ID: 950263662

View in Genome Browser
Species Human (GRCh38)
Location 3:11559804-11559826
Sequence AGGGCTCTGGGGACGTTAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950263662_950263674 12 Left 950263662 3:11559804-11559826 CCCGTTAACGTCCCCAGAGCCCT 0: 1
1: 0
2: 1
3: 3
4: 85
Right 950263674 3:11559839-11559861 CACTGAGCCGCGGGTGTGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 148
950263662_950263671 2 Left 950263662 3:11559804-11559826 CCCGTTAACGTCCCCAGAGCCCT 0: 1
1: 0
2: 1
3: 3
4: 85
Right 950263671 3:11559829-11559851 CCATCATGTCCACTGAGCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 78
950263662_950263676 23 Left 950263662 3:11559804-11559826 CCCGTTAACGTCCCCAGAGCCCT 0: 1
1: 0
2: 1
3: 3
4: 85
Right 950263676 3:11559850-11559872 GGGTGTGCCTGGAGCCATCCAGG 0: 1
1: 0
2: 1
3: 27
4: 272
950263662_950263672 3 Left 950263662 3:11559804-11559826 CCCGTTAACGTCCCCAGAGCCCT 0: 1
1: 0
2: 1
3: 3
4: 85
Right 950263672 3:11559830-11559852 CATCATGTCCACTGAGCCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950263662 Original CRISPR AGGGCTCTGGGGACGTTAAC GGG (reversed) Intronic