99148581-99148603 CCTGTGAAAGCAGCCTGGAGGGG + Intergenic
959227529 3:103604024-103604046 CCTGAGCAAACTGCCTGGGGGGG + Intergenic
959894054 3:111587255-111587277 CCTGTGAAAACAGCCAGGAGGGG - Intronic
960178496 3:114546232-114546254 CTTCAGAAAGCAGCCTGGGTGGG + Intronic
961503765 3:127356555-127356577 CTTGTGAAAGCAGCCAGGCTGGG - Intergenic
964678038 3:159305238-159305260 CCTGAGGACACAGCTTGGATGGG - Intronic
965589969 3:170353568-170353590 CCTGAAAAAACAGCTAGGCATGG + Intergenic
965663737 3:171069425-171069447 GCTGAGAAAACAGCCGGCCTTGG - Intronic
967246127 3:187488462-187488484 CCTGAGAAACCATCTGGGCTTGG - Intergenic
968735825 4:2296108-2296130 CCCGAGAGCACAGCCAGGCTGGG + Intronic
969202613 4:5617885-5617907 CCTGAGACCACAGCCTTGCTTGG - Intronic
970405677 4:15760921-15760943 CCTGAGTAATCTGCCTGCCTTGG + Intergenic
970597370 4:17612783-17612805 CCTGAAGAAGCAGCCTGCCTGGG - Intergenic
971190805 4:24427531-24427553 CCTGAAAAAACAAACTGGATAGG - Intergenic
971417453 4:26445524-26445546 CCTAAGAAAACAGCCAGGCATGG + Intergenic
971743162 4:30545833-30545855 GCTGAGAAGCCAGCATGGCTTGG - Intergenic
971900264 4:32649831-32649853 CCTTGGAAAACAGCCTGGAGTGG - Intergenic
973373305 4:49270761-49270783 CCTGGGCAGACCGCCTGGCTTGG + Intergenic
973598987 4:52522271-52522293 TGTGAGATGACAGCCTGGCTGGG + Intergenic
974071485 4:57127994-57128016 CCTGCGAAAACAGCCAGGAGCGG + Intergenic
974438299 4:61884979-61885001 CATAAGGAAACAGCCTGGCCGGG + Intronic
974725553 4:65794436-65794458 CCTGTGAAAGCAGCCTGGAGGGG - Intergenic
975643382 4:76523337-76523359 CCTGGGAATACAGCCTTACTTGG - Intronic
975794786 4:77995744-77995766 CCTGGGAAACCCGCATGGCTTGG - Intergenic
976097912 4:81528497-81528519 CCTGAGACTGAAGCCTGGCTGGG + Intronic
976312213 4:83623407-83623429 CCTGTGAAAGCAGCCAGGATGGG + Intergenic
978494022 4:109340000-109340022 CGTGAGGCAGCAGCCTGGCTGGG + Intergenic
979029762 4:115628251-115628273 CCAGGGAAAAGAGCATGGCTGGG - Intergenic
981011681 4:139931717-139931739 CTTTAGAAATAAGCCTGGCTCGG + Intronic
981028723 4:140102418-140102440 CAGGAGAAACCAGCCTTGCTTGG - Intronic
981553766 4:145968792-145968814 ACTGAGAAAAGAGCCTTGCAAGG - Intergenic
981611400 4:146597402-146597424 CCTGTGAAAGCAGCCAGGATGGG - Intergenic
983096772 4:163571805-163571827 CCTAAGAAAAGAGGCTGGATGGG - Intronic
983874810 4:172863353-172863375 CCTGAGAAAGCAGCCAGGAAGGG + Intronic
984331736 4:178329582-178329604 CCTCGGAAAGCAGCCTGCCTTGG + Intergenic
985775851 5:1841333-1841355 CCTGCGAAGACAGCCTGGACTGG + Intergenic
988051574 5:26037751-26037773 CCAGAGCACACAGCCTGGATAGG - Intergenic
988727857 5:33941898-33941920 CCAGAGAAGACAGCCTAGCTGGG + Intergenic
988730550 5:33968497-33968519 TTTGACAACACAGCCTGGCTTGG - Intronic
989046321 5:37277419-37277441 TCTGAGAAATCTGCCTGGCTGGG + Intergenic
990507688 5:56460723-56460745 CCTGACAAAAGAACCAGGCTCGG - Intronic
991583017 5:68175932-68175954 TCTGAGCAAAGTGCCTGGCTTGG - Intergenic
993293861 5:86109405-86109427 CCTGAGAAAGCAGCCAGGATGGG + Intergenic
993358268 5:86941557-86941579 TGTGAGACAGCAGCCTGGCTGGG - Intergenic
993517566 5:88857032-88857054 CCTGAGAAAGCAGCCAGGATTGG + Intronic
997086524 5:130806436-130806458 CCTGTGAAAACAGCCAGGAGTGG + Intergenic
997673424 5:135694958-135694980 ACTGAGAAAACATACAGGCTGGG + Intergenic
998966409 5:147545612-147545634 GCTGAGAAAGCTGCCTGGGTGGG + Intergenic
999068458 5:148716832-148716854 CCTGTGAAAACAGCCGCCCTGGG + Intergenic
999753732 5:154648982-154649004 ACTGAAAAAGCAGCCAGGCTGGG + Intergenic
1000549096 5:162636613-162636635 CTTGAGAAAACAGCCAGGTATGG + Intergenic
1000741516 5:164975088-164975110 CCTGTGAAAGCAGCCAGGATGGG + Intergenic
1001514746 5:172347459-172347481 CCTGTGAGAACAGCCTGGGCAGG + Intronic
1001701173 5:173707522-173707544 CCTGTGAACACAGCCTTACTTGG + Intergenic
1001949202 5:175804340-175804362 CCAGAGAACACTGCCTGCCTTGG + Intronic
1002582267 5:180216000-180216022 CCAGAGCCAACAGCCTGGCTGGG + Intergenic
1004134178 6:12950676-12950698 GCTAAGAAACCAACCTGGCTAGG + Intronic
1004176434 6:13344130-13344152 GCTGAGAAAAGAGGCTGACTTGG - Intergenic
1004544054 6:16579780-16579802 CCTGAGAACATTGCCTGGCCTGG - Intronic
1005387778 6:25302630-25302652 GCTGAGTAAAGAGACTGGCTGGG - Intronic
1006305638 6:33216627-33216649 CCAGAGAAAAGTTCCTGGCTTGG - Intergenic
1006653296 6:35569025-35569047 CAGGAGAAACCATCCTGGCTGGG + Intergenic
1007450571 6:41938432-41938454 CCAGAGAAAATAGCCTGGCCTGG + Intronic
1007663585 6:43501327-43501349 CCTGGGAACACAGCCTGGGTTGG - Intronic
1008248411 6:49207419-49207441 CCTGTGAAAGCAGCCTGGAGGGG - Intergenic
1008750283 6:54724941-54724963 CCTGAGAGACCTGCCGGGCTTGG + Intergenic
1009522639 6:64703586-64703608 CCTGGGAAATTAGCCTGGCATGG - Intronic
1010650978 6:78455331-78455353 CCTGTGAAAGCAGCCAGGGTTGG - Intergenic
1011385746 6:86796226-86796248 CCTGTGAAAGCAGCCTGGAGGGG - Intergenic
1012097127 6:94977058-94977080 CCTGTGAAACCAGCCAGGATGGG - Intergenic
1013111956 6:107071161-107071183 CCTGAGAAAAGACTCAGGCTGGG + Intronic
1013112645 6:107076691-107076713 ACTCAGAAAGCAGCATGGCTTGG + Intronic
1014976781 6:127895876-127895898 CTTGATAATAAAGCCTGGCTAGG + Intronic
1015758791 6:136635031-136635053 CCTGCCACCACAGCCTGGCTAGG + Intronic
1016924473 6:149329212-149329234 CCTTAGAAAAGAGCCAGACTTGG + Intronic
1017284971 6:152663906-152663928 CCTGAGTAAAGAGCCCTGCTTGG - Intergenic
1017306124 6:152920783-152920805 CCTGAGCAAACATCGTGCCTTGG + Intergenic
1018380636 6:163255284-163255306 CCTGAGAGACCAACCTGGCCAGG + Intronic
1018844767 6:167547881-167547903 CCTGAGGAAACAGCATTGCCAGG + Intergenic
1021067038 7:16188502-16188524 ACTTAGAAATCAGACTGGCTTGG + Intronic
1021598541 7:22341830-22341852 CCTGTGAAAGCAGCCTGGAGGGG - Intronic
1021858861 7:24885387-24885409 CCAGAGAGCCCAGCCTGGCTGGG - Intronic
1026447970 7:70501987-70502009 ACAGGGAAAGCAGCCTGGCTGGG - Intronic
1027139982 7:75650069-75650091 CCTAAGAAAAACACCTGGCTTGG + Intronic
1029006515 7:97215753-97215775 TGTGAGACAGCAGCCTGGCTGGG - Intergenic
1029315003 7:99703872-99703894 CATGTGGAAACAGCCTGCCTGGG - Intronic
1030806876 7:113930006-113930028 CCTGTGAAAGCAGCCTGGAGGGG + Intronic
1033419439 7:141193207-141193229 CCTGAGAAGACTTCCTGGCCAGG + Intronic
1035491247 7:159280714-159280736 TCTGAGAAAACAGCCAGGAGAGG - Intergenic
1035893796 8:3374702-3374724 CCTCAGCAGACAGCCTGTCTCGG - Intronic
1036072356 8:5455327-5455349 CCTGTGATAACCACCTGGCTCGG + Intergenic
1036652953 8:10657204-10657226 ACTGAGACCACAGGCTGGCTGGG + Intronic
1037420942 8:18702050-18702072 CCTGGGAAAACATTCTGCCTTGG - Intronic
1037562388 8:20086781-20086803 CCTCAAAAAACAGACTGGCCCGG + Intergenic
1037699278 8:21258922-21258944 CCTGTGAAACCATCCAGGCTTGG - Intergenic
1039309278 8:36298004-36298026 CCTGTGAAAACAGCCGGAGTGGG + Intergenic
1039460977 8:37744149-37744171 CCTGAGAAATCACACTGCCTAGG - Intronic
1040532146 8:48274645-48274667 CCTGGGAAAGCTCCCTGGCTTGG + Intergenic
1040837512 8:51747878-51747900 TCTCAGAGAACAGCCTGCCTTGG + Intronic
1040979231 8:53228455-53228477 CCTCAGGAAATTGCCTGGCTGGG + Exonic
1041849911 8:62378976-62378998 CCTGTGAAAGCAGCCTGGATGGG + Intronic
1042542288 8:69919358-69919380 TCTTAGAAAACTACCTGGCTGGG + Intergenic
1042807816 8:72790997-72791019 CATGAATAAACAGACTGGCTTGG + Intronic
1042828894 8:73005873-73005895 CTTGATAAATCAGCCTGTCTAGG + Intergenic
1044575154 8:93760430-93760452 ACTGAGAAAACACCCAGGTTGGG + Intronic
1045479469 8:102580678-102580700 TGTGAGAAAACAGCCAGGCACGG - Intergenic
1045582419 8:103496469-103496491 TCTTAAAAAACAGGCTGGCTGGG - Intergenic
1046135133 8:110016117-110016139 TCAGATAAAACAGACTGGCTGGG - Intergenic
1046154288 8:110266968-110266990 CCTGCTAAAACAGCCTCACTTGG + Intergenic
1046880154 8:119298929-119298951 CCTGTGAAAGCAGCCAGGATAGG - Intergenic
1048761489 8:137800503-137800525 ACTGAGAAAACAAAGTGGCTGGG + Intergenic
1048972772 8:139654542-139654564 CCTGAGGGAAGAGCCTGGCAGGG - Intronic
1049282385 8:141756724-141756746 CCTGAAAAACCACCCGGGCTGGG + Intergenic
1049784116 8:144442484-144442506 CCTGAGACCACAGCATGGCAGGG - Intronic
1049784138 8:144442570-144442592 CCTGAGAGAGCAGTCTGGCTGGG - Intronic
1049879918 8:145054771-145054793 CCTAAGAACAGAGCCTGGCCTGG - Exonic
1054810717 9:69431624-69431646 ACTGAGAAATAAGCCTTGCTTGG - Intronic
1055289640 9:74769466-74769488 AATAAGAAAACAGCCTGGCATGG + Intronic
1055829498 9:80360929-80360951 CCTGAGTTTAAAGCCTGGCTGGG - Intergenic
1056064138 9:82915965-82915987 CCTGTGAAAGCAGCCGGGATGGG - Intergenic
1056706435 9:88955991-88956013 CCTGAGAAAGCAGCCAGCCCTGG + Intergenic
1057719644 9:97521532-97521554 CCTCAGAAAACAGCCTAATTTGG - Intronic
1058124460 9:101175756-101175778 CATGAGAACACAGCAAGGCTGGG + Intronic
1058202994 9:102066905-102066927 TGTGAGACAGCAGCCTGGCTGGG - Intergenic
1058926120 9:109665911-109665933 TGTGAGACAGCAGCCTGGCTGGG - Intronic
1059228051 9:112691553-112691575 CCAGTGAAAACAGGCAGGCTAGG + Intronic
1059532536 9:115049246-115049268 CCTGAGAAATCAGAATGCCTGGG - Intronic
1062077692 9:134600828-134600850 GCTGAGAATACGGCCTGGCCTGG - Intergenic
1203697019 Un_GL000214v1:108764-108786 CCTGGGAAGACCGCCTGGCTTGG + Intergenic
1203552195 Un_KI270743v1:172265-172287 CCTGGGCAGACCGCCTGGCTTGG - Intergenic
1185845191 X:3431162-3431184 CCAAAGAAAACAGCCTTGGTAGG + Intergenic
1186679264 X:11854765-11854787 CCTGTGAAAACAGCCAGGAAGGG - Intergenic
1188987270 X:36779062-36779084 ATGGAGAAAACAGCCAGGCTAGG - Intergenic
1189896208 X:45659042-45659064 CCTGTGAAAGCAGCCTGGAGGGG + Intergenic
1190082181 X:47365243-47365265 GCTTAGAAAACAGCCAGGCGCGG - Intergenic
1190382418 X:49852461-49852483 GCTGAGAAAACATCATGGCATGG - Intergenic
1195243144 X:102972879-102972901 CCTGTGAAAGCAGCCAGGATGGG + Intergenic
1196099171 X:111830002-111830024 CCTGTGAAAGCAGCCAGGATGGG + Intronic
1196680360 X:118463786-118463808 CCTAAGAAGCCAGCCTGGCCAGG - Intergenic
1197742018 X:129902509-129902531 GATGAGAAAACAGCCTGGGCGGG + Intergenic