ID: 950265875

View in Genome Browser
Species Human (GRCh38)
Location 3:11572522-11572544
Sequence GAGGGGAATGGGACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 977
Summary {0: 1, 1: 0, 2: 11, 3: 89, 4: 876}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950265875_950265882 -7 Left 950265875 3:11572522-11572544 CCCTCCTCAGTCCCATTCCCCTC 0: 1
1: 0
2: 11
3: 89
4: 876
Right 950265882 3:11572538-11572560 TCCCCTCTCTTCGTCCCCTGGGG 0: 1
1: 0
2: 1
3: 23
4: 239
950265875_950265881 -8 Left 950265875 3:11572522-11572544 CCCTCCTCAGTCCCATTCCCCTC 0: 1
1: 0
2: 11
3: 89
4: 876
Right 950265881 3:11572537-11572559 TTCCCCTCTCTTCGTCCCCTGGG 0: 1
1: 0
2: 2
3: 19
4: 272
950265875_950265880 -9 Left 950265875 3:11572522-11572544 CCCTCCTCAGTCCCATTCCCCTC 0: 1
1: 0
2: 11
3: 89
4: 876
Right 950265880 3:11572536-11572558 ATTCCCCTCTCTTCGTCCCCTGG 0: 1
1: 0
2: 4
3: 22
4: 216
950265875_950265889 14 Left 950265875 3:11572522-11572544 CCCTCCTCAGTCCCATTCCCCTC 0: 1
1: 0
2: 11
3: 89
4: 876
Right 950265889 3:11572559-11572581 GGCATCCTCTGTTTTGTATTTGG 0: 1
1: 0
2: 2
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950265875 Original CRISPR GAGGGGAATGGGACTGAGGA GGG (reversed) Intronic
900002075 1:19962-19984 GAGGGAACTGAGACTGGGGAGGG + Intergenic
900021796 1:190485-190507 GAGGGAACTGAGACTGGGGAGGG + Intergenic
900192188 1:1356338-1356360 GTGGGGAAGGGGACTCAGTAGGG + Intronic
900522294 1:3111515-3111537 GAGGGGAAGGGGAGAGCGGAGGG + Intronic
901224190 1:7602158-7602180 GAGGGGAAGGGAAGGGAGGAGGG - Intronic
901401325 1:9016944-9016966 GGGGGGAGTGGGACTGAGACAGG - Intronic
901441790 1:9282518-9282540 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
901865234 1:12102239-12102261 GAGGGCAATGGGGCTCAGGTGGG + Intronic
902402476 1:16165827-16165849 AAGGGGAATGGGAATGGGGGAGG - Intergenic
902563365 1:17292898-17292920 GAGGGGAATGGGGAAGGGGAGGG + Intergenic
902766816 1:18622145-18622167 GAGAAGAAAGGGACTGAGGCAGG + Intergenic
902909612 1:19585811-19585833 GAGGGGAGTGGGGCTAGGGAGGG + Intergenic
903172427 1:21562675-21562697 AGGGGGAAGGGGACTGGGGAAGG - Intronic
903303377 1:22394544-22394566 AAGGGAGATGGGACTAAGGAAGG + Intergenic
903313654 1:22482386-22482408 GTGGAGAATGGGAGTGGGGAGGG - Intronic
903354927 1:22740764-22740786 GAGGGGTCTGGGGCTGAAGAAGG - Intronic
903647821 1:24905422-24905444 AAAGGGGATGGGCCTGAGGATGG + Intronic
903840362 1:26234471-26234493 GAGGGGAATGGGACGCGAGAGGG - Intronic
904005287 1:27360387-27360409 GAGAGGAAAGGGACCGAGGTGGG + Intronic
904316679 1:29670451-29670473 GAGGGGAAAGGGACCTGGGAAGG + Intergenic
904368487 1:30033779-30033801 GTGGGGAATAAGACAGAGGAGGG + Intergenic
904467001 1:30714211-30714233 GAGGGGGCTGGGGCTGGGGAGGG - Intronic
904477762 1:30775822-30775844 GAGGGGAGCTGAACTGAGGAGGG + Intergenic
904802435 1:33103332-33103354 GAGAGGAATGGGACTGGAGCAGG - Intronic
904852962 1:33472895-33472917 GAGGGCCCTGGGAATGAGGAGGG + Intronic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
905105146 1:35559426-35559448 GAGGAGAATGGGACTGAATAAGG + Intronic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905484687 1:38287034-38287056 AAGAGGAGTGGGGCTGAGGAGGG - Intergenic
905651180 1:39658032-39658054 GTGGGGAACGGGACAGAGCATGG - Intergenic
905943888 1:41885710-41885732 GAGGGGGAAGGGAAGGAGGAAGG - Intronic
905968061 1:42116048-42116070 GTGGGGAGTGGGACTGGGGCAGG + Intergenic
906105627 1:43290402-43290424 GAGGGGTGTGGGACTAAGGGAGG + Intergenic
906714258 1:47955291-47955313 AAGGAGAAAGGGACTGGGGAAGG - Intronic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906956611 1:50380843-50380865 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
907276683 1:53320726-53320748 CTGGGGAGTGGGACTGGGGAGGG - Intronic
907295352 1:53448566-53448588 GAGGGGAGAGGGACTGGAGATGG - Intergenic
907654352 1:56327327-56327349 GATGGGGATGGGGATGAGGATGG + Intergenic
907654380 1:56327416-56327438 GATGTGAATGGGAGTGGGGATGG + Intergenic
907654411 1:56327529-56327551 GATGGGGATGGGAATGAGGTTGG + Intergenic
907947034 1:59145262-59145284 TAGGGTAATGGGAATGAGCATGG + Intergenic
908458759 1:64329401-64329423 GATGGGAGTGGGACTGGGGGAGG - Intergenic
908843052 1:68297830-68297852 CAGGGGAAGGGGGCTGAGGTGGG - Intergenic
908890721 1:68844387-68844409 GAGGGGAATGGAATGGAAGAGGG + Intergenic
909183690 1:72457785-72457807 GAGGGGAGAGGGAGGGAGGAAGG - Intergenic
910650198 1:89558459-89558481 TATGGAAATGGGACTAAGGAGGG + Intronic
910739578 1:90500390-90500412 GAGAGGGATGGGATTGAGGTTGG - Intergenic
911372138 1:97006353-97006375 CTGGGGAATGGGACTCAGAATGG + Intergenic
911403876 1:97411381-97411403 GAGGGAAATTGTAGTGAGGATGG - Intronic
912069479 1:105791204-105791226 GAGGGGAAATGGCCTTAGGATGG - Intergenic
912379963 1:109242071-109242093 GAGGGGAATGGGGTGAAGGAGGG - Intergenic
912415686 1:109507137-109507159 GAGTTGGATGGGAATGAGGAAGG - Exonic
912519768 1:110237376-110237398 GAGGAAAGTGGGACTGAGGAAGG - Intronic
912718729 1:112002097-112002119 TAGGGCAATGGTACTGGGGATGG + Intergenic
912725717 1:112057431-112057453 AAGGAGGATGGGGCTGAGGAGGG - Intergenic
913369505 1:118082828-118082850 TGGGGGAAAGTGACTGAGGAAGG + Intronic
914805398 1:150987752-150987774 GATGGAAATGGGATTGAGGGTGG - Intronic
914902095 1:151716403-151716425 GCGGGGAAAGGGCCTGAGGAGGG + Exonic
915165495 1:153945957-153945979 GAGGGGGAGGAGGCTGAGGAAGG + Intronic
915318497 1:155043064-155043086 GAGGGGAAAGGTGGTGAGGAGGG + Intronic
915356012 1:155255469-155255491 AAGGGGGATGGGAATGGGGATGG + Intronic
915368138 1:155326740-155326762 GAGGGGCAGGGGCCTGAGGTGGG - Exonic
915424722 1:155815485-155815507 GAGGTGATTGTGACTGGGGAGGG + Intronic
915580124 1:156808538-156808560 GATGGGGAAGGGTCTGAGGAGGG + Intronic
915595441 1:156894007-156894029 GAGGGGAAGGGGACAGTGGAGGG + Intronic
916291151 1:163167592-163167614 GAGGAGAATGGGGATGAGGGAGG + Intronic
916473968 1:165150627-165150649 GAGGGGCAGGGGGCTGAGGCAGG + Intergenic
917219401 1:172711608-172711630 TGGGGGAATGAGAGTGAGGATGG + Intergenic
917538932 1:175895058-175895080 GAGGGGCAAGGGGCTGAAGATGG - Intergenic
917905645 1:179585149-179585171 GAAGTGAATGGGAATGAGGTGGG - Intergenic
918083242 1:181223437-181223459 GTGGGGAGTGAGACTGAGGCGGG + Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
918983751 1:191596508-191596530 GAGGGGGAGGGGACTAAGGGTGG - Intergenic
919284209 1:195532543-195532565 GATGGGAAGGGTACTGGGGAGGG + Intergenic
919710312 1:200720994-200721016 GAGGGGAAGGGAAGGGAGGAAGG - Intergenic
919944160 1:202307660-202307682 GATGGGGATGGGACCGAGGCAGG - Intronic
920080509 1:203369482-203369504 GAGGGGAGTGGGAGGGTGGAAGG - Intergenic
920592715 1:207236636-207236658 GAGGGGGATGGGCATGAGGGAGG + Intergenic
921130265 1:212213834-212213856 CAGGGGTGTGGAACTGAGGAAGG - Intergenic
921324678 1:213979043-213979065 GAGGGAACTGAGACTGGGGAAGG - Intergenic
921875315 1:220189087-220189109 GAAGGGAATGGGACTGAGGGGGG + Intronic
922707328 1:227796311-227796333 GAGAGGAATGGGAATGTTGAGGG - Intergenic
922818456 1:228468047-228468069 GGGGAGAATGGGACTGAGACAGG + Intergenic
922857511 1:228787688-228787710 GAGGAGAATGGGACTGAAGCAGG - Intergenic
922887072 1:229028346-229028368 GAGGAGAATGGAAGGGAGGAAGG + Intergenic
922912445 1:229229194-229229216 AAGGGGAATGGGAATAAGGAAGG - Intergenic
922938105 1:229436418-229436440 GACCAGAATGGGACTGAGGGTGG - Intergenic
923226733 1:231944628-231944650 GAGTGGAAAGGGACTGTGGTGGG - Intronic
923667245 1:236009456-236009478 GAGGGAATTGGGACTGGGGAGGG - Intronic
923755407 1:236786633-236786655 GAGGGGTATGTGAGTGAGCACGG - Intergenic
924113877 1:240726736-240726758 GTGGGGAATTGGACTGGAGATGG + Intergenic
924665122 1:246063570-246063592 GGAGGGAATGGGAGTGAGGGAGG - Intronic
1062830728 10:603909-603931 GAGGGGTGTGGGGCTGAGGCTGG - Intronic
1062844465 10:693145-693167 GAGCAGAATGAGACCGAGGAAGG - Intergenic
1062934392 10:1375087-1375109 GTGGTGCATGGGACTCAGGAAGG + Intronic
1063337412 10:5229228-5229250 GAGGGGTGTGGGTCTGAGCAGGG + Intergenic
1064273022 10:13881911-13881933 GAGGGGAATGGCAATGTGAAGGG + Intronic
1064753252 10:18553370-18553392 GAAGGGAATGGGAAGGAGAATGG + Intronic
1064754588 10:18562653-18562675 GAAGGGAATGGGAAGGAGAATGG + Intronic
1064755048 10:18565926-18565948 GAAGGGAATGGGAGGGAGAATGG - Intronic
1064755725 10:18570526-18570548 GAGCGGAATGGAATGGAGGATGG - Intronic
1065250799 10:23811381-23811403 GAAGGGAGTGGGACTGGAGAGGG + Intronic
1066680787 10:37935570-37935592 GAGGGAAATGGCCCTGACGAGGG + Intergenic
1067296019 10:44975514-44975536 GAGGGGAGTGGGGCTGGGGGTGG - Intronic
1068076344 10:52260104-52260126 TGGGGGAATGGGAATGAGGGTGG - Intronic
1068100142 10:52542405-52542427 TTGGGGAATGGGTCTGAGAAAGG + Intergenic
1069823057 10:71239383-71239405 GGAGGGAATGGGCCTGAGGGTGG + Intronic
1070121198 10:73579050-73579072 GAGGGTGATGGGGCTGAGGAAGG - Intronic
1070329963 10:75409611-75409633 GAGGGGAACGGGCCTCAGGAGGG + Intergenic
1070484007 10:76912476-76912498 GAGGTGAAATGGTCTGAGGAGGG + Intronic
1070503145 10:77090292-77090314 TTGGGGAATGGCACTGGGGATGG - Intronic
1070543302 10:77432896-77432918 GAGGGGGAAGGGACTGAGTGAGG + Intronic
1070653158 10:78252465-78252487 GCCGGGAAAGGGATTGAGGAGGG - Intergenic
1070805243 10:79266969-79266991 CAGTGGAATGGGGCTGAGGAGGG + Intronic
1071249025 10:83796938-83796960 GAGGGGACAGGGAGGGAGGAGGG + Intergenic
1071400447 10:85263615-85263637 GAGGAAATTGGGGCTGAGGATGG + Intergenic
1071827142 10:89336384-89336406 AAGGGCAATGGGAGTGAGGAGGG - Intronic
1072430523 10:95366997-95367019 GAGGGGAGTGTGACTGAGACAGG - Intronic
1072496709 10:95968372-95968394 GAGGGGCTTGGGAATGGGGAGGG - Intronic
1072693285 10:97585282-97585304 GAGGGAACTGGGACTGTGGCTGG - Intronic
1073240672 10:102055930-102055952 GAGGGGAGAGGGAGGGAGGACGG - Intronic
1073266118 10:102229484-102229506 GATGGGAGTGGGGCGGAGGAGGG + Exonic
1073911219 10:108347047-108347069 GAGGGGAGAGGGAAAGAGGAGGG + Intergenic
1074772933 10:116744992-116745014 GGGGGGAATGGGAGAGTGGAAGG - Intergenic
1074798199 10:116970905-116970927 GAGGGGAATGGGACTAGAAATGG + Intronic
1075058450 10:119237687-119237709 GAGGGGGAGGGAACTGAGGAGGG + Intronic
1075685652 10:124363666-124363688 GAGGAAAATGGGAGGGAGGAGGG + Intergenic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076071172 10:127490976-127490998 TAGGGAAAGGGGACTGGGGAGGG - Intergenic
1076296321 10:129387551-129387573 GAGGGGCATGGGACTCACCAAGG + Intergenic
1076438131 10:130460194-130460216 GAGAGGACTGGGAGTGTGGAAGG - Intergenic
1076760809 10:132605112-132605134 GAGTGGGAAGGGACTGGGGATGG + Intronic
1076760938 10:132605419-132605441 GATGGGAAAGGGGCTGGGGATGG + Intronic
1077091265 11:779399-779421 GAGGGGAAGAGGAATGGGGAGGG - Intronic
1077208031 11:1353429-1353451 GAGGGAACTGGGGCTGAGGTAGG - Intergenic
1077372447 11:2189666-2189688 GAGGAGAATGGGGCTGCGGGGGG + Intergenic
1077396343 11:2325151-2325173 GAGTGGAATGGGGCTGTGGTGGG - Intergenic
1077497166 11:2891954-2891976 GTGGAGAATGGGAGGGAGGAAGG - Intronic
1077555481 11:3224021-3224043 GAGGGGAGGGGGAATGTGGATGG + Intergenic
1077900080 11:6480947-6480969 GAGGTGTATGAGACGGAGGAGGG - Intronic
1078066888 11:8084562-8084584 GAGGACAAGGGCACTGAGGACGG - Intronic
1078140946 11:8692620-8692642 GAGGGGAAGGAAACTTAGGATGG + Intronic
1078178669 11:8990863-8990885 GTTGGGAGTGGGACTGAGAAGGG - Intronic
1078183109 11:9029030-9029052 GAGGAGCTTGGGACTGAGGGGGG - Intronic
1078354345 11:10623150-10623172 CAGGAGAATGGGGCCGAGGAAGG + Intronic
1078467204 11:11559257-11559279 GAGGAGAATGTGACAGTGGAGGG - Intronic
1078632552 11:13016424-13016446 GAGGGAAATGGGAGTGGGAATGG - Intergenic
1078917654 11:15795138-15795160 CTGGGGAGTGGGACTGGGGATGG + Intergenic
1080169323 11:29280513-29280535 CAGGGAAAAGGGACTGAGGCTGG + Intergenic
1080202396 11:29688159-29688181 GAGGGGAGTGGGACTAAGATGGG - Intergenic
1080826328 11:35852185-35852207 GAGTGAAATGGGATTGAGCAAGG - Intergenic
1081473734 11:43403372-43403394 AATGAGAATGGGACTGGGGATGG - Intronic
1081922186 11:46788873-46788895 GAGTGGAATAGAACTGAGGAGGG + Intronic
1082198705 11:49335914-49335936 GAGGGGAAGGAGGCAGAGGAGGG + Intergenic
1082810396 11:57476112-57476134 GAAGAGAATGGGCCTGAGGTAGG - Intronic
1082861013 11:57856767-57856789 GAGTGGCATGGGACAGTGGATGG + Intergenic
1083738013 11:64692747-64692769 GAGGGGAAGGGGACAGGGGAAGG + Intronic
1084003824 11:66313119-66313141 GCGGGGGATGGGAGTGGGGAAGG - Intergenic
1084021867 11:66422571-66422593 GTGGGAAATTGGACCGAGGAAGG - Intronic
1084154585 11:67306653-67306675 GCGGGGAATGGGACTGACATAGG - Intronic
1084162080 11:67355470-67355492 GGAGGGACTGGGAATGAGGAGGG - Intronic
1084180443 11:67443262-67443284 AAGGGGAGTGGGACTGAGTGGGG + Intronic
1084215657 11:67645638-67645660 GAGGGGAGTGGGAGGGAGGGAGG - Intronic
1084398625 11:68931090-68931112 GAGTGGAAGGGGACAGTGGAAGG - Intronic
1084441814 11:69178957-69178979 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1085100732 11:73797671-73797693 GAGGGGTATGTGAGTGAGCATGG - Intronic
1085350432 11:75794941-75794963 GAGGGGAGAGGAACGGAGGAGGG - Intronic
1085399893 11:76229671-76229693 GGAGGGAAGGAGACTGAGGAGGG + Intergenic
1085406723 11:76267510-76267532 GAGGGAAATGAGCCTGCGGATGG - Intergenic
1085414323 11:76310213-76310235 GTGGAGAATGGGAGTGAGGTCGG - Intergenic
1085649866 11:78257980-78258002 GAGGTGAATGGTACTAGGGAAGG + Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1088058286 11:105611179-105611201 GAGGGGAAGGGAACTGCTGAAGG - Intronic
1088108129 11:106228547-106228569 GATGGTAATGGAAATGAGGATGG - Intergenic
1088738327 11:112746709-112746731 GAAGGGAGTGGGAGTGAGGAGGG + Intergenic
1089209430 11:116790423-116790445 GCAGGCACTGGGACTGAGGAAGG - Exonic
1089388146 11:118081268-118081290 GAGGGGGATGGGCATGAGGGAGG + Intronic
1089560427 11:119340657-119340679 GAGGGGAAAGGGGCTGGGGAGGG - Intronic
1089650795 11:119911502-119911524 GAGGGCAGTGGGACTGGGGAGGG - Intergenic
1089670122 11:120050766-120050788 GAGGGCAATGGGAGAGAGGTGGG + Intergenic
1089685987 11:120147152-120147174 GAGAGGAATGGGAGGGAGGAAGG + Intronic
1090556136 11:127878543-127878565 GAGGGTGGTGGGCCTGAGGAGGG - Intergenic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090949054 11:131456601-131456623 AAGAGAAATGGGACTGAGAAGGG + Intronic
1091375139 12:19997-20019 GAGGGAACTGAGACTGGGGAGGG + Intergenic
1091692090 12:2604254-2604276 GAGGAGAAGGGGACTGAGACAGG + Intronic
1091901442 12:4147299-4147321 GGCAGGCATGGGACTGAGGAAGG - Intergenic
1091924117 12:4329966-4329988 ATGGGGAATGGTACTGGGGAGGG + Intronic
1092546140 12:9452766-9452788 GGGGGGACTAGAACTGAGGAAGG + Intergenic
1093017644 12:14170961-14170983 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1094627146 12:32135042-32135064 GAGGGGAATGGAGGGGAGGAGGG - Intronic
1094691315 12:32772067-32772089 GAGGGGAAAGGGAAAGAGAAAGG + Intergenic
1095918351 12:47503510-47503532 GAGGGGAATGGCACACAGCAGGG + Intergenic
1096109663 12:49021275-49021297 GAGGGGGATGGGGGTGAGGGTGG + Exonic
1096183939 12:49566278-49566300 CAGGGGAAGGGGGCTGGGGAGGG - Intronic
1096333394 12:50734303-50734325 GAGGGGAATGGGAAGAGGGAAGG + Intronic
1096516219 12:52156999-52157021 GGTGGGAATGGGAGTGGGGAGGG + Intergenic
1096665165 12:53159715-53159737 GAGAGGAATGAGAAAGAGGAAGG + Intronic
1096774559 12:53956038-53956060 GAGGGGATAGGGACTTAGAAGGG + Intronic
1096799823 12:54102806-54102828 GAGGGGAATGGTACTGGGGAAGG + Intergenic
1097029988 12:56083146-56083168 GAGGGGAGTGCTGCTGAGGACGG + Intronic
1097218292 12:57430879-57430901 GGGGGGACTGGGACGGGGGAGGG + Exonic
1097218299 12:57430897-57430919 GAGGGGAAAGGGGCTTGGGAAGG + Exonic
1097751699 12:63361918-63361940 GAGGGGAAAGGGAGGGAGGGAGG - Intergenic
1098114185 12:67157001-67157023 GAGAAGATTGGGACTGGGGAGGG + Intergenic
1098353491 12:69586976-69586998 GAGGGGCATGGGATTGGGGATGG - Intronic
1099246975 12:80203684-80203706 GAGGGGAAAGAAACAGAGGATGG - Intergenic
1099248045 12:80217299-80217321 GATGGGAAGGGGAGGGAGGATGG + Intronic
1100001052 12:89835572-89835594 GAGGGAAATGGCACTGAGCAGGG + Intergenic
1100250370 12:92815365-92815387 AAGGGGGAGGGGAATGAGGAGGG - Intronic
1100329335 12:93570328-93570350 CAGGGGGAGGGGACTAAGGACGG + Intronic
1100671411 12:96816969-96816991 GTCGGGAATGGGAGTGAAGAGGG - Intronic
1100688264 12:97010193-97010215 GATGGGGATGGCATTGAGGATGG + Intergenic
1101425139 12:104581966-104581988 GATGGGGATGGGACGGAGGGAGG + Intronic
1101667918 12:106836981-106837003 GAGAGTAATGTGACTGAGGAAGG - Intronic
1101682725 12:106985316-106985338 GAGGGAAATGGGAATTAGGGTGG - Exonic
1102007389 12:109597287-109597309 GAGGGGACAGGGACAGAGGGAGG - Exonic
1102457966 12:113082474-113082496 GAGGGGAAAGGGATGGAGGTGGG + Intronic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1103204896 12:119120901-119120923 GAGGGTAAGGGGAGTGACGATGG + Intronic
1103319250 12:120081161-120081183 GAGGAGAATGGGAATGGGGGTGG - Intronic
1103924262 12:124414892-124414914 GAGGGGAGTGGGGCTGGGCAGGG + Intronic
1103948655 12:124540495-124540517 GAGGGGGATGGGAGTGGAGATGG + Intronic
1103949055 12:124541644-124541666 GAGGGGGATGGGGGTGAGGATGG + Intronic
1104034249 12:125087535-125087557 GAGGGGAAAGGGAGGGAGGTCGG - Intronic
1104382139 12:128316346-128316368 GTGGGGAAGGAAACTGAGGAAGG - Intronic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1104790391 12:131477965-131477987 GATGGGAATGGAGTTGAGGATGG - Intergenic
1104842722 12:131832342-131832364 GAGGGGGATGGGAAGGGGGAAGG + Intronic
1104957729 12:132474630-132474652 GAGGGGAAGGGCACCGCGGAGGG - Intergenic
1104958394 12:132476871-132476893 GGGGTGAATGTGTCTGAGGAAGG - Intergenic
1105007300 12:132729450-132729472 GAGGGGAATGGGAGGGTGGGAGG + Intronic
1105683298 13:22752058-22752080 GTGGGGAAAGGGAGTGAGGCGGG - Intergenic
1105988530 13:25593672-25593694 GAGAGGAATGGGTAGGAGGAGGG + Intronic
1106224993 13:27778527-27778549 GAGAGGAATGCTTCTGAGGAGGG - Intergenic
1106786595 13:33113706-33113728 AAGGGTAATGGCACTGAGAAGGG - Intronic
1107802003 13:44117055-44117077 GTGGGGATTGGGAAAGAGGATGG + Intergenic
1107851204 13:44575468-44575490 GAGGCAAATGAGGCTGAGGAAGG + Exonic
1108223646 13:48265222-48265244 TTGGGGAATGGGACTGAGGAAGG - Exonic
1108544783 13:51481962-51481984 GTGGAGAATGGGAGTGATGAAGG - Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109556916 13:63988463-63988485 AAGGGGAAGGGAACTGATGAAGG + Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110436491 13:75482180-75482202 GCGGGGAATGGGGCTGTGGGCGG + Intergenic
1110582476 13:77147267-77147289 GGTGGTAATGGGTCTGAGGAAGG + Intronic
1111803027 13:93003666-93003688 GCTGGGAATGGGACTAAGGTAGG - Intergenic
1111859233 13:93680557-93680579 GAGTTGAATGGGATTAAGGAGGG + Intronic
1111885045 13:94009754-94009776 AATGGAAATGGGACTCAGGAAGG + Intronic
1112177105 13:97036586-97036608 GAGGGGAAGGGGAATGGGAAGGG + Intergenic
1112350133 13:98626319-98626341 GACGGGGATGGGAGTGGGGAGGG + Intergenic
1112541499 13:100318059-100318081 TACGGAAAAGGGACTGAGGAAGG - Intronic
1113033975 13:106028200-106028222 GAGGTGAATGGAAGTGAGGATGG - Intergenic
1113179788 13:107612091-107612113 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1113613288 13:111663305-111663327 GAGGGGAAGGGGAATGGGAAGGG - Intronic
1113651515 13:112036903-112036925 GAGGGAGCTGGGCCTGAGGAAGG - Intergenic
1113651530 13:112036956-112036978 GAGGGAGCTGGGCCTGAGGAAGG - Intergenic
1113651544 13:112037010-112037032 GAGGGAGCTGGGCCTGAGGAAGG - Intergenic
1113651558 13:112037064-112037086 GAGGGAGCTGGGCCTGAGGAAGG - Intergenic
1113651573 13:112037117-112037139 GAGGGAGCTGGGCCTGAGGAAGG - Intergenic
1113651602 13:112037224-112037246 GAGGGAGCTGGGCCTGAGGAAGG - Intergenic
1113651616 13:112037278-112037300 GAGGGAGCTGGGCCTGAGGAAGG - Intergenic
1113797290 13:113065937-113065959 GAGGGGGCGGGGACTGAGGAAGG - Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114483579 14:23049575-23049597 GAGGAGAAGGGGACAGAGGCAGG + Intronic
1115399406 14:32939779-32939801 GAAGGGAATGAGGCTGGGGAGGG + Intronic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1115754409 14:36518250-36518272 GAGGGAACTGAGACTGAGGGAGG - Intronic
1116427334 14:44807018-44807040 GAGGGGAAGGGGAGGGAAGAAGG + Intergenic
1117069442 14:52043474-52043496 GGGGAGAAGGGGACAGAGGAGGG + Intronic
1117099676 14:52333575-52333597 GAGGGCAAAGGGAATGGGGAGGG - Intergenic
1117536796 14:56710266-56710288 TAAGGGAATGGGAAGGAGGAAGG + Intronic
1118992982 14:70812337-70812359 GAGGGGAATGGGGTGGAGCAGGG + Intergenic
1119124219 14:72110550-72110572 GAGGGGAATGGAAAGGAAGAAGG - Intronic
1119184813 14:72632756-72632778 GAGGGGAAGGGGAGAGAAGAGGG + Intronic
1119184843 14:72632828-72632850 GAGGGGAAAGGGAGAGGGGAGGG + Intronic
1119424452 14:74526741-74526763 GAGGGGCAGGGGACAGAGTAGGG + Intronic
1119548901 14:75493668-75493690 GTGGGGAGGGGGACTGGGGAGGG + Intergenic
1119837249 14:77761432-77761454 TCGGGGAACGGGACTGAGTAAGG - Intronic
1120849384 14:89155631-89155653 GAGGGGAGTGGGAACAAGGAAGG - Intronic
1121089335 14:91170374-91170396 GAGGTGAGTGGGACCGAGGCTGG - Intronic
1121343463 14:93118330-93118352 GAGGGAAATGGGAAGGAAGATGG + Intergenic
1121468206 14:94129400-94129422 GAAGGGAAGGGGAGGGAGGAAGG + Intronic
1121935222 14:98012318-98012340 GAGGGGAATGGACCTGGGGCAGG + Intergenic
1122182975 14:99969351-99969373 GAGGGGGAGGGTACTGAAGAAGG + Intergenic
1122248717 14:100423301-100423323 GTGGAGAATGCCACTGAGGATGG + Intronic
1122810815 14:104287012-104287034 GAGGCCACTTGGACTGAGGAAGG + Intergenic
1122827968 14:104380716-104380738 GAAGGGATTGGAACTGAGTAAGG + Intergenic
1123022704 14:105409158-105409180 GAGGGGAGAGGGAGTGGGGAAGG - Intronic
1123934114 15:25185925-25185947 GAGGAGAATGCGACTCAGGAAGG - Intergenic
1123996349 15:25720558-25720580 GAGGGGAAGGGGAGGAAGGAGGG + Intronic
1124142442 15:27088932-27088954 GAGGGGAATGGGGCTGTGCCGGG + Intronic
1124957776 15:34370922-34370944 GAGGAGAAGGGAAGTGAGGAAGG - Intergenic
1125758031 15:42078331-42078353 GAGTGAAATGAGACTGGGGAGGG + Intronic
1126059718 15:44768607-44768629 CAGGGAAATGGAACTGAGAAAGG - Intergenic
1126096003 15:45091175-45091197 GATGGTAATGGGACTGTGGATGG - Intergenic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126271057 15:46817394-46817416 GAAGGAAGTGGGAGTGAGGAAGG + Intergenic
1127467574 15:59259085-59259107 GAGGGAAATTGGACTGGGCATGG - Intronic
1127756188 15:62094612-62094634 GAGGGGAGAGGGACTGTGTATGG + Intergenic
1127849721 15:62902058-62902080 GAGGGCAGTGGGACAGAGCAGGG + Intergenic
1128462572 15:67882380-67882402 GAGGGGGAAGGGATGGAGGAAGG + Intergenic
1128723525 15:69970930-69970952 GATAGGAATGGGGATGAGGATGG - Intergenic
1129025247 15:72566067-72566089 GAGGGAAATGGTACTGGGCAAGG - Intronic
1129085322 15:73083570-73083592 AAGGGAAATGGGACTGAGTGTGG - Intronic
1129189653 15:73929963-73929985 GAGGGGAATGGGACAGGGCAAGG + Intronic
1129333341 15:74838751-74838773 GCAGGGAAAGGGCCTGAGGAGGG + Intronic
1130263834 15:82380709-82380731 TAGGGGTATTGGACGGAGGAAGG + Intergenic
1130991264 15:88877410-88877432 GAGGGGAAGGGGAACGGGGAGGG + Exonic
1131641577 15:94299035-94299057 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1131654238 15:94438393-94438415 GAGAGGAATAGGACTGAGGAAGG + Intronic
1132210596 15:100019300-100019322 GAGGAGAACGGGACTAGGGAGGG + Intronic
1132298694 15:100763399-100763421 GAGGAGACTGGGACAGAGGTGGG - Intergenic
1132451437 15:101970977-101970999 GAGGGAACTGAGACTGGGGAGGG - Intergenic
1132855496 16:2042905-2042927 GAGGGGAATGGTAGGGAGGGAGG - Intronic
1132989907 16:2787190-2787212 GAGGAGGAGGGGGCTGAGGATGG - Intronic
1133534789 16:6691429-6691451 GATGGTAAAGGTACTGAGGAAGG - Intronic
1133578943 16:7124492-7124514 GAGGGGAGGGGGAGCGAGGAAGG - Intronic
1133780196 16:8932769-8932791 GAAGGGAATGGGGCTGGGGATGG + Intronic
1134248082 16:12554905-12554927 CAGGGGAGAGGGGCTGAGGAGGG + Intronic
1134406331 16:13962220-13962242 GTGGGGAATGGGAGTGAGACTGG - Intergenic
1135926813 16:26702056-26702078 GAGGGGAATTGGAGAGGGGATGG - Intergenic
1136227092 16:28866494-28866516 GAGGAGGAAGAGACTGAGGAAGG - Exonic
1137357117 16:47777559-47777581 GAGAGGAATGGGACTGCAGATGG + Intergenic
1137436618 16:48459805-48459827 TAGGGGAAAGGGAATGAGGGAGG - Intergenic
1137577244 16:49608307-49608329 GAGGGGAGGGGGAAGGAGGAGGG + Intronic
1137836864 16:51600403-51600425 GAAGGGAATGGGAATGAACAGGG - Intergenic
1137982102 16:53078733-53078755 TAGGGGAATGGAAGTGGGGAGGG - Intronic
1138252174 16:55509522-55509544 AGGGGGCATGGGTCTGAGGAGGG + Intronic
1138261135 16:55623526-55623548 GTGTGGAATGGGAATGGGGAAGG - Intergenic
1138532033 16:57639756-57639778 GAGGGGAAGGGGAGTGAAGGAGG - Intronic
1138547264 16:57727405-57727427 GAAGGGATTGGGACTGACCATGG - Exonic
1138673455 16:58633757-58633779 GAGAGGAGTGGGAATGAGGAAGG + Intergenic
1138754709 16:59469454-59469476 GAGGGAAATTGTAATGAGGAGGG + Intergenic
1139020137 16:62738797-62738819 GAGGGGAAAGAGACTCTGGAAGG + Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139373639 16:66483612-66483634 GAGGGAAATGTGACAGAGGAAGG - Intronic
1139512700 16:67436417-67436439 GTGGGGAATGGGGCTGGGAATGG + Intronic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1140268607 16:73442675-73442697 GAGGGGCATGGCCCTGAGGTGGG - Intergenic
1140882790 16:79214141-79214163 GAGGGGAAGGGGAATAAGAATGG - Intergenic
1141199132 16:81883624-81883646 GAGGGGTGAGGGCCTGAGGATGG + Intronic
1141330794 16:83108942-83108964 GAGGGGAAGGGAGCTGATGAGGG - Intronic
1142412760 16:89924566-89924588 GAGGGGAAGGGGCCAGAGAAAGG + Intronic
1142877067 17:2857613-2857635 GAGGGGATTGGGTTTGAGTATGG + Intronic
1142934281 17:3314565-3314587 GGAGGGAATAGGACTGGGGAGGG + Intergenic
1143095266 17:4475476-4475498 GAGGGGAGTGAGGGTGAGGAAGG + Intronic
1143366630 17:6412930-6412952 GAAGGGCATGGCATTGAGGAGGG - Intronic
1143526827 17:7478006-7478028 GAGGGGATTTGGTATGAGGAAGG - Intronic
1144140262 17:12341199-12341221 GAGGGGAATGGGGATGTGGCAGG + Intergenic
1144278791 17:13703335-13703357 GCGGGGAGAGGGAGTGAGGAAGG + Intergenic
1144459470 17:15446445-15446467 AAGGGCAATGGGAGTGGGGAGGG + Intronic
1145077976 17:19870792-19870814 GCCAGGAATGGGACTGAGGAAGG + Intergenic
1145923897 17:28631749-28631771 GAGGGGAATGGAACTGAGAAGGG + Intronic
1146430387 17:32787741-32787763 GAGGGGAAAGGGAGGGAGGTGGG - Intronic
1146926503 17:36749448-36749470 GAGGGGAATGGAACTCAGTTTGG + Intergenic
1147578250 17:41614670-41614692 GAGGGTGATGGGTCTGTGGATGG - Intronic
1147865435 17:43548956-43548978 GAGAGGATTGGGAATGTGGAGGG - Intronic
1148649409 17:49238888-49238910 GAGGGGCCTGGGATTGGGGAAGG - Intergenic
1148808798 17:50277841-50277863 GGCTGGATTGGGACTGAGGACGG - Intronic
1148915451 17:50973313-50973335 GAGGAGAATGGGATTGGAGAGGG + Intronic
1148990882 17:51666276-51666298 GAAGGGAAGGGGAATGAGGTAGG + Intronic
1149302506 17:55318164-55318186 GAGGGAAAGGGGGCAGAGGATGG + Intronic
1149556713 17:57578561-57578583 GAGGGGAAGGGGACGGGAGAAGG + Intronic
1150168423 17:62966426-62966448 GAGGGGGATGGGAATGGGGGCGG - Intergenic
1150489476 17:65564369-65564391 GAGGGGACTGGGACTGGGACTGG + Intronic
1150675709 17:67244913-67244935 GAGGGGAAGGGGACTAAGTAGGG + Intronic
1150711147 17:67531888-67531910 GAGGGGAGGGGGAGAGAGGAAGG - Intronic
1150786259 17:68165371-68165393 GAAGGGAAGGGGAGGGAGGAGGG + Intergenic
1150947682 17:69765588-69765610 GAGGGGGAAGGGAGAGAGGAAGG - Intergenic
1151462106 17:74260516-74260538 GAGGGGAGTGGCAGTGAGGAGGG + Exonic
1151958486 17:77392638-77392660 GAGGGGGAGGGGACTGGGAAAGG + Intronic
1152187466 17:78866873-78866895 GAGGGGGAGGGGAGTCAGGAGGG + Intronic
1152494833 17:80663736-80663758 GAGGGGACTGTGACTGGGGAGGG - Intronic
1152659502 17:81535756-81535778 GAGGGGGATGGGGATGAGGATGG - Intronic
1152739620 17:82013227-82013249 GAGGGGATGGAGACGGAGGAAGG - Intronic
1152936704 17:83142422-83142444 GAGGAGAATGTGGATGAGGAAGG + Intergenic
1152977087 18:231700-231722 GAGGGAAATAGGAGTGGGGAGGG - Intronic
1153501226 18:5751968-5751990 AAGGGGAAAGGCACTGAGGAAGG + Intergenic
1153687179 18:7557982-7558004 GGGGAGAATGGGACTGGGAATGG - Intergenic
1153836750 18:8970484-8970506 GAGGGGGAAGGGAGGGAGGAAGG + Intergenic
1154238823 18:12632572-12632594 GAGGAGATTGGGATTGTGGATGG - Intronic
1155164237 18:23219670-23219692 GAGGGGTCTGAGACTCAGGAGGG - Intronic
1155229306 18:23757447-23757469 GAGGGGACTGGGGAGGAGGAGGG - Intronic
1155857875 18:30856814-30856836 GAGGGAGATGGGACTGAAAAAGG - Intergenic
1156875264 18:42002931-42002953 AAGGGGAATGGGACTAACTAGGG + Intronic
1157746656 18:50141842-50141864 GCAGGGAATGGGACTGGGCAGGG - Intronic
1157864184 18:51166745-51166767 GAGGGGAAGGGGGCTGAGCAGGG - Intergenic
1158071754 18:53478423-53478445 GAGGGGAATAGGAACTAGGAAGG + Intronic
1158149968 18:54357427-54357449 GAGAGGAAAGGCACTGAAGAGGG + Intronic
1158243859 18:55408400-55408422 GAGATGGATGGGACTGGGGATGG - Intronic
1158500392 18:57995701-57995723 GAAGGGAAGAGGAGTGAGGAAGG + Intergenic
1158814458 18:61077847-61077869 GAAGGAAAGGGGAATGAGGATGG - Intergenic
1160248221 18:77178047-77178069 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
1160633827 19:61570-61592 GAGGGAACTGAGACTGGGGAGGG + Intergenic
1160710002 19:547094-547116 GAGGGGGATGGGAGGGATGAAGG + Intronic
1161072552 19:2270009-2270031 GAGGGGCATGGGTCGGAGGTCGG + Intronic
1161400836 19:4065763-4065785 GAGGGGAGGGGGGCTGGGGACGG + Intronic
1161483677 19:4523625-4523647 GACGGGAGTGGGAATGGGGATGG - Exonic
1161635894 19:5388692-5388714 GAGGGGAATCGGGCAGGGGAGGG + Intergenic
1161706250 19:5823445-5823467 AAGGGGAGTGGGAGTGGGGAGGG + Intergenic
1161821607 19:6533711-6533733 GAGGGGAAGGGGACTCTGGAGGG - Intronic
1162050005 19:8027409-8027431 GTGCTGAATGGGAATGAGGATGG - Intronic
1163018617 19:14471432-14471454 GGGGGGACTGGGGCTCAGGAGGG - Intronic
1163293123 19:16393786-16393808 GAAGGGAACGGGACCGAGAATGG + Intronic
1163611552 19:18304451-18304473 GAGGGGAATGGGGAGGAAGATGG + Intergenic
1163751608 19:19081568-19081590 GAGGAGAATGCCACTGAGGGTGG + Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1165077274 19:33286844-33286866 CAGGGGTAAGGGAATGAGGATGG + Intergenic
1165081508 19:33309793-33309815 GCGGGGAATGGAATAGAGGATGG - Intergenic
1165143720 19:33718542-33718564 GATGGGAAGGGGACGGAGGGTGG - Intronic
1165332817 19:35150798-35150820 GAGGGCAATGGGCGGGAGGAGGG + Intronic
1165392587 19:35546935-35546957 TAGGGGAATGCAGCTGAGGAAGG - Exonic
1165402432 19:35610376-35610398 TAGGTAAATGGGAATGAGGAAGG - Intergenic
1165436249 19:35797068-35797090 GACGGGAACGGGATTTAGGAGGG + Intergenic
1165477861 19:36042074-36042096 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
1165506891 19:36238579-36238601 AATAGGAATGGGAGTGAGGATGG + Exonic
1165764681 19:38343369-38343391 GAGGGGTAAGGGGCTGTGGAGGG - Intronic
1166108071 19:40607272-40607294 GAGGGGAATGGTTCTGGGGTTGG - Intronic
1166670634 19:44707728-44707750 GCTGGGAAGGAGACTGAGGAAGG - Intronic
1166695504 19:44849252-44849274 CACTGGAATGGGACGGAGGAGGG + Intronic
1166730860 19:45058275-45058297 GAGGTGAATGGCAGAGAGGAGGG - Intronic
1167169552 19:47822027-47822049 GAGGCGGAGGGGACCGAGGAGGG + Intronic
1167262118 19:48464676-48464698 GAGGACGATGAGACTGAGGAAGG + Exonic
1167423046 19:49415015-49415037 GAGTGGATGGGGACTGGGGAGGG - Intronic
1167440683 19:49507036-49507058 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1167610935 19:50507473-50507495 GAGGGGAATGTGGCTGGGGGAGG - Intronic
1167738088 19:51309813-51309835 GAGGGGGAAGGAATTGAGGATGG + Intergenic
1167913431 19:52721672-52721694 GAGGGGAAAGGGAGAGAGGGAGG + Intronic
1168148284 19:54431401-54431423 GGGGGGAAAGGGAGGGAGGAGGG - Intronic
1168296152 19:55378147-55378169 GAGGGGGAAGGGACGGAGGAGGG + Exonic
1168509263 19:56961527-56961549 GAGGGGAGGGGGAAAGAGGAGGG - Intergenic
1168723153 19:58565848-58565870 GAGAGGAATGGGGCTGGGCACGG + Intronic
924987113 2:282065-282087 GAGAGGAATGGCACTGGGGGAGG - Intronic
925905129 2:8535552-8535574 GAGAGGAAGGGGGCTGAGGAGGG + Intergenic
925942188 2:8831304-8831326 GGGAGGGATGGGGCTGAGGAGGG - Intronic
926156180 2:10455156-10455178 GTGGGGAATGGGTCTGAGAGCGG + Intergenic
926254928 2:11185037-11185059 CTGGGGTATGGGAGTGAGGAGGG - Intronic
926808062 2:16730603-16730625 GAAGGGAATGGGTCAGAGAAAGG - Intergenic
927200629 2:20575928-20575950 TGGGGGAAGGGGACTGGGGAGGG + Intronic
927207500 2:20619380-20619402 GAGTGGAATGGGGCAGAGCAGGG - Intronic
927343558 2:22010226-22010248 GAGGGGAAAGGGAAGGGGGAGGG - Intergenic
927460309 2:23292966-23292988 GAGGGGACAGGGACAGGGGAAGG + Intergenic
927561407 2:24076693-24076715 GAGGGGGCGGGGCCTGAGGAGGG + Intronic
927887775 2:26729023-26729045 AAGGGGAGTGGGGCTGAGTAGGG - Exonic
929385702 2:41403699-41403721 GAGAGGAAGGGGAAAGAGGATGG + Intergenic
929444454 2:41991826-41991848 GAGGGGGAAGGGGGTGAGGAGGG + Intergenic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929787783 2:45004573-45004595 GAGGGAAATCGGACTCAGGGCGG - Intergenic
930307792 2:49697975-49697997 GAGGGAATTGGGGCTGAGAAAGG + Intergenic
930472068 2:51829727-51829749 GAAGGGAAGGGAAGTGAGGAAGG - Intergenic
930826322 2:55700287-55700309 GAGGGGAGGGGGAGTGGGGAGGG - Intergenic
931233377 2:60392908-60392930 GAGAGGAATGGAACTGGGGCAGG - Intergenic
931525418 2:63147205-63147227 GAGGGGAATGATACTTAGGTAGG + Intronic
931781258 2:65580922-65580944 GAGGGACAGGGGACTGAGGTAGG + Intergenic
931838324 2:66123831-66123853 GAGGGGATGAGGAATGAGGAGGG - Intergenic
932243288 2:70174959-70174981 GAGGGGGTTGGGGCTGAGCACGG - Intronic
932531294 2:72536165-72536187 GAGGGGAATGGGATTGGAAATGG - Intronic
932751869 2:74376356-74376378 TGGGGGAATGGGGCTGAGGAAGG - Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
933326069 2:80839098-80839120 GTTGGGGATGGGAGTGAGGATGG - Intergenic
933355483 2:81205252-81205274 GAGGGGAAAGGGTGGGAGGACGG - Intergenic
933505169 2:83168079-83168101 GAAGAGAATGGAACTGAGAAAGG + Intergenic
933734750 2:85486876-85486898 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
933944751 2:87276276-87276298 GATGGGGATGGGGCAGAGGACGG + Intergenic
934616725 2:95775909-95775931 GAAGGGAATGGGAGTGAGTGTGG - Intergenic
934644165 2:96048651-96048673 GAAGGGAATGGGAGTGAGTGTGG + Intergenic
934660457 2:96140842-96140864 GAGGGGATTGGGGCTGGGTAGGG + Intergenic
934712809 2:96526929-96526951 GGGCGGCATGTGACTGAGGAAGG + Intergenic
934750703 2:96792440-96792462 GAGGGGAAGGGGAGCGGGGAAGG - Intronic
934837580 2:97604742-97604764 GAAGGGAATGGGAGTGAGTGTGG + Intergenic
934853359 2:97714840-97714862 CAGGGCAGTGGGGCTGAGGATGG - Intronic
934854839 2:97723303-97723325 GAGGGGAAAGGGTCAGCGGAAGG + Intronic
935011552 2:99141194-99141216 GAGGAGAAAGGGGCGGAGGATGG - Intronic
935308412 2:101759666-101759688 GAGGGGAATGGGGAGGGGGAGGG - Intronic
935308416 2:101759672-101759694 GAGGGGGAGGGGAATGGGGAGGG - Intronic
935674114 2:105579737-105579759 GAAGGGAAGGAGACTGAGGGAGG - Intergenic
936335460 2:111585303-111585325 GACGGGGATGGGGCAGAGGACGG - Intergenic
936371262 2:111904132-111904154 GAGGGGAATGGCAGTCAGGGCGG - Intronic
936567649 2:113593443-113593465 GAGGGAACTGAGACTGGGGAGGG - Intergenic
937062477 2:118990861-118990883 GATGGCAAAGGGGCTGAGGATGG + Intronic
937144134 2:119627858-119627880 GAAGGGACTGAGACTGAGGTAGG - Intronic
937270117 2:120644293-120644315 GAGGGGAAAGGAACTGAGTAGGG - Intergenic
937354952 2:121192470-121192492 GAGGGGAGTGGGGGAGAGGAAGG - Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937909045 2:127066527-127066549 GAAGGGAATGGGACTACTGACGG - Intronic
938081048 2:128370330-128370352 GAGGGGCTGGGGTCTGAGGAAGG + Intergenic
938139925 2:128787081-128787103 TGGGGGAATGGGAATGAGGTCGG + Intergenic
938297272 2:130185973-130185995 GAGGGGAATGGGGCAGATGTGGG + Intronic
938837094 2:135115950-135115972 GGGGGGAATGGGGCTGATGAGGG + Intronic
939370053 2:141287234-141287256 GAGGAGAATGAGAATGAGAATGG - Intronic
939461080 2:142495559-142495581 GTGGGGGCTGGGACTGAAGAAGG - Intergenic
940175145 2:150870418-150870440 GCGGAGAATGGGACTGAGACAGG + Intergenic
940929793 2:159414284-159414306 GAGGGGCAAGGGAGTGAAGATGG + Intronic
941198745 2:162483010-162483032 AAGGAGAATGGGAATGAAGAAGG + Intronic
941312166 2:163947084-163947106 GCGGGAAATAGGATTGAGGATGG + Intergenic
941739838 2:169023806-169023828 AAGTGGAATGAGACTGGGGAGGG + Intronic
942069024 2:172298652-172298674 GTGGAGAATGGGAGAGAGGAAGG + Intergenic
944027447 2:195188251-195188273 GAGGTGAATTGGACTGTGGTAGG - Intergenic
944976789 2:205062545-205062567 GAGTGGAAGTGCACTGAGGATGG + Intronic
945410581 2:209501530-209501552 GAGGAGAAAGAGACAGAGGATGG + Intronic
946301575 2:218827506-218827528 GAGCTGAGTGGGACTGGGGAAGG + Intronic
946399411 2:219460780-219460802 GAGGGGAAGGCGCCTGAGGAGGG - Intronic
946881296 2:224179721-224179743 AGGGGGAAGGGGACTGAGGGTGG + Intergenic
947415607 2:229892199-229892221 GAGGATAATGGGAAGGAGGAAGG + Intronic
947511007 2:230754385-230754407 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
947511020 2:230754421-230754443 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
947668162 2:231919923-231919945 GGTGGGAGTGGGACAGAGGAAGG + Intergenic
947755140 2:232557354-232557376 AAGGTGAATGAGACTGTGGAAGG + Intronic
947849690 2:233275671-233275693 GAGTGGAGTGGGACTGGGAAGGG - Intronic
947938724 2:234029469-234029491 GAGGTCAATGGCACTCAGGAGGG - Intergenic
948344332 2:237282667-237282689 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948344346 2:237282697-237282719 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948388908 2:237598248-237598270 GAGGGAGAGGGGACTGAGGTGGG - Intronic
948699138 2:239749581-239749603 GAGGGGTGAGGGACTGAGCAGGG - Intergenic
948732867 2:239978145-239978167 GAGAGGAATGGGACCGTTGATGG - Intronic
949071323 2:242026451-242026473 GAAGGGACTGGGACTCAGGCAGG - Intergenic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1168967895 20:1910439-1910461 CTGGGAAATGGGACTGAGGTAGG - Intronic
1169765619 20:9144764-9144786 GAGGGGAATGAGGGGGAGGAGGG + Intronic
1169900459 20:10547425-10547447 GAGGTGAAAAGGACTCAGGAGGG - Intronic
1170031412 20:11947977-11947999 GAGGGGAAGGCGACTGGTGAAGG + Intergenic
1171796616 20:29571541-29571563 GAGGGGAATGGTACTGGGGAAGG - Intergenic
1171851625 20:30312625-30312647 GAGGGGAATGGTACTGGGGAAGG + Intergenic
1171885132 20:30646555-30646577 GAGGGGATTGGGGGTGGGGAGGG - Intergenic
1172292207 20:33784327-33784349 GAGGGAGATGGGAAGGAGGAGGG - Intronic
1172434785 20:34921301-34921323 CAGGGGAATGGGAGAGAGGAAGG - Intronic
1172634462 20:36400799-36400821 CAGGGGAATGGGAGTGAAGGAGG + Intronic
1172995765 20:39069446-39069468 GAGGGTGGTGGGACTGAGGTGGG + Intergenic
1173882622 20:46428238-46428260 GAGGGGTAGGGGAGTGAGGATGG + Intronic
1174744541 20:53048497-53048519 GAGGGTAATGGCTCTGATGATGG - Intronic
1175345074 20:58267055-58267077 GAGAAGAATGGGATGGAGGAGGG + Intergenic
1175487384 20:59355720-59355742 GGGGGGAGAGGGACAGAGGAGGG - Intergenic
1176025442 20:62983137-62983159 GAAGGGGATGGGAGTGATGAGGG - Intergenic
1176275589 20:64265680-64265702 GAGGGGGAAGGGACAGAAGAAGG - Intronic
1176335975 21:5600553-5600575 CAGGGCTGTGGGACTGAGGAGGG + Intergenic
1176365067 21:6027790-6027812 GAGGGGGTTGGGGCTGAGGGAGG + Intergenic
1176391782 21:6220395-6220417 CAGGGCTGTGGGACTGAGGAGGG - Intergenic
1176469637 21:7095779-7095801 CAGGGCTGTGGGACTGAGGAGGG + Intergenic
1176493198 21:7477557-7477579 CAGGGCTGTGGGACTGAGGAGGG + Intergenic
1176507444 21:7660826-7660848 CAGGGCTGTGGGACTGAGGAGGG - Intergenic
1177366643 21:20148300-20148322 AAGGGGAAAGGGGCTGAGCATGG - Intergenic
1177432680 21:21010944-21010966 AAGGGGAATGGGAATGTGGGTGG + Intronic
1177491776 21:21835050-21835072 GAGGGGGATGTGCCTCAGGAGGG - Intergenic
1178321637 21:31610440-31610462 GAGGGACAGGGGACCGAGGAGGG + Intergenic
1179469331 21:41600143-41600165 GAAGGTAAAGGGACTGACGAGGG - Intergenic
1179576244 21:42310211-42310233 GAAAGGAAAGGGGCTGAGGAGGG - Intergenic
1179633931 21:42695486-42695508 GAGGGGAGAGGGCCAGAGGACGG + Intronic
1179758451 21:43510755-43510777 GAGGGGGTTGGGGCTGAGGGAGG - Intergenic
1179831722 21:44001123-44001145 GAGGGGGAAGGGAGTGGGGATGG + Intergenic
1180183690 21:46129262-46129284 CAGGGGAATGGTCCTGGGGAAGG - Intronic
1180626870 22:17199425-17199447 GAGGGGAAGAGGATAGAGGAGGG - Intronic
1180747566 22:18101443-18101465 GAGGGAAAAGGGTCAGAGGAAGG - Exonic
1180786303 22:18549678-18549700 GAGGGGATGGGTACTGGGGAGGG - Intergenic
1181140019 22:20797484-20797506 GCAGAGAATGGGACAGAGGAAGG + Intronic
1181182365 22:21077328-21077350 GAGGGGAGTGGGGCAGAGGTGGG - Intergenic
1181774275 22:25148307-25148329 GGGAGGGCTGGGACTGAGGAAGG - Intronic
1182048943 22:27298731-27298753 GGTGGGTATGGGAGTGAGGAGGG + Intergenic
1182194219 22:28497830-28497852 GTGAGGAATAGGGCTGAGGATGG + Intronic
1182321312 22:29480051-29480073 GCGGGGCAGGGGACCGAGGAGGG - Intergenic
1182389555 22:29981065-29981087 GAGGGAACTGGGACTAAGAAAGG - Intronic
1182411590 22:30191461-30191483 GAAGGGGAGGGGACTGAGAAAGG - Intergenic
1182870226 22:33639919-33639941 GAGGGCAAAGGGACTGATGAGGG + Intronic
1183096213 22:35553847-35553869 GTGGGGAAGGGGACAGAGGCAGG - Exonic
1183263324 22:36810418-36810440 TAGGGGGTTGGGAGTGAGGAAGG + Intronic
1183383534 22:37502534-37502556 GAGGGGAACAGGAGTGAGGTGGG - Intronic
1183426283 22:37741077-37741099 GACGGGGATGGGAGGGAGGAGGG + Intronic
1183455689 22:37922009-37922031 TATGAGAATGGGCCTGAGGAGGG + Exonic
1183563943 22:38599349-38599371 GGGAGGAATGTGTCTGAGGAGGG + Intronic
1183607244 22:38872841-38872863 GCGGCGAATGGGGCCGAGGAAGG + Intergenic
1183652828 22:39168748-39168770 GAGGGAAACAGGACTGAGGTGGG + Intergenic
1183780953 22:39998518-39998540 GAGGGGGGAGGGGCTGAGGATGG + Intronic
1184326245 22:43789122-43789144 GGGAGGAATGGGACTGCTGATGG + Intronic
1184332063 22:43833524-43833546 GAGGAGGAGGGGTCTGAGGAGGG - Intronic
1184380816 22:44143878-44143900 GAGGGGGAAGAGAGTGAGGAAGG - Intronic
1184606187 22:45576088-45576110 AGGGGGACTGGGACTGGGGACGG - Intronic
1184763676 22:46560704-46560726 GAGGGGACTGGGGCCTAGGAAGG + Intergenic
1184870823 22:47237435-47237457 GAAGGGAGAGGGAGTGAGGATGG + Intergenic
1184947057 22:47811096-47811118 GGGGTAGATGGGACTGAGGATGG - Intergenic
1185202465 22:49516662-49516684 GAGGGGAATGGGAGGGAGAGAGG + Intronic
1203308713 22_KI270736v1_random:127561-127583 GAGTGGAATGGAACTGAGAGTGG + Intergenic
949893132 3:8748057-8748079 GATGAGAATGGGCCTGAGGCAGG + Intronic
950098522 3:10343854-10343876 GAGGAGAATGGGGCTGAGGCAGG - Intronic
950182229 3:10922595-10922617 GGGAGGAATGGGAATGAGGGAGG + Intronic
950265875 3:11572522-11572544 GAGGGGAATGGGACTGAGGAGGG - Intronic
950420299 3:12894894-12894916 GAGGGGAATGTGACTGTTGAGGG + Intergenic
950435848 3:12979550-12979572 GAGGGGAATGGGACGTGGAAGGG + Intronic
950681086 3:14585524-14585546 GAGGGGAAAGGGACTGCAGCTGG + Intergenic
950704064 3:14769296-14769318 GAGGGAAAAGGCACTCAGGAGGG + Intronic
950836861 3:15928615-15928637 CAGGAGAATGGCACAGAGGAGGG + Intergenic
951995060 3:28718312-28718334 GAGGGCTTTGGGTCTGAGGAAGG + Intergenic
952352279 3:32551862-32551884 GAAGGGCAGAGGACTGAGGAAGG - Intronic
952534704 3:34297283-34297305 TAGGGGAATGGTCCTCAGGAAGG + Intergenic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952862602 3:37826389-37826411 GAGGGGAATGTGAGTGAGGGTGG - Intergenic
952972057 3:38657583-38657605 GACAGGAATGGGGCTGAGGGTGG + Intergenic
953243048 3:41166548-41166570 AAGGGGAGTTGGACTGATGAAGG - Intergenic
953888931 3:46736275-46736297 CAGGGGCATGGGACGGAGGCTGG - Intronic
954361596 3:50125362-50125384 GAGGGGCAGGGGACTCAGGGAGG + Intergenic
954377433 3:50202519-50202541 GAGGGGAAGGGCACTGTGGATGG - Intergenic
954411605 3:50373600-50373622 GTGGGGAGTGGGACTGAAGGGGG + Intronic
954737194 3:52716122-52716144 GAGGGGTGTGGGAGTGAGCATGG - Intronic
954920431 3:54186135-54186157 GATGGGAATGAGGGTGAGGATGG + Intronic
955217969 3:57000415-57000437 GAGAGGAATTTGACTGGGGAGGG - Intronic
955492634 3:59498538-59498560 GAGTGGAATGTGTCTTAGGAAGG - Intergenic
955933069 3:64077192-64077214 GATGGGGATGGGAATGGGGATGG + Intergenic
955933072 3:64077198-64077220 GATGGGAATGGGGATGGGGATGG + Intergenic
956012901 3:64850607-64850629 GATTGGAATGGGACAGAGGTGGG + Intergenic
956125360 3:66005851-66005873 GAGGGAAAGGGCACTTAGGAAGG + Intronic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
957467073 3:80608069-80608091 AAGGGGAGTGGGAGGGAGGAGGG + Intergenic
957523519 3:81351212-81351234 GAGGGGAATGATATAGAGGAAGG - Intergenic
959430843 3:106252918-106252940 GAGGGTAAAGGGTGTGAGGAGGG + Intergenic
960680633 3:120243906-120243928 GAGGGAAAGGGGGATGAGGAAGG - Intronic
961041070 3:123678693-123678715 GAGGTGTCTGGGACTGGGGATGG + Intronic
961340077 3:126212112-126212134 AAGGGCTCTGGGACTGAGGAAGG + Intergenic
961622146 3:128232567-128232589 GGGGGGAAGGGGACTGAGGCGGG + Intronic
961635592 3:128330779-128330801 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635608 3:128330836-128330858 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635623 3:128330892-128330914 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635632 3:128330921-128330943 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635640 3:128330949-128330971 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635649 3:128330978-128331000 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635665 3:128331035-128331057 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635698 3:128331148-128331170 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635710 3:128331197-128331219 GAGGGGAGATGTACTGAGGAAGG - Intronic
961635717 3:128331226-128331248 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635726 3:128331255-128331277 GAGGGGAGATGTACTGAGGAAGG - Intronic
961635751 3:128331341-128331363 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635784 3:128331460-128331482 GAGGGGAGATGCACTGAGGAAGG - Intronic
961981514 3:131084136-131084158 GAGGGGATTGGGATTGGGGTGGG - Intronic
962285216 3:134079334-134079356 ACGAGGACTGGGACTGAGGAGGG + Intronic
962336627 3:134537654-134537676 GGGAGGAATGGGACTGTGGTAGG - Intronic
962386420 3:134936144-134936166 GGGAGGAGTGGGAATGAGGAGGG + Intronic
962502028 3:136004740-136004762 AAGGGAAATGCAACTGAGGAAGG + Intronic
963060563 3:141221533-141221555 AAGGGGAATGAGACTGAGAAGGG + Intergenic
963135412 3:141899083-141899105 GAGAGGAATGGGAATGGGTATGG + Intronic
963143257 3:141965541-141965563 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
964256988 3:154786618-154786640 CAGGTGAATGGGAGAGAGGAAGG + Intergenic
964618037 3:158690859-158690881 GAGCGGAGTGGGGATGAGGAGGG + Intronic
964749623 3:160042323-160042345 CAGTGGAATGGGAGTGGGGAGGG + Intergenic
965193465 3:165562043-165562065 GAGGGGTAGGGGAGTGGGGATGG - Intergenic
965666211 3:171096279-171096301 GAGGGGGAAAGGACTGAAGACGG - Intronic
966043372 3:175519327-175519349 GGGGAGAATGGGACTGAGACAGG + Intronic
966129792 3:176624555-176624577 GTGGAGAGTGGTACTGAGGATGG + Intergenic
966247982 3:177830207-177830229 TATGGGAATGGTACTGAGCATGG + Intergenic
966588215 3:181650995-181651017 GAGGGGAGAGGGAAGGAGGAAGG + Intergenic
966885724 3:184377173-184377195 GTGGGGAGTGGGGCTGGGGAGGG + Intronic
968050614 3:195652395-195652417 GAAGGGACTGGGACTCAGGCAGG - Intergenic
968096707 3:195936464-195936486 GAAGGGACTGGGACTCAGGCAGG + Intergenic
968105209 3:195995958-195995980 GAAGGGACTGGGACTCAGGCAGG + Intergenic
968287880 3:197518837-197518859 GAGGGGGGTCGGCCTGAGGAGGG - Intronic
968303501 3:197633535-197633557 GAAGGGACTGGGACTCAGGCAGG + Intergenic
968529968 4:1086564-1086586 GAGGGGTAGGGGAAAGAGGATGG + Intronic
969129601 4:4981904-4981926 GAGGGGAGTGGCTCTGAAGAGGG - Intergenic
969297098 4:6276627-6276649 GAGGGGAAGGGAGCTGGGGAGGG - Intronic
969393438 4:6906138-6906160 AAGGGGATTGGGAGGGAGGATGG + Intergenic
969874171 4:10123732-10123754 GGGGGGAATCGCACTGCGGATGG + Intergenic
970187286 4:13470907-13470929 GGGGGCAAAGGGACTGAAGAGGG + Intronic
970317647 4:14845046-14845068 GATGGGGATGGGAGTGGGGATGG + Intergenic
970317658 4:14845070-14845092 GATGGGGATGGGAGTGGGGATGG + Intergenic
970372770 4:15424608-15424630 GAGGGAGATGGTACTGAGGAAGG - Intronic
970658655 4:18260369-18260391 GAGGGCAGTGGGAGTGAGGCTGG - Intergenic
970690056 4:18611849-18611871 AAGGTGAAAGGGAGTGAGGAAGG + Intergenic
971119855 4:23691116-23691138 GAGGGGATTGGGAAAGAGGAGGG + Intergenic
971375044 4:26049762-26049784 GAGAGAAATGGGAGTGGGGAGGG - Intergenic
972687371 4:41363698-41363720 GAGGGGAAGGGGGCTGAAGTGGG - Intronic
973210699 4:47612279-47612301 GAGGCGAATGGCCCTCAGGATGG - Intronic
973726867 4:53785800-53785822 GAGGGGAAGGGTTCTGAGGGGGG - Intronic
973908984 4:55560249-55560271 GAGGGGAACAGGACTAAGTATGG + Intronic
975360217 4:73460937-73460959 GAGGGGGAGGGGAAGGAGGAGGG - Intergenic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
975445793 4:74463734-74463756 GATGAGAATGGGATGGAGGAGGG + Intergenic
975726380 4:77295645-77295667 GAGGGGTGTGGGACTGGGGGAGG - Intronic
975745162 4:77468143-77468165 CAGGGTGATGGGACTGAAGAAGG + Intergenic
978072429 4:104490681-104490703 AAGGGGAGAGGGAGTGAGGAGGG + Intronic
978160770 4:105545356-105545378 GAGGGAAATGTCACAGAGGAGGG + Intergenic
979301114 4:119088463-119088485 GAGGGTGATGGGAGGGAGGAGGG - Intergenic
980023459 4:127736656-127736678 GAGGGAACTGGGGCTGAGAAAGG - Intronic
980062479 4:128146637-128146659 GAGGGGAATGGGATTGGGCAGGG + Intronic
980092331 4:128455623-128455645 GAGGGGGAAGGGAAGGAGGAAGG + Intergenic
981159758 4:141483949-141483971 GTGGGGAAGGGGACTGCAGAGGG - Intergenic
981737889 4:147971880-147971902 GAAGGGCATGGGAGTGAGAATGG + Intronic
982162975 4:152588399-152588421 GAGGGCCCTGGGACTGATGAGGG - Intergenic
983010186 4:162537364-162537386 GTTGGGAGGGGGACTGAGGAAGG + Intergenic
983486226 4:168333954-168333976 CTGGGGAATTGGATTGAGGAAGG - Intergenic
983649055 4:170020623-170020645 GAGGGGAATGGGAGGAGGGAGGG - Intronic
984157075 4:176206403-176206425 GAGGAGAATGGGGTTGAGGGAGG + Intergenic
984536623 4:180983848-180983870 CAGTGGAATGGAACTGAAGAAGG - Intergenic
984934960 4:184881948-184881970 GAGAGAAATGGCAGTGAGGATGG + Intergenic
985756652 5:1723479-1723501 GAGGGGAAAGGGAGAGAGGAAGG - Intergenic
985807735 5:2059487-2059509 GATGGGTATGAGAATGAGGAGGG + Intergenic
986354817 5:6913418-6913440 GAAGGGGATGAGTCTGAGGAAGG + Intergenic
986517243 5:8576438-8576460 GAGGGGAAGGTGATTGAGGGAGG - Intergenic
986867431 5:12006478-12006500 GAGGGGGAAGGGAGTGAGGAAGG - Intergenic
988300345 5:29417356-29417378 GAGGGGAATGGAGGTGAGGTTGG - Intergenic
988687056 5:33535547-33535569 GAGAGGAACGGGAATGAGGGAGG + Intronic
988829724 5:34975976-34975998 GAAGGGAATGGGAGTGAAGAAGG + Intergenic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
990167598 5:53011747-53011769 GAGGGGAGTGGTAATAAGGAAGG + Intronic
990589652 5:57249764-57249786 GAGGGGAAGGGGAGAGGGGAAGG - Intronic
991472433 5:66983653-66983675 GAGGGGGAGGGGAATGGGGAGGG + Intronic
991680524 5:69134895-69134917 GAGGGGAGGGGGAATGAGGCAGG + Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
992466078 5:77006357-77006379 TAGGTGAAAGGGAATGAGGAGGG - Intergenic
994796242 5:104304001-104304023 CATGGGAATGGGACTGGGAATGG - Intergenic
995251379 5:109996986-109997008 GAAGGGAATGCAAATGAGGAAGG - Intergenic
995346692 5:111128883-111128905 GAGGATATTGGGACTGAAGATGG - Exonic
996069376 5:119117504-119117526 GAGGGAGATGGGTGTGAGGATGG + Intronic
996199459 5:120653133-120653155 GAGAGGAAAGTGACTGTGGAAGG + Intronic
996334911 5:122372790-122372812 GAGGGGGAAGGGAAAGAGGAGGG - Intronic
997241670 5:132312424-132312446 CAGGTGAAGGGGACTGAGGGCGG - Intronic
997597419 5:135116367-135116389 CAGGGGAATGGGGCTGTGGGCGG - Intronic
998164830 5:139837020-139837042 GAGGGGCATGGGAGGGAGGCTGG + Intronic
998219237 5:140262719-140262741 AATGGGAATGAGACTGGGGAAGG + Intronic
998370112 5:141655477-141655499 GTGGGGAATGGGGGTGAAGAAGG + Intronic
998470331 5:142378757-142378779 GGGGGGCATGGGAGTGAAGATGG - Intergenic
998537801 5:142950964-142950986 GAAGGGAAAGGGAAAGAGGAAGG - Intronic
998580813 5:143373781-143373803 GAGGGGGATGTGACTGGGAAAGG + Intronic
998775239 5:145592316-145592338 AAGGAGAATGACACTGAGGAAGG + Intronic
998868809 5:146532507-146532529 GAGGGGGTTGGGACAGAGGGGGG - Intergenic
999110283 5:149114372-149114394 AAGGGGAATGTGATTAAGGAGGG + Intergenic
999200505 5:149812906-149812928 GAGGGGAATGGGTAAGAGGCAGG + Intronic
999386206 5:151156197-151156219 GAGTTGGATGGGACTGGGGAGGG - Intronic
999448142 5:151657934-151657956 TAAGGGAAGGGGAGTGAGGAAGG - Intergenic
999670862 5:153958165-153958187 GAGGGGGCTGGGACTTAGGGTGG - Intergenic
1000115366 5:158148917-158148939 GAGGGGAAGGGGAGGGAGGGAGG - Intergenic
1000364257 5:160476483-160476505 GATGGGAAGATGACTGAGGACGG + Intergenic
1001111977 5:168904116-168904138 GAGCGGAGTGAGAATGAGGAGGG - Intronic
1001411534 5:171515732-171515754 GGTGGAAATGGGGCTGAGGAGGG - Intergenic
1001447660 5:171798276-171798298 GAGCAGAATGGGACTCAGAAGGG - Intergenic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001971166 5:175956201-175956223 GATGGTAATGTGACTTAGGAGGG - Intronic
1002053576 5:176585725-176585747 GCAGGGAAGGGGACTGAGCATGG + Intronic
1002070904 5:176678480-176678502 GAGGAGGCTGGGACAGAGGAAGG + Intergenic
1002246276 5:177887576-177887598 GATGGTAATGTGACTTAGGAGGG + Intergenic
1002516660 5:179764058-179764080 GATGGGAAGGGGACAGAAGACGG - Intronic
1003153134 6:3569912-3569934 GAGGGGAGAGGGAGGGAGGATGG - Intergenic
1003411355 6:5865614-5865636 GAGGGTAATGAGAGTGGGGAAGG + Intergenic
1003850842 6:10220913-10220935 GAGGGAAATGGCATTGAGAAGGG - Intergenic
1004092634 6:12519848-12519870 GAGGGGAATGGAATTTAGGATGG - Intergenic
1004278486 6:14258843-14258865 GGGAGGGATGGGACTGGGGAGGG + Intergenic
1005293454 6:24401080-24401102 CAGGGTACTGGGACTGGGGATGG - Intergenic
1005403302 6:25458014-25458036 CAGGGGAAAGGGAGTAAGGAGGG + Intronic
1005682927 6:28224921-28224943 TCGGGGAGTGGGACTAAGGAGGG + Intronic
1006171365 6:32095282-32095304 GAGAGGAGTGGGAGTTAGGATGG - Intronic
1006443557 6:34066689-34066711 GAGAGGAACAGGACTGAAGAAGG + Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006795995 6:36732772-36732794 GTGGGGAAAGGGAGTGAGGTTGG - Exonic
1006804702 6:36780433-36780455 GATGGGATTGGGACTGAAGTAGG - Intronic
1007128958 6:39451643-39451665 GAGGGGCATGGCTGTGAGGATGG + Intronic
1007589367 6:43012169-43012191 GAGGGGCCAGGGGCTGAGGAAGG + Exonic
1007775883 6:44223997-44224019 GAGGGGTATGGGGATGGGGATGG + Intronic
1007811753 6:44491201-44491223 GAAGGGGATGGGGCTGGGGAGGG + Intergenic
1007947340 6:45838296-45838318 GAAGGGAATGGGAATGAAGTTGG - Intergenic
1008046043 6:46852257-46852279 GAGAGGTATGGGACAGAGGTGGG - Intergenic
1008092615 6:47308832-47308854 GAGGGTAAAGGGATTGAGGAGGG + Intronic
1009593788 6:65708915-65708937 GAGGGGAATGGGAGAGGGGACGG - Intergenic
1009645578 6:66396387-66396409 GAGGGCAGTGGGACTGAACAAGG + Intergenic
1010376524 6:75176528-75176550 GAGGGCAGTGGGACAGAGAAGGG + Intronic
1010501100 6:76601342-76601364 GAGGGGTAGGGGGCTGGGGAGGG + Intergenic
1010981504 6:82375156-82375178 GTGTGGCATGGGACTGAGGAGGG + Intergenic
1015885201 6:137910686-137910708 AAGGAGGAAGGGACTGAGGATGG + Intergenic
1015955087 6:138590422-138590444 GAGGGGAAAGGGAGAAAGGAGGG - Intronic
1016301808 6:142640118-142640140 GAGGGGAATGTGATTGGGGAAGG + Intergenic
1017009159 6:150051305-150051327 GAAGGGACTGGGATTCAGGAGGG + Intergenic
1017045216 6:150340888-150340910 GAGGGCCATGGGACTCAGCAGGG - Intergenic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017092431 6:150772032-150772054 GAGCAGAATGTGACTGGGGAAGG - Intronic
1017296252 6:152798140-152798162 AAGGGAAATGGGAGTGAGGTTGG + Intergenic
1017457955 6:154619700-154619722 GAAGGGAATATGACAGAGGAAGG + Intergenic
1018178548 6:161200048-161200070 GAAAGGAAGGGCACTGAGGAGGG + Intronic
1018203666 6:161417005-161417027 GAGGGAGATGGGGCCGAGGAAGG + Intronic
1018597300 6:165495346-165495368 GAGGGGAAAGGGAGAGAGAAAGG + Intronic
1018987537 6:168649144-168649166 AAGCCGAGTGGGACTGAGGACGG - Intronic
1019326039 7:438730-438752 GAGGGAGATGGGTCTGTGGAAGG - Intergenic
1019832737 7:3349387-3349409 AAGGGGAATGGGGCTGGGGAGGG + Intronic
1019964026 7:4484479-4484501 GAGAGGAAAGGGAGAGAGGAGGG + Intergenic
1020014910 7:4825202-4825224 GAGGGGAAGGGCACTCAGCAGGG + Intronic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021809509 7:24389885-24389907 GGTGGGAATGGGAGTGTGGAGGG - Intergenic
1021899012 7:25264523-25264545 GAAGGGAGTGAGACTGAGGCAGG + Intergenic
1022339263 7:29453283-29453305 GGTGGGAGTGGGACTGGGGAGGG - Intronic
1022494574 7:30844756-30844778 GAGGGGAAGGGTGCTGAAGAGGG + Intronic
1022516757 7:30979704-30979726 GAGGCGAATGGGAGTGGTGAAGG - Intronic
1023362949 7:39434220-39434242 CAGGGAAATGGGAAAGAGGATGG + Intronic
1023608830 7:41954407-41954429 GAGGGGAAGGGGGCTGGAGATGG + Intergenic
1023649200 7:42350966-42350988 GAAGAGAGTGGGACTGAGGAGGG - Intergenic
1023863123 7:44227158-44227180 GAGGTGCAGGGGACAGAGGAGGG + Intronic
1023880058 7:44313202-44313224 CAGGGGAATGGGACGGAGCGAGG - Intronic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1024641829 7:51335328-51335350 GAGGTGAATGGGGATGAGGTGGG + Intergenic
1025034512 7:55585258-55585280 GTGGGGGATGGGACAGTGGAGGG + Intergenic
1026129444 7:67607951-67607973 GAGAGGAATGGTATTGGGGAGGG + Intergenic
1026361443 7:69604559-69604581 GTGGGGAATGGGACCTAGAAGGG + Intronic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1026969444 7:74459024-74459046 GAAGGGAATGGGACCGAGAATGG - Intronic
1027195511 7:76027314-76027336 GAGGGGAATGGAAGAGGGGAGGG + Intronic
1027224914 7:76237758-76237780 GAAGGGAGAGGGGCTGAGGATGG - Intronic
1028265936 7:88725657-88725679 GAGGAGAATGTGATTGAGGTTGG + Intergenic
1029184737 7:98730438-98730460 GGGGAAGATGGGACTGAGGAAGG + Intergenic
1029436100 7:100564938-100564960 GAGGCGAATGGGCTTGATGAGGG - Exonic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1029577595 7:101413675-101413697 GAAGGGAAGGGAAATGAGGAAGG + Intronic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029846999 7:103422581-103422603 GAGGGAAATGAGACTAAGAAGGG + Intronic
1030099336 7:105931347-105931369 GAGAGGAAGGGGAAAGAGGAGGG - Intronic
1030384077 7:108847445-108847467 GAGGGGAATGGAGGGGAGGAGGG - Intergenic
1030386542 7:108874135-108874157 GAGAGGAATTTGACTGGGGATGG + Intergenic
1030656505 7:112173995-112174017 GTGGGGAAAGGCAATGAGGAAGG - Intronic
1031567121 7:123314199-123314221 GAGGGTTTTGGGACTGGGGAAGG + Intergenic
1031870681 7:127087176-127087198 GAAGGGCCTGGGACTGAGGCTGG - Intronic
1032306370 7:130735463-130735485 AAGGTGAATGGAACTGGGGAGGG - Intergenic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1033361221 7:140640440-140640462 GAGGGAAAGGGGACGGAGGAGGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034112441 7:148550706-148550728 GAGGGGAATGGGAGTGAGTGGGG - Intergenic
1034193589 7:149229144-149229166 TAGGAGAATGAGATTGAGGATGG + Intergenic
1034277613 7:149830556-149830578 GAGGAGGAGGGGACTGTGGAGGG - Intergenic
1034440299 7:151082691-151082713 GAGGGGACGGAGGCTGAGGACGG - Intronic
1034812080 7:154141341-154141363 GATGGGAGTCGCACTGAGGAGGG - Intronic
1034988148 7:155530409-155530431 GAGGGGAGAGGGGCTGAGGGAGG - Intronic
1035696779 8:1603769-1603791 TAAGGGACTGGGGCTGAGGAGGG + Intronic
1035998574 8:4576380-4576402 CTGGGGAATGGGACAGGGGAAGG - Intronic
1036226233 8:6960126-6960148 CAGGAGAATGGCAGTGAGGAGGG + Intergenic
1036808774 8:11853143-11853165 GTGGGGTATGGGACAAAGGAGGG + Intronic
1037097972 8:15008575-15008597 GAGGGGGAGGGGAGGGAGGAAGG + Intronic
1037169416 8:15873919-15873941 GAAGGGAAGGGGAGTGGGGAGGG - Intergenic
1037378067 8:18253370-18253392 TAGGGGGATGGGAGTGGGGATGG + Intergenic
1037636362 8:20704077-20704099 GAGGGGAGTGGGACTTTGAAAGG + Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037760401 8:21738141-21738163 GAGGGGGAGGGGGATGAGGAGGG - Intronic
1037898065 8:22671412-22671434 GAGGGGCACTGGGCTGAGGAGGG + Intergenic
1037947532 8:22998960-22998982 GAGGGGGATGGGATGGAGGTGGG + Intronic
1037994427 8:23342078-23342100 GAGGGGCATGGGCGAGAGGAAGG + Intronic
1038166518 8:25090141-25090163 GAGGGGCATGTGACTGTTGAGGG + Intergenic
1038168399 8:25106635-25106657 CACGAGAATGGCACTGAGGATGG - Intergenic
1038209564 8:25503464-25503486 CTCGGGAATAGGACTGAGGAGGG - Exonic
1038413339 8:27375255-27375277 CAGGGTAAGGGGACTCAGGAGGG - Intronic
1038736575 8:30175007-30175029 GGGTGGAAGGTGACTGAGGATGG - Intronic
1038999313 8:32962228-32962250 TAGGGGAATGAGATTGGGGATGG + Intergenic
1039063642 8:33591833-33591855 GAGGGGACGGGGAGTGAGGTTGG - Exonic
1039567784 8:38563854-38563876 AAGGGGAATGGGGAGGAGGAGGG - Intergenic
1039835569 8:41253741-41253763 GAGGGCAATGGCAGTGGGGAGGG + Intergenic
1039901147 8:41753415-41753437 GAGGGGAAGGGGTCTGGGGGAGG - Intronic
1039913890 8:41845516-41845538 GAGGCCAATGGGACTGACCATGG + Intronic
1040102968 8:43521352-43521374 GAGGAGAATGGGACGGATGATGG + Intergenic
1041330488 8:56719134-56719156 GAAGAGAATGGGAAAGAGGAGGG - Intergenic
1041755139 8:61305325-61305347 GAGGGGAAGGGGAGTGGGAAGGG - Intronic
1042210895 8:66379264-66379286 GAGTGGAATGGGGCTGGGGCTGG + Intergenic
1042220293 8:66466824-66466846 GAGGGGAAGGGCCCTGAGGCAGG + Intronic
1044352870 8:91186813-91186835 GAGGTGGATGGGATGGAGGATGG + Intronic
1044561712 8:93618569-93618591 GAAGGGAAAGAGACTGAGGTTGG + Intergenic
1044569067 8:93698202-93698224 GATGGGAATGGGGCTGGGGGAGG + Intergenic
1045015056 8:97994205-97994227 GAGGGGGAAGGGAAAGAGGAAGG + Intronic
1045723779 8:105146228-105146250 AAGGAGAATGGGAGTGATGAAGG - Intronic
1045824517 8:106381276-106381298 GAGAGGAATGGAAATGAAGATGG + Intronic
1046687039 8:117239281-117239303 GAGGGGAAGGGGGCTGGGAAGGG - Intergenic
1047361490 8:124173280-124173302 GAGGGGAATGGGGCAGATGGGGG - Intergenic
1047414536 8:124653130-124653152 GATGGGAAAGAAACTGAGGAAGG + Intronic
1048320182 8:133393545-133393567 AAGGAGCATGGGTCTGAGGATGG + Intergenic
1048421581 8:134283289-134283311 GTGGGGAATGTGAGTGAGCATGG + Intergenic
1048936759 8:139363992-139364014 GAGTGCATTGGGACTGATGAAGG - Intergenic
1049026036 8:139989581-139989603 GAAAGGAAGGGGAATGAGGAAGG - Intronic
1049281656 8:141752666-141752688 GAGGGGGACGGAAATGAGGAGGG + Intergenic
1049602595 8:143514880-143514902 GACAGGGAGGGGACTGAGGAGGG - Intronic
1049665570 8:143841190-143841212 GAGGGGACAGGGCCTGGGGAGGG - Intergenic
1049884884 9:20075-20097 GAGGGAACTGAGACTGGGGAGGG + Intergenic
1050957323 9:11681267-11681289 GAGGGCAAAGGGTGTGAGGAGGG + Intergenic
1051039741 9:12793148-12793170 GAGGGGGATGAGACAGAGTAGGG - Intronic
1051125466 9:13798510-13798532 GAGGGGTGGGGGACTGAGGGAGG + Intergenic
1053054641 9:34987427-34987449 CAGGACAATGGGACTGAGGGCGG + Intergenic
1053136073 9:35650889-35650911 GCGGGGTACGGGCCTGAGGAGGG - Exonic
1053182264 9:35982892-35982914 GAGAGGAATGTAATTGAGGAGGG - Intergenic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1053651347 9:40173049-40173071 GAGAGGTATGGGACAGAGGTGGG + Intergenic
1053789403 9:41675880-41675902 GAGGGGAATGGTACTGGGGAAGG + Intergenic
1053799557 9:41755713-41755735 GGGGGGAAGGGGTCTGAGAAGGG - Intergenic
1053901740 9:42802402-42802424 GAGAGGTATGGGACAGAGGTGGG + Intergenic
1053946374 9:43312960-43312982 GAAGGGAAAGGGAGGGAGGAAGG + Intergenic
1054155740 9:61638882-61638904 GAGGGGAATGGTACTGGGGAAGG - Intergenic
1054177741 9:61887566-61887588 GAGGGGAACGGTACTGGGGAAGG + Intergenic
1054475508 9:65569883-65569905 GAGGGGAATGGTACTGGGGAAGG - Intergenic
1054533233 9:66203154-66203176 GAGAGGTATGGGACAGAGGTGGG - Intergenic
1054659790 9:67693259-67693281 GAGGGGAACGGTACTGGGGAAGG - Intergenic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055492629 9:76821351-76821373 GAGGTTAATGGGAATGAGAAAGG + Intronic
1055528198 9:77156401-77156423 GGGGGGTAGGGGACTGGGGAAGG + Intergenic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1057073575 9:92121605-92121627 GAGGGGAGTTGGGATGAGGAAGG - Intergenic
1057453080 9:95182885-95182907 CAGGGGAAGGTGACTGGGGAAGG + Intronic
1057572695 9:96216432-96216454 CAGAGGAATGGGACAGGGGATGG + Intergenic
1057725867 9:97567764-97567786 GAAGTGAAGGGCACTGAGGAGGG + Intronic
1057849720 9:98556008-98556030 GAGGGGAAAGGGAGACAGGAGGG + Intronic
1057987307 9:99730195-99730217 GAGTGGAGTGGCACAGAGGAAGG - Intergenic
1058156139 9:101518025-101518047 GAGGAGAAAGGGAGGGAGGAAGG - Intronic
1058773594 9:108263305-108263327 GAAGGGAATGGGAAGGAGCATGG + Intergenic
1058985824 9:110207692-110207714 AAGAGGAGTGGGACTGAGGAAGG + Exonic
1059079661 9:111234693-111234715 GAAGGGATTGGGACTCAGGGAGG - Intergenic
1059336902 9:113574787-113574809 GGTGGGAAGGGGAGTGAGGATGG + Intronic
1059338894 9:113586293-113586315 GAGGGGAATAGAACTGGGAAGGG - Intronic
1059382446 9:113936976-113936998 GAGGGGAATGAGGTTGGGGAAGG - Intronic
1059506494 9:114804048-114804070 GAGGGAAATGGGGGTGAGGCTGG - Intronic
1059526362 9:114994173-114994195 GAGGAGAATTGGACTGATGCAGG + Intergenic
1059730886 9:117055754-117055776 GAGGGCAAGGGGACTGAGGGAGG + Intronic
1059770169 9:117416324-117416346 AAGGGGAATGAGACAGAAGAGGG - Intergenic
1059957716 9:119535609-119535631 GACGGGAATGTGTCTGAGGCTGG + Intergenic
1060860864 9:126953909-126953931 GATGGACATGGGACTGGGGAAGG + Intronic
1061201010 9:129138586-129138608 GTCGGGAAAGGGACTGAGGAGGG - Intronic
1061237660 9:129351937-129351959 GAGGGGGAAGGGACTGCAGAAGG - Intergenic
1061559490 9:131393854-131393876 GAGGGGGCTGGGAGTGGGGAGGG - Intergenic
1062254869 9:135616116-135616138 AAGGGGCATGGGAGTGAGGGGGG + Intergenic
1062350529 9:136136567-136136589 GAATGGAGTGGGGCTGAGGAGGG + Intergenic
1062469611 9:136696830-136696852 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469621 9:136696848-136696870 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469631 9:136696866-136696888 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469653 9:136696910-136696932 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469663 9:136696928-136696950 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469686 9:136696973-136696995 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062562070 9:137146178-137146200 GAGGGGCATGGGCAGGAGGAGGG - Intronic
1062576168 9:137209391-137209413 GAGAGGAGAGGGACTGAGGCTGG + Intronic
1203425663 Un_GL000195v1:34349-34371 CAGGGCTGTGGGACTGAGGAGGG - Intergenic
1203738876 Un_GL000216v2:161748-161770 GTGGGGGATGGGGCTGGGGAGGG + Intergenic
1203589504 Un_KI270747v1:41518-41540 GAAGGGAAAGGGAGGGAGGAAGG + Intergenic
1185532465 X:832899-832921 GAAGGGCATGGGAAAGAGGAGGG + Intergenic
1185581340 X:1213184-1213206 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1185627578 X:1493356-1493378 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1186747212 X:12582541-12582563 GAAGGGAAGGAGACTGAGCAAGG + Intronic
1186829940 X:13379956-13379978 GGGGAGAATGGGACTGAGACAGG + Intergenic
1187182168 X:16953423-16953445 GAGGGGAATGGGACCAGAGAAGG - Intronic
1187245037 X:17546278-17546300 GAGGGGAATGAGACAGAGAATGG - Intronic
1187650432 X:21397575-21397597 GATGGGAAGGGGAGTGGGGATGG + Intronic
1187831708 X:23389075-23389097 CTGGGGAATGGGACAGAGAATGG - Intronic
1187966825 X:24620323-24620345 GAGGGGATGGGGACAGGGGAGGG - Intronic
1188221221 X:27543786-27543808 GTGGAGAATGGGACTGAGACAGG + Intergenic
1188770554 X:34148063-34148085 GAGGGGAATGAGATTGGGCAGGG + Intergenic
1189012754 X:37063130-37063152 GAAGGGAATGGGATTGGGCAGGG - Intergenic
1189014015 X:37077347-37077369 CAGGGGAATGGGATTGGGCAGGG - Intergenic
1189068941 X:37844338-37844360 CTGGGGAATGGGACTGGGGATGG - Intronic
1189345434 X:40237618-40237640 GATGGGAATGGGGCTGGGGGAGG - Intergenic
1189461275 X:41244953-41244975 GAAGGGAATGGAATGGAGGATGG - Intergenic
1189921434 X:45906649-45906671 GAGGGGAATAGAACTGAGGCAGG - Intergenic
1189976418 X:46464795-46464817 TAGGGAATTGGGACTCAGGAGGG - Intronic
1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG + Intronic
1190222402 X:48520831-48520853 GAGGGGAATAGGAATGAGTGAGG + Intergenic
1190303777 X:49071312-49071334 GAGGCAAATGGGACTGGTGAGGG + Exonic
1190690825 X:52911631-52911653 GAGAGGATTGGGACAGAGAAAGG + Intergenic
1190695158 X:52944161-52944183 GAGAGGATTGGGACAGAGAAAGG - Intronic
1191156783 X:57283104-57283126 GATGGGAAGGGGATTGCGGAGGG + Intergenic
1191180192 X:57553936-57553958 GAGGGGGAAGGGTGTGAGGAGGG + Intergenic
1191795355 X:65016120-65016142 AAGGGGAATGGGTATTAGGAAGG - Intronic
1192275795 X:69629707-69629729 GGAGGGAAAGGAACTGAGGAAGG - Intronic
1194813798 X:98418017-98418039 GAGTGGAATGGGGCTGGGGTTGG - Intergenic
1194897723 X:99466579-99466601 GAGGGGAATGTGAGGAAGGAGGG + Intergenic
1195366957 X:104135563-104135585 GAGGGCAATGGCAGTGAGTATGG - Intronic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1196753281 X:119136465-119136487 GAAGGGAATGGGCATAAGGAGGG + Intronic
1197249523 X:124200439-124200461 AAGGGAAATGGGAATGGGGAAGG - Intronic
1197646162 X:129019426-129019448 GCTGGGAATGGTAGTGAGGAGGG - Intergenic
1197887576 X:131234616-131234638 GAGGAGAAGGTGTCTGAGGAGGG - Intergenic
1198058595 X:133020803-133020825 GGGGAGAATGGGACTGAGACAGG + Intergenic
1198075630 X:133190557-133190579 GAGGGGAAGGGGTCCCAGGATGG + Intergenic
1198242031 X:134796602-134796624 GAGAGGAAGGGGGCGGAGGAGGG + Intronic
1199086743 X:143636220-143636242 GAGGGGAGTTTGACTGGGGAAGG + Intergenic
1199394492 X:147318818-147318840 TAGGAGAATGGGATTGAGGAAGG - Intergenic
1199601697 X:149544976-149544998 TAGGGGAAGGGGCTTGAGGAAGG + Intronic
1199666888 X:150103466-150103488 GAGGGCAATGGTGCTAAGGAGGG + Intergenic
1199846718 X:151697024-151697046 GAAGGGAAGGGGAGGGAGGAAGG - Intronic
1199872564 X:151912620-151912642 GAAGGGAATGGGAATGGGGTGGG - Intronic
1199874480 X:151919986-151920008 GATGGGAATGGGAAGGGGGATGG - Intronic
1200017830 X:153179680-153179702 GTGGGGAATGGGAATGCGAATGG - Intronic
1200110748 X:153739731-153739753 GAGTCGGATGGGACTGAGGACGG + Intronic
1200249079 X:154542594-154542616 GAGGAGGAAGGGACAGAGGAAGG + Intronic
1200845874 Y:7831819-7831841 GAGGGGAGTGGCCCTGATGAGGG + Intergenic
1201010227 Y:9544437-9544459 CAGGGCAGTGGGAGTGAGGATGG + Intergenic
1201374935 Y:13309034-13309056 GGGGGAAATGTGACTGTGGATGG + Intronic
1201702555 Y:16900472-16900494 GAGGGAAATGGGAAGGAGGGAGG - Intergenic