ID: 950266246

View in Genome Browser
Species Human (GRCh38)
Location 3:11575213-11575235
Sequence CTGTGGTGCGAGAGGGAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 456}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950266237_950266246 18 Left 950266237 3:11575172-11575194 CCTGCTGCCAATGCCCGGAGGGT 0: 1
1: 0
2: 1
3: 3
4: 108
Right 950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG 0: 1
1: 0
2: 1
3: 31
4: 456
950266240_950266246 4 Left 950266240 3:11575186-11575208 CCGGAGGGTTTCAAAAGCAGCTC 0: 1
1: 0
2: 1
3: 23
4: 154
Right 950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG 0: 1
1: 0
2: 1
3: 31
4: 456
950266231_950266246 27 Left 950266231 3:11575163-11575185 CCTTGCTCCCCTGCTGCCAATGC 0: 1
1: 0
2: 0
3: 28
4: 327
Right 950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG 0: 1
1: 0
2: 1
3: 31
4: 456
950266233_950266246 20 Left 950266233 3:11575170-11575192 CCCCTGCTGCCAATGCCCGGAGG 0: 1
1: 0
2: 0
3: 22
4: 156
Right 950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG 0: 1
1: 0
2: 1
3: 31
4: 456
950266239_950266246 5 Left 950266239 3:11575185-11575207 CCCGGAGGGTTTCAAAAGCAGCT 0: 1
1: 0
2: 1
3: 24
4: 209
Right 950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG 0: 1
1: 0
2: 1
3: 31
4: 456
950266235_950266246 19 Left 950266235 3:11575171-11575193 CCCTGCTGCCAATGCCCGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 106
Right 950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG 0: 1
1: 0
2: 1
3: 31
4: 456
950266238_950266246 11 Left 950266238 3:11575179-11575201 CCAATGCCCGGAGGGTTTCAAAA 0: 1
1: 0
2: 0
3: 6
4: 46
Right 950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG 0: 1
1: 0
2: 1
3: 31
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950266246 Original CRISPR CTGTGGTGCGAGAGGGAAGG CGG Intronic
900810314 1:4796843-4796865 CTGTACTGCAGGAGGGAAGGAGG + Intergenic
900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG + Exonic
901239236 1:7683451-7683473 CGGAGGTGGGAGAGGGTAGGTGG - Intronic
901494155 1:9611900-9611922 CTGAGGTGCGGGAGGGGAGGGGG + Intronic
901642493 1:10699699-10699721 CTTTGGAGGGAGAGAGAAGGAGG + Intronic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
902161241 1:14532088-14532110 AAGTGGTGCAAGAAGGAAGGTGG + Intergenic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
902917502 1:19647542-19647564 GTGTGGGGGGAGAGGAAAGGTGG + Intronic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
905158359 1:36008345-36008367 TTATGCTGGGAGAGGGAAGGAGG - Intronic
905380534 1:37558613-37558635 CTGTGGTAGGAGAGTGAATGAGG - Intronic
905427180 1:37895498-37895520 CTGTGGGGAGAGAGAGAGGGAGG - Intronic
905793372 1:40802006-40802028 CTATGATGGGAGGGGGAAGGGGG + Intronic
906124594 1:43419957-43419979 CTGAGGTGGGTGTGGGAAGGAGG + Intronic
906745319 1:48217280-48217302 CTGTGGTTCGAGGAGGGAGGAGG - Intergenic
907158351 1:52354303-52354325 CTCAGGTCCGAGAGGAAAGGGGG - Intronic
907852084 1:58265054-58265076 ATGTGTTGGGAAAGGGAAGGAGG + Intronic
908398368 1:63746858-63746880 CTGAAGTGCAAGAGAGAAGGCGG - Intergenic
909169982 1:72282754-72282776 GTGTGGTGCCAGGGGGAGGGAGG - Intergenic
910121932 1:83799628-83799650 GTGTGATGGGAGAAGGAAGGGGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912947110 1:114094479-114094501 CTCTGGGCTGAGAGGGAAGGGGG + Intronic
913301009 1:117368244-117368266 CTGTGATGTGGGAAGGAAGGCGG - Exonic
913389647 1:118296202-118296224 GTGTGTTGTGGGAGGGAAGGTGG - Intergenic
914228043 1:145738264-145738286 TTCTGGTGGGAGTGGGAAGGGGG - Intronic
915148193 1:153808110-153808132 AAGTGGTGGGAGAGGGAGGGGGG - Exonic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
916122296 1:161539296-161539318 CTGTCGTGGGTGGGGGAAGGAGG + Intergenic
916462760 1:165044374-165044396 CTGTGGTAGGAGAGGAAAGTAGG - Intergenic
916783767 1:168067022-168067044 CTGGGATGGGAGAGGGAAGGTGG + Intronic
916802299 1:168226398-168226420 CTGAGCTGCGAGTGGGAGGGTGG + Intronic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
917192227 1:172430122-172430144 CTGTGGTGTGTGTGGGAAAGGGG - Intronic
917325075 1:173824088-173824110 TTGTGGAGCGAGAGGGAATTTGG - Intronic
918004244 1:180526769-180526791 CAGTGGTGTGGGAGAGAAGGGGG + Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918407367 1:184224166-184224188 GGGTGGAGAGAGAGGGAAGGAGG - Intergenic
918760099 1:188393249-188393271 ATGTGGTGCGGGGGGGACGGAGG - Intergenic
919662491 1:200260847-200260869 CTGTGGTGGGAGGGGAGAGGAGG + Intergenic
919890934 1:201973814-201973836 CTGTGGTGCCAGATTGAAGTTGG - Intergenic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
923462671 1:234220698-234220720 CTGTGGTGAGAGTGTGAAGTAGG + Intronic
923783697 1:237048047-237048069 CTGGGGTCCGAGAGGCAAGAGGG - Intronic
1062952730 10:1516732-1516754 CTGTGATGCGACAGAGATGGGGG + Intronic
1063123298 10:3119849-3119871 TTGTGGGGCGAGAGGGAAGCTGG - Intronic
1065774237 10:29104585-29104607 CTGTGGTGTGAGATGGACAGTGG + Intergenic
1065794080 10:29290440-29290462 CTGGGGAGCAAGAGGGATGGAGG - Intronic
1065948479 10:30628364-30628386 CTGGGGAGCAAGAGGGATGGAGG + Intronic
1066329795 10:34407926-34407948 CTGTGGTGAGAGATGGAGGCAGG - Intronic
1067255170 10:44630721-44630743 GTGTGGAGCAAGAAGGAAGGGGG + Intergenic
1067515584 10:46938783-46938805 CTGTGATCCCAGAGAGAAGGGGG - Intronic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067646667 10:48113032-48113054 CTGTGATCCCAGAGAGAAGGGGG + Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1068716826 10:60198173-60198195 CTGTGGTGGGAGAGGGTAACTGG - Intronic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069224751 10:65929022-65929044 CTGTTGTGGGTGAGGGGAGGGGG - Intronic
1069559528 10:69419744-69419766 CTGTGGTGTGTGAGAGAAGTGGG + Intergenic
1070169209 10:73920094-73920116 CTGAGGTGGGAGAGGGCAGAGGG - Intronic
1071301796 10:84261589-84261611 TTGTGGGGTGAGTGGGAAGGAGG - Intergenic
1071344066 10:84674640-84674662 CTGTGGTGAGAGAGGAAGTGAGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071880099 10:89888062-89888084 CTGTGATGCTAGAGGCAAGACGG - Intergenic
1072015993 10:91347080-91347102 CTGTGGTTGGAGTGAGAAGGAGG - Intergenic
1072360750 10:94656820-94656842 CTGTGGTGCGGTGGGGGAGGGGG - Intergenic
1073067290 10:100770205-100770227 CTGTGGTGGGACAGGGTTGGGGG + Intronic
1073143941 10:101266863-101266885 CTGGGGTGAGAGAGGGAATGGGG - Intergenic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1074627724 10:115211758-115211780 CTGTTGTGGGTGAGGGGAGGGGG - Intronic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1074898653 10:117798054-117798076 CTTTGGTGCCCGAGGGAAGAGGG - Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075403763 10:122180266-122180288 CTGAGGTGGGAGGGGGAAGGAGG - Intronic
1075709123 10:124521342-124521364 CTGAGGTGCCAGAGGGCTGGGGG - Intronic
1076149286 10:128149891-128149913 CTGGGGTGCGGGCGGGAACGCGG - Intergenic
1076286838 10:129307728-129307750 CTCTGGTGAGAGAGAGAAGGTGG + Intergenic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076883376 10:133250203-133250225 CGGTTCTGCAAGAGGGAAGGAGG + Intergenic
1077223383 11:1427118-1427140 CTGTGGGGAGAGAGGGGATGGGG - Intronic
1077663646 11:4090419-4090441 CTGTGGTGCGGCAGGAAGGGTGG - Intronic
1077853194 11:6095794-6095816 CTGAGGGGCGAGTGGGAAGTGGG + Intergenic
1078379041 11:10823054-10823076 CAGTGTTGGGAGAGGGAAAGAGG + Intronic
1082018954 11:47514973-47514995 CTGTGGTGAGAGCTGGGAGGTGG + Intronic
1082870005 11:57935570-57935592 ATGTGGTGAGAGAGAGCAGGAGG + Intergenic
1083891185 11:65596514-65596536 GTGTGGTGGGAGAGGAATGGTGG + Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084157367 11:67321409-67321431 CTGTGGAGCGGGAGTGAAGTGGG - Intronic
1084313774 11:68331961-68331983 CTGGGCTGGGAGAGGGCAGGTGG + Intronic
1084314458 11:68336882-68336904 TTGTGGTGGGAGATGGATGGTGG - Intronic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084856848 11:71994901-71994923 CTGTAGTGAGAGAGAGAAAGAGG + Intronic
1085440224 11:76554953-76554975 CTGTAGTGCGAGAGGCATGGTGG + Intergenic
1085475930 11:76788926-76788948 CTGTGGGGTGAGAGGCCAGGAGG + Intronic
1086520244 11:87661009-87661031 CTGGAGTGGGAAAGGGAAGGGGG - Intergenic
1086949995 11:92882433-92882455 CTGAGGTGGGAGAGGAGAGGAGG - Intronic
1087439885 11:98170018-98170040 CAGTGGGGTGAGAGGGATGGGGG + Intergenic
1088094441 11:106081852-106081874 CTGTTGTGGGTGGGGGAAGGGGG + Intronic
1089364965 11:117915843-117915865 CTGTAGTGGGAAAGGGAGGGAGG + Intronic
1089497783 11:118916443-118916465 CTGGGGTGAGAGTGGGATGGTGG - Intronic
1090080423 11:123608906-123608928 CTGAGGTGGCCGAGGGAAGGAGG - Intronic
1090351259 11:126110037-126110059 CTGTGGTGTGAGAGAGGAGGAGG - Intergenic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091826498 12:3516796-3516818 CTAAGGGGCGAGGGGGAAGGTGG - Intronic
1092132854 12:6124636-6124658 TTGTGGTGGGAAAGGGAGGGTGG - Exonic
1093178678 12:15943383-15943405 CTGTGGTGCGAAAGTCAAGTAGG - Intronic
1093854501 12:24084018-24084040 CTGCAGTGCAAGAGGAAAGGAGG + Intergenic
1093863274 12:24194260-24194282 CTGTGGGGGGTGATGGAAGGTGG + Intergenic
1096199472 12:49671433-49671455 CTGAAGTGTGATAGGGAAGGAGG + Intronic
1096427022 12:51512567-51512589 CTGTGGTGAAAGAGTCAAGGTGG + Exonic
1097697192 12:62786324-62786346 CTGAGGCGGGAGAGGAAAGGAGG + Intronic
1099373863 12:81872077-81872099 ATGTGATGTGAGAGAGAAGGAGG - Intergenic
1099808688 12:87553034-87553056 CTGTGGTGCTTGGGGAAAGGAGG - Intergenic
1101328738 12:103740322-103740344 CTGGGGAGGGAGTGGGAAGGAGG - Intronic
1102315266 12:111882450-111882472 CTGTGGTGTGAGGGGGAGTGTGG + Intronic
1102520778 12:113476552-113476574 CAGGGATGCGAGAGGGATGGCGG + Intergenic
1103159619 12:118717998-118718020 CTGGGGTGAGAAAGGGGAGGAGG - Intergenic
1103818414 12:123677697-123677719 CTGTGGTGCAGGGGAGAAGGTGG - Intronic
1104013276 12:124947026-124947048 CTGAGGTGGGAGGGGGAGGGTGG - Exonic
1104226274 12:126837692-126837714 CTCAGGTGCGAAGGGGAAGGAGG + Intergenic
1104958543 12:132477426-132477448 CTGTGGTGGGGGAGGGGTGGGGG - Intergenic
1105063192 12:133172777-133172799 CTGGGATGTGAGAGGGAAGCAGG + Intronic
1105648253 13:22344723-22344745 CTTTGGTCGGAGAAGGAAGGCGG - Intergenic
1105649994 13:22366632-22366654 CAGAGGTGGGAGAGGGTAGGGGG + Intergenic
1107361426 13:39621758-39621780 CTGTGGTCTGAGAGGGTAGTTGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112384878 13:98930393-98930415 CTGTTGTGTGTGACGGAAGGAGG - Intronic
1114347742 14:21814484-21814506 CTGTTGTGGGTGGGGGAAGGGGG + Intergenic
1115399412 14:32939792-32939814 CTGGGGAGGGGGAGGGAAGGCGG + Intronic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1117857166 14:60047304-60047326 GTGTGGTGAGAGACTGAAGGAGG + Intronic
1119273161 14:73327896-73327918 GTGTGGTGGGGGAGGGCAGGCGG - Intronic
1120813155 14:88825291-88825313 CTGTTGTCCAAGAGTGAAGGAGG + Intronic
1121563673 14:94893176-94893198 CCGGGGTGGGAGGGGGAAGGGGG - Intergenic
1122289419 14:100672186-100672208 CTGTGGCACAAGAGGGCAGGAGG - Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1123152841 14:106199407-106199429 CTGTTGTGAGAGAGGTGAGGGGG + Intergenic
1124600178 15:31127488-31127510 ATGTGGTGAAAGTGGGAAGGTGG + Intronic
1125576204 15:40757315-40757337 CTGTGGAGGGGGTGGGAAGGTGG - Intergenic
1126364257 15:47877562-47877584 CTATTGTGGGACAGGGAAGGGGG - Intergenic
1126817310 15:52466537-52466559 CTGGGGTGTAAGAGGGAAGCAGG + Intronic
1127351915 15:58161530-58161552 TTTTGGTGAGAGAGGGAAAGCGG - Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127856771 15:62960017-62960039 CTGTGGGGAGAGGGGGATGGGGG + Intergenic
1128349190 15:66877778-66877800 CTGTGCTGGGACAGGGAGGGTGG + Intergenic
1128451900 15:67810714-67810736 CTGTGGTGTGGGACGGTAGGAGG + Intergenic
1128542125 15:68543528-68543550 CTGGGGTGGGAGGAGGAAGGAGG - Intergenic
1128549399 15:68588507-68588529 CTGTGGAAGGCGAGGGAAGGTGG + Intronic
1128562222 15:68676438-68676460 CTGAGGTGCCAGAGGGTAAGGGG + Intronic
1129445764 15:75616758-75616780 CTGTGGTACCATAGGGAAAGAGG - Intronic
1130513748 15:84609946-84609968 CTATGGTGCGGGAGAGAAAGAGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1131539014 15:93260640-93260662 CTGAGGTGCCAGAGGGCACGCGG + Intergenic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132590181 16:723162-723184 CTGTGAGGGGAGAGGAAAGGAGG + Intronic
1132982369 16:2745026-2745048 CTGGGGTGGGACAGGTAAGGGGG + Intergenic
1133925579 16:10189501-10189523 CTTTGGTGTGAGTGGGAGGGAGG - Intergenic
1134572777 16:15305947-15305969 CTGTGGTGGGATAGGGATGGGGG - Intergenic
1134638127 16:15808188-15808210 CTGTGGTGTGACTGTGAAGGTGG + Intronic
1134640306 16:15824689-15824711 CTGTGGTCCAGGAGGGAGGGAGG + Intronic
1134937830 16:18261817-18261839 TTGTGGTGGGATAGGGATGGGGG - Intergenic
1136089126 16:27905855-27905877 CAGGGGTGGGAGTGGGAAGGTGG - Intronic
1136238882 16:28932323-28932345 CTGTGGAGAGAGAGGGAGAGAGG - Intronic
1136366356 16:29810983-29811005 CTGGGGTGGAAGAGGGGAGGGGG - Exonic
1137253455 16:46757042-46757064 GTGTGGTGCGGGCGGGGAGGTGG - Intronic
1137731183 16:50691750-50691772 CTCTGGTGCCAGAGGAAAGGGGG + Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1138272015 16:55702198-55702220 CTGAGGTCCGTGAAGGAAGGGGG + Intronic
1140232822 16:73131983-73132005 CTGTGATGCAAGAGGGATGAGGG + Intronic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1141013650 16:80427058-80427080 CAGTGGTGGGAAAGGGAGGGAGG - Intergenic
1141461370 16:84180345-84180367 CTGGGGCCCGAGAAGGAAGGGGG + Intronic
1142094938 16:88234495-88234517 CTGCGCTGCGAGATGGGAGGTGG - Intergenic
1142153553 16:88523227-88523249 CTGGGGAGCAAGGGGGAAGGGGG - Intronic
1142260733 16:89041434-89041456 CTGTGGTGTCAGAGAAAAGGAGG - Intergenic
1142271397 16:89091463-89091485 ATGTGGTGTGGGAGGGAAGCAGG + Intronic
1142476749 17:193460-193482 CTGTGGTGGGAGTGGGGAGATGG - Intergenic
1142876549 17:2854575-2854597 CGGTGGGGCGAGAGGGTGGGTGG - Intronic
1142978219 17:3657511-3657533 GTGTGAAGCGAGAGTGAAGGTGG + Intronic
1143447466 17:7017928-7017950 CTGTGGTGTTAGAGCGAGGGTGG - Intergenic
1143594690 17:7907270-7907292 CTGTGGAGCGGGAGGGGAGGGGG + Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1146272980 17:31496659-31496681 CTGGGGTGGGAAAGGGGAGGAGG + Intronic
1146806486 17:35868833-35868855 CTGTGGTACGAGAGGTACAGGGG + Exonic
1147185867 17:38712828-38712850 CTGGGGTGGCAGAGGGAGGGAGG + Intronic
1147442721 17:40457299-40457321 CTGCTGTGGGAGAGCGAAGGGGG + Exonic
1148698090 17:49573119-49573141 CTGGGGTGCTAGAGGTATGGAGG - Intergenic
1148768168 17:50051481-50051503 GTGTGGGGCGAGAGGGATGCTGG - Intergenic
1148820388 17:50356488-50356510 CTGGAGTGGGAGAGGCAAGGAGG - Intronic
1148955160 17:51347579-51347601 CTGTGGTGAGAAAGGACAGGTGG - Intergenic
1149524196 17:57341151-57341173 CTGGGGTGGGCCAGGGAAGGAGG + Intronic
1149755666 17:59183332-59183354 GTCTGGTGGGAGAGGGAGGGTGG + Intronic
1150289133 17:63971670-63971692 CTGGGGTGGGTGAGGGGAGGGGG - Intronic
1151446212 17:74166003-74166025 CTGTGGTGGGAGGGAAAAGGGGG + Intergenic
1151476148 17:74345245-74345267 CTCTGGTGGGAAGGGGAAGGAGG + Intronic
1151577133 17:74958506-74958528 CTCGGGTGGGAGGGGGAAGGAGG + Intronic
1152277347 17:79365832-79365854 CTGCTGCCCGAGAGGGAAGGGGG + Intronic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152423272 17:80205294-80205316 GCGTGGTGGGGGAGGGAAGGAGG - Intronic
1152502357 17:80720903-80720925 GTGTGGTGTGAGAGGCAAGCAGG + Intronic
1153434955 18:5059184-5059206 GTGTGGTGAGGCAGGGAAGGAGG - Intergenic
1153711582 18:7805299-7805321 CTGTGGTGAGAGTGTGAACGTGG - Intronic
1153975804 18:10267646-10267668 CTCTGGTGGGAGAGGAATGGCGG + Intergenic
1156376534 18:36519708-36519730 CTGAGGTAAGAGAGGGAAGCTGG + Intronic
1156474703 18:37398137-37398159 CTGTTGGGAGAGAGTGAAGGAGG + Intronic
1157430040 18:47617142-47617164 CTGTCATGCAAGGGGGAAGGAGG + Intergenic
1158796882 18:60856949-60856971 CGGTGGGGGGAGAGGGGAGGAGG - Intergenic
1160051841 18:75440966-75440988 GTGTGGTGAGGGAGGGATGGAGG + Intergenic
1160503960 18:79417089-79417111 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160503987 18:79417181-79417203 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160503994 18:79417205-79417227 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504006 18:79417246-79417268 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504018 18:79417287-79417309 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504031 18:79417335-79417357 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504043 18:79417375-79417397 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504055 18:79417416-79417438 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504062 18:79417440-79417462 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504075 18:79417488-79417510 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504087 18:79417528-79417550 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504099 18:79417569-79417591 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504111 18:79417610-79417632 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504124 18:79417658-79417680 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504136 18:79417698-79417720 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504143 18:79417722-79417744 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504155 18:79417763-79417785 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504167 18:79417804-79417826 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504180 18:79417852-79417874 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504192 18:79417892-79417914 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504199 18:79417916-79417938 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160774029 19:846597-846619 CTGTGGTCCTAGAGGGGAGTGGG - Intronic
1161046337 19:2136755-2136777 AGGTGGTGAGCGAGGGAAGGGGG + Intronic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161346477 19:3770962-3770984 GGAGGGTGCGAGAGGGAAGGGGG + Intronic
1161437514 19:4272759-4272781 GTGGGGTGTGAGAGGGGAGGAGG - Intergenic
1161821587 19:6533667-6533689 CTCTGGAGGGAGAGGGAAGGGGG - Intronic
1162057072 19:8071260-8071282 GGGTGGCCCGAGAGGGAAGGAGG + Intronic
1163558971 19:18007983-18008005 CCGGGGTCCGCGAGGGAAGGGGG + Intronic
1164329329 19:24237220-24237242 CTGTTGTGGGTGGGGGAAGGGGG + Intergenic
1165095951 19:33410066-33410088 CTGTGGTGCCAGAGTGAACCAGG + Intronic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165313003 19:35039921-35039943 CTGGGGTGGGAGGGGGCAGGGGG + Intronic
1165711161 19:38011951-38011973 CTGTGGAGGATGAGGGAAGGAGG + Intronic
1166737760 19:45096251-45096273 GTGAGGTGCGAGGGGGAAGATGG + Intronic
1166790451 19:45395913-45395935 ATCGGGTGAGAGAGGGAAGGTGG + Intronic
1167284036 19:48588853-48588875 CTGAGGTGCAAGAGGGAGGTCGG + Intronic
1167414537 19:49363144-49363166 CTTTGGTGCCTGAGGGAAGATGG + Intronic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1168474673 19:56667316-56667338 TGGTGCTGAGAGAGGGAAGGAGG + Intronic
926119269 2:10232738-10232760 CTGTGTTGTGGGAGAGAAGGTGG + Intergenic
926572193 2:14541885-14541907 GTGTTGTGGGAAAGGGAAGGGGG + Intergenic
926985188 2:18614794-18614816 TTGTGGTGGGAGAGGAATGGGGG - Intergenic
927083531 2:19653227-19653249 CTTGGGTGAGAGAGAGAAGGAGG + Intergenic
927507222 2:23622369-23622391 CTGTGATGTGAGCGGGATGGTGG - Intronic
929524911 2:42693113-42693135 GTGTGGGGAGAGAAGGAAGGAGG - Intronic
930948726 2:57110395-57110417 TTGTTGTGCGTGAGGGAATGGGG + Intergenic
931464845 2:62477015-62477037 CTGGGGAGAGAGAGGGAAGGAGG + Intergenic
931683079 2:64768734-64768756 GTGTAGGGAGAGAGGGAAGGAGG - Intergenic
932106016 2:68943762-68943784 CTGTGGTGCAAGGGGGAGAGGGG + Intergenic
932174351 2:69585969-69585991 GGGTGGTGCCAGAGGGAAGGTGG - Intronic
932220534 2:69995674-69995696 CTGTGGTGGGAGCAGGAAGAGGG + Intergenic
932274448 2:70441659-70441681 CTGTGGTGGGGGGGGGAGGGGGG - Intergenic
933935772 2:87202720-87202742 TTGTTGTGGGAGGGGGAAGGCGG + Intergenic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934554130 2:95278490-95278512 CAATGGTGGGAGAGGGATGGGGG + Intronic
935418933 2:102846461-102846483 CTGGGGTGTGAGTGTGAAGGCGG + Intergenic
935572441 2:104676128-104676150 CTGTGGTCCAAGAGGGATCGGGG + Intergenic
935734105 2:106092517-106092539 TTGTGGTGTGAGAGAGAAAGAGG - Intergenic
936357376 2:111763110-111763132 TTGTTGTGGGAGGGGGAAGGCGG - Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
936939697 2:117871458-117871480 CTGTTGTGGGTGGGGGAAGGGGG - Intergenic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
939967418 2:148624069-148624091 GTGTGGTGGGAGAGGGAGAGAGG - Intergenic
940379211 2:152995096-152995118 GTGTGGTGTGAAAGAGAAGGAGG + Intergenic
940945951 2:159617376-159617398 ATGGGGTGCGGGAGGGAATGGGG - Intergenic
942132563 2:172895040-172895062 TTCTGGTGTGTGAGGGAAGGTGG + Intronic
943016558 2:182517573-182517595 CTGTGGTTGAATAGGGAAGGTGG + Intronic
944276559 2:197845507-197845529 GTGTGGAGGGAGAGGGAATGAGG + Intronic
944766165 2:202866290-202866312 GCATGGTGAGAGAGGGAAGGGGG - Intronic
945139330 2:206667209-206667231 ATGAGGTCAGAGAGGGAAGGGGG - Intronic
945333929 2:208569750-208569772 CTGAGGTGTGAGAGGAAAGCAGG + Intronic
945348281 2:208746635-208746657 CTGTTGTGGGGGGGGGAAGGGGG - Intronic
945989263 2:216380170-216380192 CTGGGATGCGACAGGCAAGGAGG - Intergenic
947639163 2:231696642-231696664 CTGTGGTGCGTGAGGGGACAGGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948524242 2:238560423-238560445 GTGTGCTGGGAGAGGGAGGGTGG - Intergenic
1168854294 20:997991-998013 CTGCAGTCCAAGAGGGAAGGGGG - Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170574615 20:17652965-17652987 CTGTGGTGCCCGAGGGTATGAGG - Intronic
1170690100 20:18606772-18606794 CTGTGGTGGGGGGGGGGAGGGGG + Intronic
1170811303 20:19677379-19677401 CTGTAGAGCGACAGGGAAAGAGG - Intronic
1171973175 20:31577177-31577199 CTGAAGTGCGGGAGGGGAGGTGG + Intronic
1172484696 20:35291209-35291231 ATGTGGTGCAGGAGGGTAGGGGG + Intronic
1172771733 20:37386182-37386204 CTGAGGGGCAATAGGGAAGGGGG - Intronic
1173180538 20:40803426-40803448 CTGTGTTGGGAGTGGGCAGGGGG - Intergenic
1173182041 20:40813084-40813106 CTGGGATGGGAGAGGGATGGTGG + Intergenic
1173279872 20:41618436-41618458 CAATGGCGCGACAGGGAAGGCGG - Exonic
1173666352 20:44766074-44766096 CTGTGGTGGGGGAGGGACAGGGG + Intronic
1173960955 20:47072171-47072193 CTGTTGTGCCTGTGGGAAGGAGG - Exonic
1174180197 20:48669571-48669593 ATGTGATGGGAGAGGGGAGGAGG + Intronic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1176037135 20:63045107-63045129 CTGAGGTGGGAGAGGGGAGGAGG - Intergenic
1179101770 21:38360652-38360674 ATGTTGTGGGAGAGGGCAGGTGG + Intergenic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180706416 22:17812984-17813006 GTGGGGTGCGGGAGGAAAGGGGG + Intronic
1181473346 22:23154101-23154123 CTGGGGTGGGAGAGGGTAAGGGG - Intronic
1181712693 22:24700541-24700563 ATTTGGTGACAGAGGGAAGGAGG - Intergenic
1181807806 22:25385585-25385607 CTGGGCTGGGAGAGGGCAGGTGG - Intronic
1182142708 22:27975573-27975595 CTGTCGTGCGGGAGGCAAGGCGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182446588 22:30393242-30393264 CTGTGGTGCCAGGGGGAAGGGGG - Intronic
1183343667 22:37295351-37295373 GTGTGGTGGGGGAGGGGAGGAGG - Intronic
1183360163 22:37379232-37379254 CTGGGCTGCGGGAGGGAAGCAGG - Intronic
1183483872 22:38079018-38079040 CTGGGGTGGGAGCGGGGAGGGGG + Intronic
1183543791 22:38444782-38444804 CTGAGGAGCCAGTGGGAAGGTGG - Intronic
1183553445 22:38506804-38506826 CGGTGGGGCGAGAGGGCTGGCGG - Intronic
1184207345 22:43013929-43013951 CTTGGGTGCCTGAGGGAAGGTGG - Intronic
1184711094 22:46250015-46250037 CTGGGGCGAGAGAGGGCAGGCGG - Intronic
1185212364 22:49577476-49577498 CTGTGGGGAGAGAGGGACTGTGG - Intronic
949539298 3:5019939-5019961 CTGTGGCCAGAGAGGAAAGGGGG - Intergenic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950499621 3:13355355-13355377 CTGTGGAGAGAAAGGGAATGTGG - Intronic
950751907 3:15135841-15135863 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
951140197 3:19148869-19148891 CGCTGGTGCAAAAGGGAAGGTGG - Intronic
952401236 3:32966043-32966065 CTGTAGTGCAGAAGGGAAGGTGG + Intergenic
953532653 3:43752449-43752471 CTGTTGAGCGAGAGGGAATACGG + Intergenic
954704325 3:52471110-52471132 CTGTGGTGGGTGCTGGAAGGTGG + Intronic
955324452 3:57999207-57999229 CTGTGGTAAGAGAATGAAGGCGG - Intergenic
956705572 3:71996176-71996198 TGGGGGTGGGAGAGGGAAGGAGG - Intergenic
961284707 3:125791857-125791879 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961414797 3:126749394-126749416 CTGTGGGGTGAGAAAGAAGGAGG + Intronic
961530170 3:127535855-127535877 CTGTGGTGAGAGAGAGGAGCAGG - Intergenic
961746209 3:129064977-129064999 CTGTGGTGGGAGAGGCACTGAGG - Intergenic
961785801 3:129345934-129345956 CTCCAGTGGGAGAGGGAAGGTGG - Intergenic
962237843 3:133723802-133723824 CTGTGGTGGGGTGGGGAAGGGGG - Intergenic
963769704 3:149377745-149377767 CTGTGGTGCGAAGAGGCAGGGGG + Exonic
963843614 3:150132755-150132777 CTGTGCAGGAAGAGGGAAGGGGG + Intergenic
964359418 3:155878886-155878908 CCTTGGTGGGAGAGGGATGGGGG + Intronic
964720486 3:159764246-159764268 TGGTTGTGCGAGAGGAAAGGCGG + Intronic
964824257 3:160808329-160808351 GTGTGGTGGGTGAGGGAAGCTGG + Intronic
964824267 3:160808419-160808441 GTGTGGTGGGTGAGGGAAGCTGG + Intronic
965716940 3:171614848-171614870 CTGTGGTGGGAGAGGAATGGGGG - Intronic
966509777 3:180748897-180748919 CTGGGCAGGGAGAGGGAAGGAGG + Intronic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968494911 4:910228-910250 CTGTGCTGAGTGAGGGAGGGTGG - Intronic
968684071 4:1944520-1944542 CTGTGCTTGGAGAGGGGAGGTGG + Intronic
969013034 4:4083004-4083026 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
969162530 4:5273836-5273858 CTGTGGTGGGTGGGGGGAGGGGG + Intronic
969740810 4:9024790-9024812 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
972630227 4:40835962-40835984 CTGGAGTGGGGGAGGGAAGGAGG + Intronic
972979611 4:44679365-44679387 CTCTGGTGGGAGAGGGTGGGAGG + Intronic
973093671 4:46169910-46169932 CTGTGGGGTGAGGGGGAGGGCGG + Intergenic
973710216 4:53622491-53622513 CTGGGGTGAGAGAGTGAGGGAGG - Intronic
976298225 4:83493331-83493353 CTGGAGTGTGAGAGGGAGGGAGG + Intronic
977914600 4:102577577-102577599 ATGTGGTGGGACAGGGAATGGGG - Intronic
980604454 4:135071213-135071235 CTGTTGTGGGAGGGGGGAGGGGG + Intergenic
981691644 4:147515359-147515381 CTGTGGTGGTGGGGGGAAGGGGG + Intronic
984836694 4:184028927-184028949 CTGTGGTGCGGCAGGCAAGGGGG + Intergenic
985723110 5:1501055-1501077 CTGAGGTGGGAGGGGTAAGGGGG + Intronic
986302181 5:6486424-6486446 CTGTGGTGGGAGAGGACAAGGGG - Intronic
986370726 5:7077750-7077772 CCATGGTGCGCGGGGGAAGGTGG + Intergenic
986618301 5:9643053-9643075 CTGGGGTATGGGAGGGAAGGAGG - Intronic
987245163 5:16041525-16041547 CTGTGGGGGCAGAGGGGAGGGGG - Intergenic
987413955 5:17643202-17643224 CTGTGGTGGGAAAGGGAGAGAGG - Intergenic
989727984 5:44610303-44610325 ATGTGCTTCAAGAGGGAAGGAGG + Intergenic
989846625 5:46152244-46152266 CTGTGGTGGGTGGGGGAATGGGG + Intergenic
990535317 5:56715928-56715950 CTGTTGTAAGAGAGGAAAGGAGG + Intergenic
991479710 5:67064252-67064274 CTGAGATGCAGGAGGGAAGGTGG + Intronic
991514635 5:67421174-67421196 CTGTGCTGAGAGGGTGAAGGTGG - Intergenic
995126935 5:108586885-108586907 GGGTGGGGAGAGAGGGAAGGGGG + Intergenic
996219391 5:120911099-120911121 CTGTGGTGAGAGAGGCAACTGGG - Intergenic
996626495 5:125576203-125576225 GTGAGGTGAGAGCGGGAAGGTGG - Intergenic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998903463 5:146878970-146878992 GAGTGGCGCGAGAGGGGAGGAGG - Intronic
1000337335 5:160251595-160251617 CTGATTTGAGAGAGGGAAGGAGG + Intergenic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1002133126 5:177093309-177093331 CTGTCGGGCCAGAGGGAAGCGGG - Exonic
1002593548 5:180307101-180307123 CTGAGGAGCCAGCGGGAAGGAGG - Intronic
1003864650 6:10351855-10351877 CTGAGGAGCGAGAGGGCACGTGG + Intergenic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1005805227 6:29468320-29468342 CTGTGGAGCCAGAGGAAAGGAGG - Intergenic
1007090028 6:39178357-39178379 CTGTGGTGGGAGAGCGGTGGGGG - Intergenic
1007251160 6:40496107-40496129 CTTTGGTGTGAGAGGAAGGGAGG - Intronic
1008864709 6:56195436-56195458 ATGTGGTGGGGGAGGGAAAGAGG + Intronic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1011833329 6:91401072-91401094 CTGTTGTGGGAGAGGGGAGAGGG - Intergenic
1011963671 6:93124439-93124461 CTTTTGTGCCACAGGGAAGGAGG - Intergenic
1013603893 6:111730563-111730585 AATTGGTGGGAGAGGGAAGGGGG + Intronic
1013703639 6:112805710-112805732 ATGTGGGGAGAGATGGAAGGAGG - Intergenic
1013853681 6:114545521-114545543 ATGTGGTGTGAGAGAGCAGGAGG + Intergenic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1014781824 6:125573593-125573615 CGGTGGTGCTTGAGGAAAGGGGG - Intergenic
1014951007 6:127556312-127556334 CTGTGGGGAGAGAGTGGAGGTGG - Intronic
1017024816 6:150172460-150172482 CTGTGGTGCAGGTGGGGAGGCGG + Intronic
1018509461 6:164509847-164509869 TTGTGGTGGGGGAAGGAAGGTGG + Intergenic
1018638986 6:165889821-165889843 GAGTGGGGCGAGAGGGAGGGAGG - Intronic
1018974769 6:168556155-168556177 CGGCTGTGCGGGAGGGAAGGAGG + Intronic
1019254680 7:41705-41727 CTGTGAGGCTAGAGGTAAGGTGG - Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1022470001 7:30676296-30676318 CTGCTGGGAGAGAGGGAAGGTGG - Intronic
1022596277 7:31716139-31716161 CTGTGGTGCAAAGTGGAAGGAGG + Intergenic
1022597228 7:31724208-31724230 CTATGGTGCAAAATGGAAGGAGG + Intergenic
1023742756 7:43295227-43295249 CTTTTGTGAGAGAGGGAGGGAGG + Intronic
1023828963 7:44028329-44028351 CTGGGGTCAGAGGGGGAAGGAGG + Intergenic
1024767617 7:52679109-52679131 CTGTGCTGGGAGATGGAAGGTGG - Intergenic
1024847347 7:53662377-53662399 CTGTGGGGTTAGAGTGAAGGAGG - Intergenic
1026929335 7:74215268-74215290 CTGTGGTGGGAGCTGGGAGGAGG - Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1029071691 7:97904638-97904660 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
1029432420 7:100539637-100539659 CTCCGGGGCGCGAGGGAAGGGGG + Intronic
1029739262 7:102482586-102482608 CTGGGGTCAGAGGGGGAAGGAGG + Intronic
1029757263 7:102581765-102581787 CTGGGGTCAGAGGGGGAAGGAGG + Exonic
1029775203 7:102680826-102680848 CTGGGGTCAGAGGGGGAAGGAGG + Intergenic
1029910511 7:104141347-104141369 CAGTGGTGAGAGTGGGAATGAGG - Intronic
1030074709 7:105726381-105726403 CTGTGCTGCCTGAGGGATGGGGG - Intronic
1030341504 7:108385896-108385918 CTATGGAGAGAGAGGGAGGGAGG + Intronic
1030793185 7:113755043-113755065 TTTTGGTGGGAGAGGGATGGTGG + Intergenic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031280627 7:119795831-119795853 CTGTTGTGGGATAGGGGAGGGGG - Intergenic
1032935863 7:136730767-136730789 CTGTGGTGTGAGAGAGTATGTGG - Intergenic
1032977456 7:137241938-137241960 CTGTGTTGAGAGAGGTGAGGGGG - Intronic
1033271341 7:139935700-139935722 GGGTGGAGGGAGAGGGAAGGGGG - Intronic
1034088125 7:148338910-148338932 CTGTGCTCTGAGAGTGAAGGAGG + Intronic
1034167791 7:149039055-149039077 CAGAGGTGCGAGCGGGAACGGGG - Intergenic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1035284987 7:157800088-157800110 CTGTGGTGCCTCAGGGATGGAGG - Intronic
1035459141 7:159028725-159028747 ATGTGGAGCGAGAGGGAGGCAGG - Exonic
1036051701 8:5206075-5206097 CTTTGGTGAGAGAGGAAAGCTGG + Intergenic
1036246015 8:7117358-7117380 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
1036888255 8:12576670-12576692 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
1037896454 8:22659451-22659473 CTGTGGAGCGGTGGGGAAGGAGG - Intronic
1038197932 8:25385119-25385141 CTGGGGTGCCAGCGGGGAGGCGG + Intronic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1041046772 8:53895018-53895040 CTGTGCGGGGAGAGGGAAGGAGG + Intronic
1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG + Intergenic
1041698675 8:60763894-60763916 CTGTGGTCAGAGAGGAAAAGAGG + Intronic
1044108936 8:88247865-88247887 CTGTGATGAGAGAGAGTAGGGGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048308183 8:133297784-133297806 CTGTCGGGCGAAAGCGAAGGCGG - Intronic
1048518606 8:135133511-135133533 CTGTGGTGAGATGGGGAAGGAGG + Intergenic
1049027672 8:140006813-140006835 CTAGGGTGCGGGAGGGAAGTAGG + Intronic
1049417243 8:142500653-142500675 CTGAGGTCAGAGAGGGAGGGTGG + Intronic
1049436234 8:142587447-142587469 CTGTGGAGCGGGAGGGAGTGGGG + Intergenic
1049436244 8:142587472-142587494 CTGTGGAGCGGGAGGGAGTGGGG + Intergenic
1049513237 8:143040126-143040148 CTGTGGTGCTAGAGGCAGGGGGG + Intronic
1049575753 8:143388899-143388921 CTGTGCTGCGGGTGGGGAGGAGG + Intergenic
1049855864 8:144861510-144861532 CTTTGGTAGGAGAGGGGAGGAGG + Intergenic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1053018157 9:34675837-34675859 CTGGGGTGTCAGAGGGAAGTAGG + Intergenic
1053270559 9:36746639-36746661 ATGTGGTGAGGGAGGGATGGTGG + Intergenic
1053551063 9:39079876-39079898 CGGTGGTGTGGGAGGGAGGGTGG - Intronic
1053815173 9:41899957-41899979 CGGTGGTGTGGGAGGGAGGGTGG - Intronic
1054615423 9:67287484-67287506 CGGTGGTGTGGGAGGGAGGGTGG + Intergenic
1056746817 9:89310656-89310678 CTGCGGTGTGAGGGGGAGGGCGG - Intergenic
1057519819 9:95751892-95751914 CTGAGCTGCGAGAGGGAGGGAGG + Intergenic
1058283834 9:103151188-103151210 CTGTGTTGTGAGAGGGATGCAGG + Intergenic
1058861156 9:109119183-109119205 CTGAGGTGTGAGAAGGAAAGCGG + Intronic
1059199582 9:112401712-112401734 GTGGGGTGGGGGAGGGAAGGAGG + Intronic
1059368043 9:113801813-113801835 CTGGGGTGAGGGAGAGAAGGCGG + Intergenic
1059455058 9:114395097-114395119 CTGGGGTGCAGGAGGGAGGGAGG + Intergenic
1060103235 9:120857842-120857864 CTGGGGTGGGAGAAGGAAGCAGG - Exonic
1062695488 9:137873700-137873722 CTGAGGTTGGAGAGGGATGGGGG + Intergenic
1062719027 9:138025228-138025250 CTGTGGAGCAGGAGGGAATGGGG - Intronic
1203776435 EBV:75693-75715 CTGTGGTGAGGGATAGAAGGGGG + Intergenic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1186297990 X:8169860-8169882 GTGTGGTGAGGGAGGGAGGGAGG - Intergenic
1187440826 X:19318284-19318306 TTATGGAGCGAGAGGGAAAGAGG + Intergenic
1187796473 X:23008945-23008967 AGGTGATGGGAGAGGGAAGGTGG - Intergenic
1188246470 X:27841098-27841120 CTGAGGTGTCAGAGGCAAGGTGG - Intergenic
1188522439 X:31053746-31053768 CTGAGGAGAGAGAGGGAGGGAGG - Intergenic
1188774344 X:34194906-34194928 CTGGGGTGAGGGAGGGAGGGAGG - Intergenic
1190912767 X:54787883-54787905 CTGTGGTGGGAGAGGCAGAGTGG + Intronic
1190942649 X:55057141-55057163 CTGTGGTGGGAAAGGGGAGAGGG + Intergenic
1191083667 X:56540417-56540439 CTGTTGGGGGTGAGGGAAGGTGG + Intergenic
1191839500 X:65501594-65501616 CTGTGATGGGAGAGAGAAAGTGG - Intronic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1195043533 X:101035502-101035524 TTCTAGTGCTAGAGGGAAGGAGG - Intronic
1196048087 X:111276930-111276952 CTGTGTTGCGGGAGGGAGGTGGG + Intergenic
1197724796 X:129769050-129769072 CTGTGGAGTAAGAGGGAATGCGG + Exonic
1200068349 X:153515646-153515668 CTGTGGTGCCTGAGGGCATGGGG + Intergenic
1200790053 Y:7291667-7291689 CTGGGCTGCAAGAGGGAGGGTGG - Intergenic