ID: 950261927

View in Genome Browser
Species Human (GRCh38)
Location 3:11548733-11548755
Sequence AGGTGTGGATGTGCATCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950261920_950261927 15 Left 950261920 3:11548695-11548717 CCGATTGAACTCACTGTGTTTCA 0: 1
1: 0
2: 1
3: 18
4: 190
Right 950261927 3:11548733-11548755 AGGTGTGGATGTGCATCAAATGG 0: 1
1: 1
2: 1
3: 6
4: 220
950261917_950261927 26 Left 950261917 3:11548684-11548706 CCCCGTATCAGCCGATTGAACTC 0: 1
1: 0
2: 0
3: 1
4: 17
Right 950261927 3:11548733-11548755 AGGTGTGGATGTGCATCAAATGG 0: 1
1: 1
2: 1
3: 6
4: 220
950261919_950261927 24 Left 950261919 3:11548686-11548708 CCGTATCAGCCGATTGAACTCAC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 950261927 3:11548733-11548755 AGGTGTGGATGTGCATCAAATGG 0: 1
1: 1
2: 1
3: 6
4: 220
950261916_950261927 27 Left 950261916 3:11548683-11548705 CCCCCGTATCAGCCGATTGAACT 0: 1
1: 0
2: 0
3: 2
4: 24
Right 950261927 3:11548733-11548755 AGGTGTGGATGTGCATCAAATGG 0: 1
1: 1
2: 1
3: 6
4: 220
950261918_950261927 25 Left 950261918 3:11548685-11548707 CCCGTATCAGCCGATTGAACTCA 0: 1
1: 0
2: 1
3: 0
4: 35
Right 950261927 3:11548733-11548755 AGGTGTGGATGTGCATCAAATGG 0: 1
1: 1
2: 1
3: 6
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950261927 Original CRISPR AGGTGTGGATGTGCATCAAA TGG Intronic
900787624 1:4658662-4658684 AGGTGGGGGTGAGCATGAAAGGG - Intronic
901167822 1:7232267-7232289 AGGTGTGGCTGTGCTGCACACGG + Intronic
901468715 1:9440826-9440848 TGGTGTGGATGGGCATCAGCAGG - Intergenic
905945969 1:41901707-41901729 AGGTGTGGCTGGGCATGCAAGGG + Intronic
907579663 1:55560189-55560211 AGGTGTGCATGTGTGTGAAAGGG + Intergenic
907670347 1:56469129-56469151 TGGTGTGGATGTGGAAAAAAGGG + Intergenic
907672507 1:56489038-56489060 TGGTGTGGATGTGAAACAACTGG - Intergenic
909104349 1:71390659-71390681 TGGTGAGGATGTGCAGAAAAGGG + Intergenic
909120828 1:71601326-71601348 TGGTGTGGATGTGGAGAAAAGGG + Intronic
909206134 1:72760017-72760039 GGGTGTGGATGTGGAGTAAAAGG - Intergenic
910325964 1:86007329-86007351 TGGTGAGGATGTGGAGCAAAAGG + Intronic
912766989 1:112422612-112422634 TGGTGAGGATGTGCAGCAACTGG - Intronic
912970783 1:114280912-114280934 TGGTGAGGATGTGGAGCAAAAGG + Intergenic
914449078 1:147774689-147774711 AGGTGATGATGTGGAGCAAAGGG - Intergenic
915169754 1:153969387-153969409 ATGTGGGCATGAGCATCAAAGGG - Exonic
918365195 1:183800406-183800428 AGGTATGGAAGAGCAACAAACGG - Intronic
918795083 1:188883635-188883657 AGGTGTGGTGGTGCTACAAAGGG + Intergenic
920248113 1:204603531-204603553 AGGTGTGGAAGTGCAGGAACAGG - Intergenic
922272218 1:224044018-224044040 AGGAGTGGAGCTTCATCAAATGG - Intergenic
924917238 1:248583810-248583832 TGGTGTGGATGTGCTGAAAAGGG - Intergenic
1063301212 10:4850411-4850433 AGGTGTGGATGGGCATCAAATGG + Intergenic
1067513603 10:46916353-46916375 TGGTGAGGATGTGGAGCAAATGG - Intronic
1067648649 10:48135481-48135503 TGGTGAGGATGTGGAGCAAATGG + Intergenic
1067908859 10:50323511-50323533 AGCTGTGGATATGGATGAAAAGG - Intronic
1072176753 10:92931796-92931818 TGGTGAGGATGTGAATCAAGTGG + Intronic
1072315729 10:94201229-94201251 TGGTGTGGATGTGGAGCAACTGG - Intronic
1074793447 10:116916209-116916231 AGGTGGAGATGTGTATCAATTGG + Intronic
1075886723 10:125906034-125906056 AGGACTTGAAGTGCATCAAAGGG - Intronic
1075888113 10:125919683-125919705 AGGATTTGAAGTGCATCAAAGGG + Intronic
1077198250 11:1292165-1292187 ATGTGTGGGTGTGCAGCAGAAGG - Intronic
1077371720 11:2185489-2185511 AGGTTTTGATGTTTATCAAAGGG + Intergenic
1077945629 11:6894674-6894696 AGGTGTGGATGTTGATTCAATGG + Intergenic
1078467440 11:11560643-11560665 AGGTGTGGTTGTGCAGGATAAGG + Intronic
1078997063 11:16712694-16712716 TGGTGTGGGTCTGCTTCAAAAGG - Intronic
1085823323 11:79816751-79816773 AGGTCTGGCTATGCATCAACTGG - Intergenic
1087073703 11:94108021-94108043 ATATGTGGATGTGCAACATATGG - Intronic
1087165236 11:94996866-94996888 AGGTGTGGATGTGGAACAGTGGG - Intronic
1088111105 11:106262733-106262755 AGGTGTGTCTCTGCTTCAAAGGG - Intergenic
1088741372 11:112770103-112770125 AGGTGGGGATGTGCTTCATGAGG + Intergenic
1088808123 11:113370145-113370167 AGGGGTGCATGGGCATCAACAGG + Intronic
1089939827 11:122404286-122404308 TGGTGAGGATGTGAAGCAAATGG - Intergenic
1091191571 11:133699893-133699915 TGGTGTGGAGGTGCCTCCAAGGG - Intergenic
1091690120 12:2590197-2590219 AAGTGAGGATGAGCATCAGATGG + Intronic
1091911590 12:4235073-4235095 AGGTGAGGATGTGGAGAAAAGGG - Intergenic
1093612561 12:21180206-21180228 AGGTATGGATATTCATCAAAAGG - Intronic
1094681585 12:32671997-32672019 GGGTGTGGGTGTGGAGCAAAGGG + Intergenic
1095433673 12:42164081-42164103 AGGAGTTGATGTGCACAAAATGG + Intronic
1095807432 12:46335390-46335412 TGGTGAGGATGTGGATAAAAGGG - Intergenic
1100759797 12:97794804-97794826 AGGTGAGGGAGTGCATCCAAGGG - Intergenic
1101481076 12:105097890-105097912 TGGTGTGGATGTGGAGAAAAGGG - Intergenic
1102781825 12:115572136-115572158 ATGTATGGCTGTGCAACAAAAGG + Intergenic
1105613624 13:21991884-21991906 TGGTGAGGATGTGGAACAAAGGG - Intergenic
1106754052 13:32803596-32803618 TGGTGAGGATGTGCAGCAAAGGG + Intergenic
1107790102 13:43993481-43993503 TGGTGAGGATGTGCAGGAAAAGG + Intergenic
1110974612 13:81814449-81814471 CGGTGAGGATGTGCAGAAAAGGG + Intergenic
1114136733 14:19860930-19860952 TGGTGAGGATGTGGATAAAAGGG + Intergenic
1114453929 14:22843600-22843622 AGGTGTGGATGGGCTTCTAGGGG - Intronic
1116100680 14:40430809-40430831 TGGTGTGGATATGGATCAACAGG + Intergenic
1116491636 14:45510562-45510584 AGGAGTGGATGTTAATTAAATGG - Intergenic
1116731790 14:48632082-48632104 AGGTGAGGATGTGGAGCAACTGG - Intergenic
1120118246 14:80645576-80645598 TGGTGAGGATGTGGAGCAAAAGG + Intronic
1121670332 14:95705129-95705151 ATGTGTGCATGTGTATAAAAAGG - Intergenic
1202871379 14_GL000225v1_random:167931-167953 AGGATTTGAAGTGCATCAAAGGG + Intergenic
1124128286 15:26959555-26959577 AGGGGGAGATGTTCATCAAAGGG + Intergenic
1124342305 15:28897666-28897688 CGGTGAGGATGTGGAACAAATGG + Intronic
1125316211 15:38434422-38434444 AGGTGTGGATGTAGAGAAAAGGG - Intergenic
1126563099 15:50066477-50066499 AGGTGAGGATCTGCATCATGTGG + Intronic
1134448713 16:14349968-14349990 AGAGGTGGATGTGCAACAAATGG - Intergenic
1135390931 16:22092650-22092672 AGGTGAGGGTGAGCATCACAAGG + Exonic
1140821190 16:78664850-78664872 ATGTGTGCATGTGCGTAAAACGG + Intronic
1142524194 17:527095-527117 ATGTCTGGATGTTGATCAAATGG - Intronic
1143455993 17:7068147-7068169 AGCTCTGGATGTGGATAAAAGGG - Intergenic
1143720094 17:8803293-8803315 ATGTGTTGATGGGCATCAGAAGG + Exonic
1143807005 17:9437420-9437442 GGGAGGGGATGTGCATGAAATGG + Intronic
1144835797 17:18156087-18156109 AGGTGGGGCTGGGCTTCAAATGG + Intronic
1147508569 17:41045685-41045707 TGGTGTGGATGTGGAAAAAAGGG + Intergenic
1149573339 17:57693089-57693111 AGGTGTGGAAGAATATCAAATGG - Intergenic
1150059377 17:62051295-62051317 AGGTCTGGAGGTGCAACACACGG + Intronic
1150400681 17:64853924-64853946 AGTTATGGATGTGCATCAGCCGG + Intergenic
1151600327 17:75102177-75102199 GGGTGTGCATGGGGATCAAAAGG + Intronic
1154363121 18:13681848-13681870 TGGGGTGGATGAGCATCCAATGG + Exonic
1154460995 18:14585923-14585945 TGGTGAGGATGTGGATAAAAGGG + Intergenic
1155237860 18:23839674-23839696 AGGACTGCATGGGCATCAAAAGG - Intronic
1155255153 18:23989900-23989922 AGGTGAGGATGTGGAAGAAATGG + Intergenic
1158999101 18:62954920-62954942 AAGTGTAGATGTTCAACAAATGG - Intronic
1159724601 18:71940702-71940724 TGGTGTAGATGTGGAGCAAAAGG - Intergenic
1160002752 18:75042855-75042877 AGCAGTGGATGTGCAGCAATGGG - Intronic
1163551663 19:17969036-17969058 AGGTTTGGATGCCCATGAAAGGG - Intronic
1164966852 19:32492318-32492340 AGGTGTGTATTTGCAACACAAGG + Intergenic
1165248417 19:34511577-34511599 AGGTGGCCATGTGCATCCAAAGG - Exonic
1166095722 19:40537791-40537813 AGGTGGGGATGTGCACAGAAAGG + Intronic
1167109662 19:47451934-47451956 ATGTGTGGTTCTGGATCAAATGG + Intronic
1167197043 19:48036949-48036971 TGGTGAGGATGTGGATAAAAGGG + Intronic
926754100 2:16222009-16222031 TGGGGTGGATGTGGATCACAGGG - Intergenic
928768454 2:34676134-34676156 TGGTGAGGATGTGGATAAAAGGG + Intergenic
929767888 2:44864987-44865009 AGGTGAGGATGTGGAGCAATGGG + Intergenic
930471620 2:51822866-51822888 TGATGTGCATGTGAATCAAAGGG + Intergenic
931101403 2:59005715-59005737 ATTTGTGGATGTGAATCAAGAGG - Intergenic
931758844 2:65398726-65398748 TGGTGTGGATGTGCTGAAAAGGG + Intronic
936710118 2:115121967-115121989 AGGTTTGGGTATGCATCGAAGGG + Intronic
936877885 2:117214243-117214265 AGATGAGAATGTGCATCAGATGG + Intergenic
939097211 2:137847087-137847109 TGGTGAGGATGTGCAGAAAAGGG + Intergenic
939143452 2:138382865-138382887 TGGTGAGGATGTGAATAAAAGGG + Intergenic
942336629 2:174894477-174894499 TGGTGAGGATGTGGAACAAATGG + Intronic
943122700 2:183756924-183756946 TGGTGTGGATGTGGTACAAAAGG + Intergenic
943241154 2:185385844-185385866 TGGTGTGGATGTGGAACAATTGG - Intergenic
943635288 2:190300297-190300319 TGGTGAGGATGTGCAGAAAAGGG - Intronic
946177913 2:217933145-217933167 AAGGGTGGATATGCGTCAAATGG - Intronic
946180998 2:217948871-217948893 AGGTGGGGATGTGCAGCAAAGGG - Intronic
946917467 2:224539971-224539993 TGGTGTGGATGTGCATACAGGGG + Intronic
946992109 2:225345134-225345156 TGGTGTGGATGTGGAGGAAAGGG - Intergenic
947476340 2:230451272-230451294 TGGTGAGGATGTGCAGAAAAGGG - Intronic
1168781209 20:492135-492157 AGCTGTGAATGTGCATTAAGTGG + Intronic
1170080172 20:12466288-12466310 TGGTGTGGATGTGGAGAAAAGGG + Intergenic
1170197224 20:13701901-13701923 GGGGGTAGATGTTCATCAAATGG + Intergenic
1170961845 20:21032358-21032380 AGGTGTGGATGTGGTGAAAAGGG + Intergenic
1172919199 20:38467409-38467431 AGGTGTGAAAGTACATCAATAGG + Intergenic
1174042015 20:47706729-47706751 AGGTGTGGACCTGCATCAGTGGG + Intronic
1179982993 21:44906074-44906096 AGGTGTGGTGGTGCAGCAGATGG - Intronic
1181393731 22:22603200-22603222 AGGAGTGGATGCGCATCAGGTGG + Intergenic
1182065630 22:27429541-27429563 ATGTGTGGATGTGCATGCACAGG - Intergenic
1183000111 22:34849978-34850000 AGGTGGGGTTGGCCATCAAAGGG + Intergenic
949660890 3:6277055-6277077 TTGTGTGGATGGGCATCAGATGG + Intergenic
950178771 3:10896162-10896184 TGGTGTGGATGTTCTACAAAGGG - Intronic
950261927 3:11548733-11548755 AGGTGTGGATGTGCATCAAATGG + Intronic
950773609 3:15331978-15332000 TCGGGTGGATGTGCAACAAAGGG - Intronic
952386465 3:32845032-32845054 AGGTGAGGCTGTGCATCTGAGGG + Intronic
953100185 3:39817306-39817328 ATTTGAGGATGGGCATCAAAAGG - Intronic
953859151 3:46527431-46527453 AGGTGTGGATGAGTCACAAAGGG + Exonic
956872112 3:73428302-73428324 AGGTGAGGATGTGGAACAGAGGG - Intronic
957615815 3:82525326-82525348 TGGTGAGGATGTGCAGAAAAGGG - Intergenic
957966580 3:87329420-87329442 TGGTGAGGATGTGCAGAAAAGGG + Intergenic
959899684 3:111646571-111646593 AGGTGAGGATGTGGAGAAAAGGG + Intronic
960045319 3:113191864-113191886 TGGTGTGGATGTGGAGAAAAGGG - Intergenic
960144834 3:114189926-114189948 AGGTGTTTATGTGCATAACATGG - Intronic
960348542 3:116565154-116565176 ATGTGTTGATGATCATCAAAGGG + Intronic
961172729 3:124809658-124809680 AGGTATGGATGTGAATGACAGGG - Intronic
962314259 3:134349268-134349290 AGGCGTGGAAGTGCATACAATGG + Intergenic
965348894 3:167588564-167588586 TGGTGAGGATGTGGATAAAAGGG - Intronic
967655964 3:192049223-192049245 TGGTGAGGATGTGCAGAAAAGGG + Intergenic
967904758 3:194490654-194490676 AGTTGTGGATGGGCTTCAGAAGG + Intronic
968023200 3:195414167-195414189 TGGTGAGGATGTTCAGCAAAAGG + Intronic
968092369 3:195907421-195907443 AGGTGTGGCTGTGAGTCAGATGG - Intronic
968569142 4:1330244-1330266 AGGTGTGGGTGTGCGACAGACGG - Intronic
968571126 4:1341271-1341293 TGGTGTGGATGTGGAGCAGATGG - Intergenic
968731054 4:2269366-2269388 AGGGGGGGATGGGCATCACAGGG + Intergenic
970550556 4:17176815-17176837 ATGTGTGGATGTGGATCTTATGG - Intergenic
970632570 4:17966793-17966815 TGGTGAGGATGTGCAGCAACAGG + Intronic
972111278 4:35562235-35562257 AGGTGAGGATGTGGAAAAAAGGG + Intergenic
973635163 4:52855415-52855437 AGGGGAGGATGGGCCTCAAAGGG - Intergenic
973652384 4:53009038-53009060 AGGTGTGGCTGACCATCCAAAGG - Intronic
974801414 4:66823666-66823688 TGGTGTGGATGTGCTGAAAAGGG - Intergenic
975917720 4:79344596-79344618 TGGTGAGGATGTGGAGCAAAGGG - Intergenic
976240343 4:82949148-82949170 TGGTGAGGATGTGCAGAAAACGG - Intronic
978453255 4:108860080-108860102 AGGTATGGATGAGGAACAAAAGG - Intronic
981837399 4:149070830-149070852 TGGTGTGGATGTGGAGAAAAGGG + Intergenic
983139403 4:164130305-164130327 AAATGTGGATGTGTATTAAAAGG + Intronic
984092995 4:175397790-175397812 AAGTGTGGATGTGGAGAAAAGGG - Intergenic
986043731 5:4017759-4017781 AGGTGTTAATGTCAATCAAATGG - Intergenic
986537666 5:8808192-8808214 AGGTGAGGATGTGGAGAAAAGGG - Intergenic
986824407 5:11505001-11505023 TGATGTGGATGTGCAGCAGAGGG - Intronic
988193631 5:27970952-27970974 TGGTGTGGATGTGGAGAAAATGG + Intergenic
989073469 5:37536619-37536641 AGGTGTTGAACTTCATCAAATGG + Intronic
994374317 5:99001684-99001706 TGGTGAGGATGTGGATCAACTGG + Intergenic
994671660 5:102768982-102769004 TGGTGAGGATGTGGAACAAAGGG - Intronic
995809965 5:116094527-116094549 AGGTGAGGATGTGGAGAAAAGGG + Intronic
995920909 5:117310832-117310854 AGGTGTAGATGTGGTTAAAAGGG + Intergenic
996343640 5:122466407-122466429 AGTTCTAGATGTGCATCACAGGG + Intergenic
996424909 5:123304036-123304058 AGCTATGGATATTCATCAAAGGG + Intergenic
998788885 5:145744320-145744342 TGGAGTGGATGTGCTTCAATGGG - Intronic
999143253 5:149376759-149376781 AGCTGTGGATGTCCAACAAGAGG - Exonic
1001180124 5:169512637-169512659 AGCTGTGGATCTGCCTCCAAGGG + Intergenic
1005907650 6:30278550-30278572 TGGTGAGGATGTGGATAAAAGGG - Intergenic
1006687577 6:35849345-35849367 TGGTGAGGATGTGGAGCAAAGGG + Intronic
1007901535 6:45418716-45418738 AAGTGTGAATGTTCAGCAAAAGG + Intronic
1008927989 6:56907393-56907415 ATGTGTAGATGGGCATAAAAAGG + Intronic
1011896066 6:92227460-92227482 TGGTGTGGATGTGCTGAAAAGGG - Intergenic
1013050726 6:106532540-106532562 TGGTGAGGATGTGGAGCAAAGGG - Intronic
1015951069 6:138552996-138553018 AGGTGTGAAGGTGGATTAAAAGG - Intronic
1018685836 6:166303919-166303941 AAGTGTAGGTGTGCATTAAATGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1022116550 7:27266008-27266030 TGGTGAGGATGTGGATCAACTGG - Intergenic
1023268013 7:38429055-38429077 AGGTGTGGAGGCGTGTCAAAAGG - Intronic
1026064333 7:67056912-67056934 TGGTGAGAATGTGCAACAAATGG - Intronic
1027362061 7:77419154-77419176 AGGTGAGGAAATGCATGAAATGG + Intergenic
1030812669 7:113993661-113993683 TGGTGAGGATGTGCAGAAAAGGG + Intronic
1033148521 7:138892183-138892205 AGATGTGGCTGTAAATCAAATGG - Intronic
1035045685 7:155963862-155963884 AGCTGGGGGTGTGCATGAAATGG - Intronic
1035795136 8:2349131-2349153 TGGTGAGGATGTGGAGCAAAAGG + Intergenic
1036738011 8:11336426-11336448 CGGTGTGAATGTTCACCAAAGGG - Intergenic
1037623595 8:20588737-20588759 AGGTGTGAATGTGTTTAAAATGG + Intergenic
1039071919 8:33656574-33656596 TGGTGAGGATGTGGATAAAAGGG - Intergenic
1039436642 8:37564105-37564127 AGGTGTGGCTGTGGAGGAAATGG - Intergenic
1040468978 8:47720454-47720476 TGGTGAGGATGTGGATCAAGAGG - Intronic
1040820567 8:51552189-51552211 TGGTGTGGATGTGGTTAAAAAGG + Intronic
1042843264 8:73146168-73146190 AACTGTGGCTGTTCATCAAATGG - Intergenic
1045038782 8:98200756-98200778 TGGTGAGGATGTGGATCAACTGG - Intronic
1045373975 8:101552953-101552975 ATGTTTGGTTGTGCATCCAAAGG + Intronic
1049499550 8:142954479-142954501 AGTTGTGGATATTCATCAAATGG - Intergenic
1050041104 9:1494735-1494757 TGGTGTGGATGTGAAGGAAAGGG - Intergenic
1050078065 9:1885159-1885181 ATGTGTGAATGTGCACTAAAAGG + Intergenic
1050759373 9:9048159-9048181 TGGTGAGGATGTGAATAAAATGG + Intronic
1050830703 9:10008548-10008570 AGCTGTGAATATGCATGAAATGG - Intronic
1052403105 9:28025598-28025620 AGGTGTGAATGGGCATGAAAGGG + Intronic
1053433997 9:38063223-38063245 GAGTGTGGCTGTTCATCAAATGG + Intronic
1053520048 9:38768404-38768426 AGGTGTGGATGAGTCACAAATGG - Intergenic
1054748934 9:68884816-68884838 TGGTGAGGATGTGGAGCAAAGGG + Intronic
1055992897 9:82126970-82126992 TGGTGAGGATGTGGAACAAAAGG + Intergenic
1056462646 9:86823252-86823274 CGGTGTGGATATGCATCCACAGG - Intergenic
1058571027 9:106344426-106344448 AGGTGAGGATGTGGAGAAAAAGG + Intergenic
1060920666 9:127418194-127418216 AGGGGTGGAAGTGCATCAGCTGG + Intergenic
1061226715 9:129284767-129284789 AGGTGTGGATGTGGAGGAAGAGG - Intergenic
1203724531 Un_GL000216v2:39028-39050 AGGAGTGGATTTGAATCAAAAGG - Intergenic
1186229771 X:7440548-7440570 TGGTGAGGATGTGCAGAAAAAGG + Intergenic
1191650793 X:63535896-63535918 TGGTGAGGATGTGCAGAAAAGGG + Intergenic
1193350262 X:80455714-80455736 AGGTGAGGATGTGTAGCAACAGG - Intergenic
1194090263 X:89576326-89576348 AGGTGTGGATCTGCCTCACCAGG - Intergenic
1194857545 X:98952519-98952541 TGGTGTGGATGTGGAGAAAAGGG - Intergenic
1195122425 X:101768857-101768879 TGGTGAGGATGTGGAGCAAAAGG - Intergenic
1195951037 X:110273145-110273167 TGGTGTGGATGTGGAGAAAAGGG - Intronic
1196305831 X:114101790-114101812 ATGTGTATATGTGCACCAAATGG - Intergenic
1196646334 X:118121341-118121363 AAGTGAGGATGTTGATCAAAGGG + Intergenic
1196994043 X:121361352-121361374 TGGTGTGGATGTGGTTAAAAGGG - Intergenic
1197519607 X:127481097-127481119 TGGTGAGGATGTGGAGCAAAGGG - Intergenic
1199002381 X:142654283-142654305 ATGAGTGGATGTGAATCAGACGG - Intergenic
1199277056 X:145957402-145957424 AAGTGGGGATGTTCGTCAAAGGG + Intergenic
1200442914 Y:3232379-3232401 AGGTGTGGATCTGCCTCACCAGG - Intergenic
1201099004 Y:10657219-10657241 TGGTGTGGATTTGAATCGAATGG - Intergenic
1202627938 Y:56879770-56879792 AGGATTTGAAGTGCATCAAAGGG + Intergenic