ID: 950264773

View in Genome Browser
Species Human (GRCh38)
Location 3:11565462-11565484
Sequence GAGCAGTACTGTGAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950264773_950264777 6 Left 950264773 3:11565462-11565484 CCATCTTCCTCACAGTACTGCTC 0: 1
1: 0
2: 1
3: 31
4: 309
Right 950264777 3:11565491-11565513 TCTTCCTAACAGCACTAAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950264773 Original CRISPR GAGCAGTACTGTGAGGAAGA TGG (reversed) Intronic
900276563 1:1833428-1833450 TAACAATACTGTGAGGAATAAGG + Intronic
900585479 1:3430540-3430562 GGGCAGTCCTGTGGGGAAGCTGG - Intronic
900800821 1:4735940-4735962 GAGCAGAGCTTAGAGGAAGAGGG + Intronic
902314303 1:15606295-15606317 GAGCAGAACTGTGAGCAGGCGGG + Intergenic
902733022 1:18382431-18382453 GAGCAGGGCTTTGGGGAAGAAGG - Intergenic
902785085 1:18727997-18728019 GTGGAGTATTGAGAGGAAGAGGG + Intronic
905849922 1:41266092-41266114 TAGCAGTGATGTGAGGAAAAAGG + Intergenic
906281805 1:44559637-44559659 GAGCAGGCCTGTTAGGAAGAGGG + Intronic
906832084 1:49043711-49043733 GAGAAGCACTGTTGGGAAGAAGG + Intronic
907830486 1:58060123-58060145 GAGCAGCAGGGTGAGGAGGAAGG + Intronic
908487969 1:64614057-64614079 GAGAAGTACTGAGCGGAAAATGG - Intronic
908558813 1:65284610-65284632 GAGGGGTAGTGTGAAGAAGAGGG - Intronic
909184864 1:72474239-72474261 AAGCAGTAATGTGAGGAGAAAGG + Intergenic
910084445 1:83382685-83382707 TATCAGTTCTGTGAGGAAGTTGG - Intergenic
911692476 1:100850142-100850164 AAGCAGAGATGTGAGGAAGAAGG + Intergenic
911871959 1:103109272-103109294 GAACTGTACTCTGAGGGAGAAGG + Intergenic
912233264 1:107820158-107820180 GAACAGTACTGTGATAAACAGGG - Intronic
913212074 1:116590153-116590175 GAGCAGGACAGTGAGGAGAAGGG - Intronic
914865379 1:151423492-151423514 CAGCAGAACGGTGAGGTAGATGG - Exonic
915212676 1:154322239-154322261 AAGCATTAGTGTGAGGAAGCAGG - Intronic
917510997 1:175669219-175669241 GAGCAGGACTGTGATGATAATGG - Intronic
918342181 1:183577039-183577061 GAGCTGTTCTTTGAGCAAGAGGG + Intronic
918431415 1:184464756-184464778 GAGCAGAATATTGAGGAAGAGGG + Intronic
919121050 1:193340560-193340582 AAGAAGTACTGTAATGAAGAGGG + Intergenic
919770036 1:201152246-201152268 GAGAAGGAATGTGGGGAAGAGGG - Intronic
921201951 1:212815489-212815511 AAGCACTACTGTGATGAGGATGG + Exonic
921887661 1:220322665-220322687 GAGCAGTCCTTCCAGGAAGAGGG - Intergenic
922068572 1:222168581-222168603 GAGGAAAACTGGGAGGAAGAAGG + Intergenic
922214142 1:223507034-223507056 GAGCTGTGCTGGGAAGAAGATGG + Intergenic
923597027 1:235368303-235368325 AAGCAGTCCTGGCAGGAAGACGG + Intronic
924818168 1:247461059-247461081 GATCAGTGCTGTGAATAAGATGG - Intergenic
1064491400 10:15860719-15860741 GAGCAGTGCGTAGAGGAAGAAGG - Intergenic
1067183385 10:44007032-44007054 CCCCAGCACTGTGAGGAAGAAGG - Intergenic
1067208462 10:44239332-44239354 GGGCAGGACTGAGGGGAAGAAGG - Intergenic
1067736456 10:48855728-48855750 AAGCAAAACTGTGAGTAAGAGGG - Intronic
1067790992 10:49287708-49287730 AAGCAGTGTTGGGAGGAAGACGG + Intergenic
1072806698 10:98428016-98428038 GAGAGGGACTGGGAGGAAGATGG + Intronic
1073046831 10:100644367-100644389 GAGCAGGACTGTGGGGCACAGGG - Intergenic
1073083266 10:100873096-100873118 GTGCAGAACTTTGGGGAAGATGG - Intergenic
1074097859 10:110329872-110329894 GACCAGTAGAGAGAGGAAGATGG + Intergenic
1074908567 10:117886671-117886693 GAGAAATTCTGTGTGGAAGAAGG - Intergenic
1075451733 10:122556597-122556619 GAGCCTTACTCTGAGCAAGATGG + Intergenic
1076069019 10:127471175-127471197 AAGCAGTGCTCTTAGGAAGATGG + Intergenic
1076224756 10:128765049-128765071 GAGCAGTAATGTGAAGATCAGGG + Intergenic
1076367833 10:129933802-129933824 GGGCAGTACTGGGAGGAGGTAGG - Intronic
1077242946 11:1520573-1520595 GAGCAGGACCGTGAGGATGGAGG - Intergenic
1077359436 11:2134205-2134227 GAGCATTGCTGTGGGGGAGAGGG - Intronic
1078353119 11:10611732-10611754 AATCAGTACTGAAAGGAAGATGG + Intronic
1078493508 11:11792269-11792291 GAGCAGTGGTGTGAGGACTAGGG - Intergenic
1078524324 11:12089126-12089148 AAGCAGTGCTGCAAGGAAGATGG - Intergenic
1079175664 11:18137852-18137874 GACCAGCACTGTGAGGAGGATGG - Exonic
1079177289 11:18153946-18153968 CACCAGCACTGTGAGCAAGATGG - Intronic
1079179222 11:18173906-18173928 GACCAGCACTGTGAGCAGGATGG - Exonic
1079181419 11:18197029-18197051 GAGCAGCACTGTGAGCAGGATGG - Intronic
1079266036 11:18934113-18934135 GACCAGTACTGTGAGCAGGATGG + Exonic
1080179436 11:29406282-29406304 CAGCAGTCCTATGGGGAAGAGGG + Intergenic
1080833866 11:35921661-35921683 GGGCAGGACTGTGAGTATGATGG - Intergenic
1080889666 11:36398452-36398474 GAGCAGCACAGGGAGGAAGGAGG - Intronic
1080922568 11:36723489-36723511 GGGCATAACTGTGAGGAAAAAGG - Intergenic
1081736541 11:45408484-45408506 GAGCTGGGCTGTGTGGAAGAAGG - Intergenic
1082011384 11:47452079-47452101 GAGCAGAAGTGTGAGTAATATGG + Intergenic
1083658920 11:64243164-64243186 GAGAAGGCCAGTGAGGAAGAGGG - Intronic
1083934482 11:65863196-65863218 CAGCAGAGCTGTGAGGAGGAGGG + Exonic
1084348730 11:68577589-68577611 GAGCAGTTCTGTAATAAAGAAGG + Intronic
1084803511 11:71563310-71563332 GAGCAGTGCTGTGATAAACATGG + Intronic
1085053852 11:73392997-73393019 GAGTAGTGGTGTGGGGAAGAAGG - Intronic
1085819892 11:79781044-79781066 GAGCAGCTCTATGAGGAACAAGG - Intergenic
1086245511 11:84747141-84747163 AACAAGTTCTGTGAGGAAGAAGG + Intronic
1086487104 11:87317952-87317974 GAGCAAAACTGTGAGGGAAAGGG + Intronic
1086585564 11:88447678-88447700 GAGAAGAACTGTTAGGAAAAAGG + Intergenic
1087240860 11:95776660-95776682 AATCAGTGCTTTGAGGAAGAAGG + Intronic
1088374264 11:109122957-109122979 GAGCAGTGCTGTGATAAACATGG + Intergenic
1089398842 11:118152925-118152947 GAGCAGGAGCGGGAGGAAGACGG + Intergenic
1090624264 11:128592163-128592185 GAGAAGTATTTTGAGGGAGAAGG - Intergenic
1091488568 12:913563-913585 GAGAATTACTGTTAGGAGGAAGG + Intronic
1092751308 12:11721978-11722000 GAGCTGTAATTTAAGGAAGAAGG + Intronic
1093566352 12:20609594-20609616 AAGCAGTACTGAGGGGAAAACGG + Intronic
1094696644 12:32825941-32825963 AAGCAGTATTTTGAGGCAGAAGG - Intronic
1095472310 12:42550047-42550069 TAGCAATACTGTGAGGTACATGG - Intronic
1096229016 12:49887292-49887314 GAAGAGGGCTGTGAGGAAGATGG + Intronic
1096501574 12:52067076-52067098 GGGCAGAACTGTGGGGAGGAAGG + Intergenic
1096526510 12:52213203-52213225 GTGCAGGGCTGTGAGGAAGGAGG - Intergenic
1099139484 12:78953757-78953779 GAGCAGTAGAGTGAGAAATAAGG + Intronic
1099141815 12:78987342-78987364 GAGAAGTACTCTGAGGCTGATGG + Intronic
1103716878 12:122950138-122950160 GAGCTGTTCTGGAAGGAAGAGGG - Intronic
1106086943 13:26551118-26551140 GAGCAGTAGAGAGAGAAAGAAGG - Intergenic
1107743224 13:43476756-43476778 CAGAAGCACTGTTAGGAAGAAGG + Intronic
1109178101 13:59180041-59180063 GAGCTGTTCTGTGAAGAAGTTGG + Intergenic
1111745401 13:92262127-92262149 GAGAAGTACTGGAAGGAAAAGGG - Intronic
1111769256 13:92575685-92575707 CAGCAGTGCTGAGAGGAATATGG - Intronic
1112109480 13:96279698-96279720 GAGCAGTTCTGAGATAAAGAAGG - Intronic
1112136795 13:96587756-96587778 TAACAGTACTGAGAGGAAGTGGG - Intronic
1112733094 13:102388741-102388763 GGGCAGTACTAGGAGGAAGGAGG - Intronic
1112832122 13:103465894-103465916 GAGAAGAACTGGGAGAAAGAAGG - Intergenic
1113362475 13:109644149-109644171 GAGCAGTTATGAGAGGAAGCCGG + Intergenic
1114407940 14:22473849-22473871 AAGGAAAACTGTGAGGAAGAAGG + Intergenic
1114551572 14:23535394-23535416 GAGCAGTGCTGTGAGGCTGCAGG + Intronic
1115521972 14:34241971-34241993 GAGCAGAAGTGTGAAGAAGGGGG - Intronic
1116683714 14:48011196-48011218 CATCAGTAATGTGAGAAAGAGGG + Intergenic
1117033538 14:51702554-51702576 GTGCAGTACTATGTGGAAAATGG + Exonic
1118780546 14:69004894-69004916 GAGCTCTTCTGTGAGGGAGAGGG - Intergenic
1119448117 14:74683655-74683677 GAGCAGGACTGTGAGGAACAGGG - Intronic
1120474527 14:84970189-84970211 GAGAAATACTGGGTGGAAGAGGG - Intergenic
1121539268 14:94712894-94712916 AAGCAGTGCTGTGTGGTAGAAGG - Intergenic
1122413763 14:101538893-101538915 GAGCAGTAGGGTAAAGAAGAAGG - Intergenic
1122651958 14:103231097-103231119 GGGCAGTAATCAGAGGAAGACGG + Intergenic
1122767061 14:104080057-104080079 GAGCAGTACTGTTATGAACGTGG + Intergenic
1124422867 15:29537827-29537849 GCGGAGTGCAGTGAGGAAGAGGG - Intronic
1125042237 15:35202936-35202958 GAGCACTTCAGTGAGAAAGATGG + Intergenic
1125493045 15:40162721-40162743 GAGCAGGTCTGGGAGGAAGTGGG + Intronic
1125832651 15:42727762-42727784 GATCAGTGCTGTGGGGCAGAGGG + Exonic
1127039337 15:54956249-54956271 GAGCTGCAGTGTGAGCAAGATGG - Intergenic
1127629872 15:60818070-60818092 GAGAAATACTGTGAGTGAGAGGG + Intronic
1128246274 15:66134773-66134795 GAGCTGAGCTGTGAGGATGATGG + Intronic
1129040989 15:72686129-72686151 GTGGAGGACTGTGAGGAAGCGGG - Exonic
1130102169 15:80902386-80902408 TATCAGTACTTTGAGGAGGAAGG + Intronic
1130712331 15:86295399-86295421 GAGCAGTTCCGTGAGTAAAATGG + Exonic
1132143307 15:99412199-99412221 CAGCAGCACTGGGAGGTAGATGG + Intergenic
1132194824 15:99906330-99906352 CAGCAGTACTGAGAGTAATATGG + Intergenic
1132700108 16:1218688-1218710 AAGCAGGACAGGGAGGAAGATGG + Intronic
1133666126 16:7969594-7969616 GTGAAGTAATGTGATGAAGAGGG - Intergenic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1134257114 16:12621692-12621714 GGCCAGAACTGTGAGGAAGGGGG - Intergenic
1134742921 16:16564116-16564138 GAGAAGTGCTGTGAGGAATGGGG - Intergenic
1134924639 16:18148344-18148366 GAGAAGTGCTGTGAGGAATGGGG + Intergenic
1135177465 16:20243181-20243203 GATGAGGGCTGTGAGGAAGAGGG + Intergenic
1136549892 16:30977399-30977421 GAGCAGTTCTCAGAGGAAGGTGG + Intronic
1136619101 16:31416222-31416244 GAGAAGAACTGTGGGCAAGATGG + Exonic
1137484442 16:48880115-48880137 GAGCGGCAGAGTGAGGAAGAAGG - Intergenic
1138387352 16:56644697-56644719 GAGCAGCAGTCTGGGGAAGAAGG - Intronic
1138552783 16:57756545-57756567 CAGCAGGACTGTCAGTAAGAGGG - Intronic
1140666745 16:77234815-77234837 GAGCAGGAGAGTGAGTAAGAAGG - Intergenic
1142132903 16:88438906-88438928 GAGCAGTACGAAGAGGAAAAAGG + Exonic
1142986499 17:3698227-3698249 GAGCAGCACTGTCAGGGTGACGG - Intergenic
1143090698 17:4447755-4447777 GGGCAGGACTGTGTGGCAGATGG + Intronic
1144554774 17:16272491-16272513 GAGCAGTAATGGGATGAGGAGGG - Intronic
1144802090 17:17936334-17936356 GGGCACTAGTGTGAGGAACAGGG - Intronic
1145244890 17:21262227-21262249 CAGCAGTGCTGTGCAGAAGAAGG + Intergenic
1145869110 17:28258909-28258931 GAGCAGAAGGGTGAGGAGGAGGG - Intergenic
1146941209 17:36845576-36845598 TAGCAGTGCTGAGAGGAGGAAGG + Intergenic
1147317075 17:39626185-39626207 GAGCGCTCCTGTGAGGGAGAAGG - Intergenic
1147559471 17:41500055-41500077 GAGCAGATCTGGGAGGATGATGG + Intergenic
1147899733 17:43776266-43776288 GAGCAGCCCTGTGAGGAACAAGG + Intronic
1150186026 17:63182108-63182130 GAGCGGTGGTGTCAGGAAGAAGG - Intronic
1151060527 17:71087667-71087689 GAACAGTGCTGTGATGAAAATGG + Intergenic
1151422473 17:74007468-74007490 GAGAAGGACTGGGAGGGAGAAGG + Intergenic
1153150772 18:2090027-2090049 AAGCACTACTTTGAGGAAGATGG - Intergenic
1154101938 18:11483969-11483991 CAGTAGTACTGTGAGCAAGGAGG - Intergenic
1154325784 18:13389515-13389537 GAGTAGTTCTGGGAGGAAGAGGG + Intronic
1155356032 18:24955068-24955090 GGGCAGCACTTTGAGGAGGAAGG + Intergenic
1157437149 18:47680455-47680477 GAGCAGAATTTTCAGGAAGAGGG - Intergenic
1157477787 18:48034504-48034526 GAGGAGGGCTGGGAGGAAGAGGG - Intronic
1157477792 18:48034519-48034541 GAGGAGTGCTGGGAGGAGGAGGG - Intronic
1160855130 19:1213842-1213864 GAGCAGGACTGGGAGGCACATGG - Intronic
1161370524 19:3908610-3908632 GAGGAGGACAGTGAGGAGGAGGG - Intronic
1164551909 19:29219092-29219114 GAGGAGTACTCTGAGACAGACGG + Intergenic
1166209083 19:41294189-41294211 TACCAGTACTGTGAGGTAGATGG + Intronic
1166851072 19:45761609-45761631 AAGCAGTACTGGGGGGATGAAGG + Intronic
1167399878 19:49258066-49258088 GAGCAGTACTGGATAGAAGAAGG - Intergenic
1168095638 19:54113308-54113330 GAGCAGCAATGTGAAGATGAAGG + Intronic
925395536 2:3530757-3530779 TAGTAGTAGTATGAGGAAGAAGG + Intergenic
925395566 2:3531029-3531051 TAGTAGTAGTATGAGGAAGAAGG + Intergenic
927293532 2:21427548-21427570 TAGCAGCACTGAAAGGAAGAAGG - Intergenic
927469998 2:23366825-23366847 GAGAAGGATTGGGAGGAAGAAGG + Intergenic
927639373 2:24837005-24837027 GAGCTGGACTTTGAGGAAGCTGG + Exonic
927804415 2:26133452-26133474 GAGCAGTACTGGCAGGAAAGGGG + Intronic
928088676 2:28361013-28361035 GAGAAGCACTGTGGGGAGGAGGG + Intergenic
929505454 2:42524656-42524678 GAGCAATACAGGGATGAAGATGG - Intronic
929829464 2:45335325-45335347 CAGCAGTGCTGTGAGGCAGAGGG - Intergenic
930210155 2:48628166-48628188 GAATAGTACTGTGATGAACATGG + Intronic
930224871 2:48781853-48781875 GAGCAGTAATGTGCTGGAGAAGG - Intergenic
931701521 2:64913081-64913103 CAGCAGTAGTGGCAGGAAGAAGG + Intergenic
931777092 2:65550099-65550121 GTGCAGTACTGTGGGTAAGCGGG + Intergenic
932660905 2:73651292-73651314 GCCCAGCACTGTGAGAAAGAGGG + Intergenic
933157870 2:78994078-78994100 CAGCAGCCCTGTGAGGAAGGAGG - Intergenic
933271352 2:80236419-80236441 GTGCAGTGCAGTGAGGGAGATGG + Intronic
934957741 2:98637791-98637813 GAGCAGTCCTCTGAGGTAGATGG - Intronic
935656519 2:105428337-105428359 GAGCTGTAGTTTGGGGAAGATGG - Intronic
938185422 2:129227585-129227607 GAGCAGGACTGTGAACCAGAGGG - Intergenic
940985741 2:160050322-160050344 GGGCAGTGCTGGAAGGAAGACGG + Intronic
943181235 2:184544306-184544328 GGGGACTACTGTGAGTAAGAGGG + Intergenic
943484206 2:188458811-188458833 GTGGAGTGCTGTGAGGGAGATGG - Intronic
945137581 2:206644700-206644722 GTGCTGAATTGTGAGGAAGAGGG + Intergenic
945741710 2:213671456-213671478 TAGCAGAACTGTGAGCAAGATGG + Intronic
945781494 2:214179483-214179505 GAGCAATTCTTTGTGGAAGAGGG - Intronic
946514585 2:220397779-220397801 GAGCAGGACAGGGAGGAGGATGG + Intergenic
947490786 2:230592785-230592807 GAGCAGTCATCTGAGGCAGAGGG - Intergenic
947670235 2:231931062-231931084 GAGCAGGATAGTGAGCAAGAGGG + Intergenic
948717867 2:239877003-239877025 GCCCAGTCCTGTCAGGAAGAAGG + Intergenic
1169193263 20:3670760-3670782 GAGCTGTACTGGGAGGTAGAGGG + Intronic
1169969375 20:11252775-11252797 CAACATTACTTTGAGGAAGATGG + Intergenic
1170053606 20:12174505-12174527 GAGCAGTTCTAAGAGGAAGCAGG - Intergenic
1170246115 20:14223465-14223487 GAGCAGGACTGTGTGAAATAGGG + Intronic
1170959875 20:21015858-21015880 GCGCAGTACTTTAAGGATGAGGG + Intergenic
1171409821 20:24938653-24938675 GAGCAGTCTTCTGAGGAAGATGG + Intergenic
1171436117 20:25125923-25125945 GAGTAGTCATCTGAGGAAGATGG - Intergenic
1171558627 20:26099665-26099687 GGGAAGGACTGTGAGGCAGAGGG - Intergenic
1172273278 20:33666590-33666612 GAGCAGAACTTTGAGGGCGAAGG - Exonic
1172837650 20:37883355-37883377 GATCAGTGCTGTGGGGAAGAGGG - Intergenic
1173730833 20:45327357-45327379 GAGCAGTAGGATCAGGAAGACGG + Exonic
1175174207 20:57100889-57100911 GAGCACATCTGTGGGGAAGATGG - Intergenic
1175575800 20:60060089-60060111 CAGCAGCACCGTGAGGAAGTGGG + Intronic
1176291061 21:5044915-5044937 CAGCACTACTGTCAGGAAGATGG - Intergenic
1177782750 21:25638501-25638523 GTGCAGAACTGTGAGGAATGAGG - Intergenic
1179005806 21:37513046-37513068 ATGCAGTACTGTAAGGAAGAGGG + Intronic
1179007332 21:37527401-37527423 CAGCAGTCCTGTGAAGCAGATGG + Intergenic
1179340151 21:40500113-40500135 CAGCAGTACTGGGAGGGAGGAGG + Intronic
1179352297 21:40623730-40623752 GGGAAGGACAGTGAGGAAGATGG - Intronic
1179866194 21:44218726-44218748 CAGCACTACTGTCAGGAAGATGG + Intergenic
1181534384 22:23534113-23534135 GGGCAGGACAGGGAGGAAGAAGG + Intergenic
1181953714 22:26573110-26573132 GAGCAGTCCCTGGAGGAAGAAGG - Intronic
1184355914 22:43979494-43979516 GAGCAGTGCTGAGAGGAGGAAGG - Intronic
1184507529 22:44913462-44913484 CAGCAGCCCTGTGAGGAAGGAGG + Intronic
949095637 3:82085-82107 ATGCAGAACTGTGATGAAGAAGG + Intergenic
950142079 3:10622343-10622365 AACCAGGACTGTGAGGAGGATGG + Intronic
950264773 3:11565462-11565484 GAGCAGTACTGTGAGGAAGATGG - Intronic
950847102 3:16025222-16025244 GACCAGTAGTGTGCTGAAGATGG + Intergenic
950927331 3:16754597-16754619 GAGCAGGACTGAGAGAGAGAGGG - Intergenic
951932324 3:27982177-27982199 GAGCATCAGTGTGAGGAAGGAGG - Intergenic
953027800 3:39154644-39154666 GAGCAGGACTGGGAGGGGGAGGG - Intergenic
953127923 3:40109682-40109704 TAGCAGTAGTGCCAGGAAGAAGG - Intronic
953385488 3:42503488-42503510 AAGCAGAAGTGGGAGGAAGAGGG - Intronic
955259414 3:57370619-57370641 CATCAGTACTAGGAGGAAGAAGG - Intronic
956056953 3:65309844-65309866 GATCTGGACAGTGAGGAAGAGGG - Intergenic
958421860 3:93939415-93939437 GAGGAGCACTCTGGGGAAGAGGG - Intronic
958557017 3:95692381-95692403 GAGCAGTACTGCAAAGAAGTGGG + Intergenic
960910234 3:122642492-122642514 TAGCAGTCCTCTGAGGAAGGAGG + Intergenic
962844148 3:139260572-139260594 CAGCAGTACTCTGTGCAAGAGGG - Intronic
962894889 3:139705222-139705244 GAGCAGCATTGTGGGGTAGAAGG - Intergenic
963739285 3:149059075-149059097 GAGAAGTAATGTGAAGAAAAAGG - Intronic
964705562 3:159615224-159615246 GTTCAGTGTTGTGAGGAAGAGGG + Intronic
964784297 3:160377458-160377480 GAGCAGTACTTGCAGGAAGATGG - Exonic
965303005 3:167027428-167027450 GATAAATACTTTGAGGAAGATGG + Intergenic
966490547 3:180523512-180523534 GAGCAGTTCCCTGAAGAAGAAGG - Intergenic
966926818 3:184649725-184649747 GTGCAGGACTGTGAGGAAAAGGG - Intronic
967266822 3:187698775-187698797 GAGCAGTGCTACGAGGAGGATGG - Exonic
967383328 3:188884496-188884518 GATCAGCACTGTGAGGAAGTTGG + Exonic
967943862 3:194786962-194786984 GACCAGTACTGCAAGCAAGAGGG + Intergenic
969599562 4:8167971-8167993 GGGCAGTACAGAGAGGAAGGAGG - Intergenic
971039784 4:22738878-22738900 GAGAAATACTGTAAAGAAGAGGG - Intergenic
971083475 4:23242854-23242876 GAGCAAAAGTGTGAGGAAAAAGG - Intergenic
973220579 4:47721700-47721722 CAGCAGCACTGTGAGGATTATGG - Intronic
973683605 4:53346763-53346785 GAGCAGTTCAGTGAGGATGGAGG + Intronic
974140601 4:57881569-57881591 GAGAATTATTGTCAGGAAGAGGG - Intergenic
975201121 4:71590767-71590789 GAGCAGTGATGTTAGCAAGATGG - Intergenic
975997563 4:80333996-80334018 TAGCCTTACTGTGAGGAACAAGG + Intronic
977836268 4:101649102-101649124 GAGCAGTACTGTGAGGACCTGGG + Intronic
977852990 4:101853156-101853178 GACTAGTACTGAGAGGAAGCTGG + Intronic
977953772 4:103003450-103003472 TAGCAGTATTTTGAGGATGATGG - Intronic
978945729 4:114493906-114493928 GGGGATTACTGGGAGGAAGAAGG + Intergenic
981252990 4:142626225-142626247 GAGCAGAACTGTGAACATGATGG + Intronic
984353851 4:178632602-178632624 CAGCAGCACTCTTAGGAAGAAGG - Intergenic
984653095 4:182290266-182290288 AAGCAGTACGGGGAGGAAGTAGG - Intronic
984713576 4:182905596-182905618 GAGCAGTGCTTTAAGAAAGAAGG - Intronic
985478018 5:90841-90863 GGGCAGTACTGTCACGAGGACGG + Intergenic
986778368 5:11040585-11040607 GAGTAGAACTGTGGGCAAGAAGG + Intronic
987829101 5:23073426-23073448 GAGTATCACTGTGAGGAAGGAGG + Intergenic
988607667 5:32693934-32693956 GGGCAGGACTTTGAGGACGAAGG - Intronic
989272432 5:39549021-39549043 GTGCAGTGCTTTGAGGAAGATGG + Intergenic
990847637 5:60161657-60161679 GTGCAGTACTGTGAAGGTGAGGG - Intronic
994182278 5:96780787-96780809 GGGCTGAACTGTGAGGAGGAAGG + Intronic
994521683 5:100846168-100846190 AGGCAGTATTGTGAAGAAGAGGG - Intronic
995936549 5:117522764-117522786 GAGCAAGTCTGTGAGCAAGATGG - Intergenic
996369863 5:122741760-122741782 GAGTTTTACTGTGAGTAAGATGG - Intergenic
997476646 5:134146355-134146377 AAGCAGTTCTGTGGGGAAGCGGG - Exonic
998891641 5:146752401-146752423 GAGCAGCACTGATAGGATGAGGG - Intronic
1000021720 5:157324042-157324064 GAGCAGATGTGTGAAGAAGAAGG - Exonic
1000177361 5:158770566-158770588 GAGGAGAACTGTGAGACAGAAGG - Intronic
1000331786 5:160211577-160211599 GTGCAGTACTATAAGGATGAAGG + Intronic
1003026167 6:2557660-2557682 GAGCTGATCTGTGAGGATGATGG - Intergenic
1003189603 6:3862454-3862476 GAGCAGCAGTGTGAGGAACTTGG - Intergenic
1004735901 6:18406235-18406257 CAGGAGTGCTGTGGGGAAGAGGG + Intronic
1006036426 6:31216531-31216553 GAGCAGGAGTGTGAGTAAGTAGG - Intergenic
1008442804 6:51552376-51552398 GAGGAGTACTGAGAGGAGCAGGG + Intergenic
1012102065 6:95102516-95102538 GAGAAGTACTTTGGGGAACAAGG + Intergenic
1014252101 6:119126165-119126187 GAGCAACTCTGTGAGCAAGAAGG - Intronic
1015421616 6:133017023-133017045 GTGAAGTTCTGAGAGGAAGAGGG + Intergenic
1017989689 6:159475394-159475416 GAGCAGAACTGGGAGGAAGTTGG - Intergenic
1018008678 6:159647986-159648008 GAGCGAGACTGTGGGGAAGAGGG - Intergenic
1018149015 6:160921147-160921169 GTGCAGTACTGTGCTGAAGAGGG - Intergenic
1018453609 6:163932015-163932037 CAGCTCTACTGTGAGGAAGAAGG + Intergenic
1022104279 7:27187369-27187391 CAGCAGTGCTGTGAGTGAGAAGG + Intergenic
1022471765 7:30685951-30685973 GAGCAGAAGGGTGAGGATGAGGG - Intronic
1022677285 7:32511775-32511797 GAGGAGTAAGGGGAGGAAGAAGG + Intronic
1024708227 7:51985180-51985202 GAGAAGTGCTCTGGGGAAGATGG + Intergenic
1027301267 7:76838804-76838826 CATCAGTTCTGTGAGGAAGTTGG - Intergenic
1028056484 7:86251790-86251812 AAGAAGTACTTTGAGGAAGTGGG + Intergenic
1028111008 7:86941378-86941400 GAGCTGTCCTGTAAGGAAGCAGG + Intronic
1028120863 7:87055223-87055245 GAGAAGAAATGTGAAGAAGATGG - Intronic
1029046722 7:97637581-97637603 GAATAGGAGTGTGAGGAAGAAGG + Intergenic
1030359231 7:108578044-108578066 GAGAAGATCTATGAGGAAGAGGG + Intergenic
1030798737 7:113822576-113822598 GAGAATTTCTGTGAGGGAGAAGG - Intergenic
1032413823 7:131720741-131720763 GAGCAGTACAGAGAGGAAAGGGG - Intergenic
1032511361 7:132475185-132475207 GAGCAGTAGTGGGAGGCAGCAGG + Intronic
1033643375 7:143283643-143283665 GAGCAGAACAGTGAGGAAATTGG + Intronic
1033742284 7:144284479-144284501 GAGCAGAAATGGGAGGAAGGTGG + Intergenic
1033751618 7:144365135-144365157 GAGCAGAAATGGGAGGAAGGTGG - Exonic
1034037137 7:147836584-147836606 GATCATGACTGTGAAGAAGAGGG - Intronic
1034550916 7:151820148-151820170 GAGCAGAAGTGAGAGGAGGAAGG + Intronic
1035681006 8:1488163-1488185 GGGGAGGACTGTGTGGAAGAAGG - Intergenic
1036831107 8:12020550-12020572 GAGGAGTCCTGTGATGGAGAAGG - Intergenic
1037029742 8:14090376-14090398 GAGCAGAACTGTGAAGCAGACGG + Exonic
1038947758 8:32379976-32379998 CAGCAGTGCAGTAAGGAAGAAGG - Intronic
1039419252 8:37421763-37421785 GATCTGTACTGAGAGGCAGAAGG - Intergenic
1041698460 8:60762185-60762207 GAGCAGTAGTTAGAGGAAGATGG - Intronic
1042977161 8:74482038-74482060 GAGCAGTACGGTGGTGAAGGGGG + Intronic
1043350991 8:79360572-79360594 GGGAAGTACTGGGTGGAAGAGGG - Intergenic
1044667628 8:94647254-94647276 GACCAGTAGTGTTGGGAAGAGGG + Intronic
1045324719 8:101109616-101109638 CAGTAGTACTGTGAGGGGGATGG - Intergenic
1045582287 8:103495296-103495318 GAGCAAAAATTTGAGGAAGAGGG + Intergenic
1046319991 8:112560368-112560390 GATAGGTACTGTGAGAAAGAGGG - Intronic
1046732380 8:117739450-117739472 GAGCAGCACTTTGAGAAAGCTGG - Intergenic
1047773854 8:128052584-128052606 GAAGAGTAATGTGAGCAAGATGG - Intergenic
1048799067 8:138179667-138179689 GTGGAGTAGTGTGAGGAGGATGG - Intronic
1049423895 8:142528813-142528835 GAGCAGGCCTGTGGGGAGGATGG - Intronic
1050284241 9:4084559-4084581 AAACAGAGCTGTGAGGAAGAAGG + Intronic
1051095843 9:13464238-13464260 AAGAAGTACTGTGAGGAAGCTGG - Intergenic
1051252563 9:15176476-15176498 CATCAATACTGTCAGGAAGAAGG + Intronic
1051398898 9:16658312-16658334 GGGGAGTACTGTAAGGGAGAGGG + Intronic
1052690520 9:31810339-31810361 GAAAAGTACTGGGATGAAGATGG - Intergenic
1055016907 9:71628530-71628552 GATCAGAACAGTGAGGATGAAGG - Intergenic
1055784373 9:79856857-79856879 GAGGACTAGTGTGAAGAAGAAGG - Intergenic
1055823045 9:80291047-80291069 GTGTAGTACTATGAGGAATAGGG + Intergenic
1056655097 9:88502658-88502680 GAGCAGTAGAGTGAGGAACAAGG - Intergenic
1057079736 9:92164151-92164173 GAGGAGTAATGTCAGCAAGATGG + Intergenic
1058536149 9:105962180-105962202 CAACAGTCCTATGAGGAAGATGG - Intergenic
1058579097 9:106435530-106435552 GAGGAGTGATGTGAGAAAGATGG - Intergenic
1058932872 9:109739292-109739314 AACCAGTACTCTAAGGAAGATGG + Intronic
1059331091 9:113536350-113536372 GAAGAGCGCTGTGAGGAAGATGG + Intronic
1061081429 9:128373025-128373047 GGGAAGTCATGTGAGGAAGATGG + Intronic
1186272903 X:7908848-7908870 GCCCAGAACTGTGAGGAAGATGG - Intronic
1186662716 X:11685323-11685345 GATCAGGAGTTTGAGGAAGATGG - Intergenic
1186871776 X:13781050-13781072 GAGCAGCAGTGGGAGGAAGTGGG - Intronic
1187017509 X:15344828-15344850 TAGGAGTACTTTGAGGAAAAAGG + Intergenic
1187190036 X:17025727-17025749 GAGCATAAATGTGAGCAAGAAGG - Intronic
1187500311 X:19833476-19833498 GAGGAGGACTGTGGGAAAGAGGG - Intronic
1191996230 X:67097970-67097992 GAGCATTACAGTCAAGAAGAGGG - Intergenic
1193797021 X:85889754-85889776 GAGTAGTGCTGTGATGAACATGG - Intronic
1197674204 X:129312419-129312441 GATCAGAACTATGAAGAAGAAGG + Intergenic
1199458624 X:148058153-148058175 GAGCAGTTCTATAATGAAGATGG + Intergenic
1199648907 X:149935662-149935684 GAGCAGGACGGTGAGCAACATGG - Intronic
1201448963 Y:14089213-14089235 GCCCAGAACTATGAGGAAGATGG + Intergenic