ID: 950266280

View in Genome Browser
Species Human (GRCh38)
Location 3:11575506-11575528
Sequence CTCCTTTCCTTGGGCACAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950266268_950266280 25 Left 950266268 3:11575458-11575480 CCTCTCTCTCCTTGAGACTGGAA 0: 1
1: 0
2: 1
3: 30
4: 287
Right 950266280 3:11575506-11575528 CTCCTTTCCTTGGGCACAATCGG 0: 1
1: 0
2: 1
3: 20
4: 141
950266270_950266280 16 Left 950266270 3:11575467-11575489 CCTTGAGACTGGAAGGAGCTCCG 0: 1
1: 0
2: 0
3: 13
4: 159
Right 950266280 3:11575506-11575528 CTCCTTTCCTTGGGCACAATCGG 0: 1
1: 0
2: 1
3: 20
4: 141
950266265_950266280 27 Left 950266265 3:11575456-11575478 CCCCTCTCTCTCCTTGAGACTGG 0: 1
1: 0
2: 5
3: 39
4: 312
Right 950266280 3:11575506-11575528 CTCCTTTCCTTGGGCACAATCGG 0: 1
1: 0
2: 1
3: 20
4: 141
950266267_950266280 26 Left 950266267 3:11575457-11575479 CCCTCTCTCTCCTTGAGACTGGA 0: 1
1: 0
2: 0
3: 43
4: 288
Right 950266280 3:11575506-11575528 CTCCTTTCCTTGGGCACAATCGG 0: 1
1: 0
2: 1
3: 20
4: 141
950266275_950266280 -4 Left 950266275 3:11575487-11575509 CCGAGGGCAAAGTGGGTCCCTCC 0: 1
1: 0
2: 1
3: 17
4: 183
Right 950266280 3:11575506-11575528 CTCCTTTCCTTGGGCACAATCGG 0: 1
1: 0
2: 1
3: 20
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950266280 Original CRISPR CTCCTTTCCTTGGGCACAAT CGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
906188512 1:43880312-43880334 CTCTTTTCCTTGGGAAGATTTGG - Intronic
908167282 1:61470992-61471014 CTCTCTTCCTTGGGCATGATTGG - Intergenic
909524004 1:76601837-76601859 CTCCTTTCCTTGCTCTCAACTGG - Intronic
911367164 1:96952441-96952463 CTCTTTGCCTTTGGCTCAATAGG + Intergenic
914751041 1:150535107-150535129 CTCCTCTGCTTGAGAACAATTGG + Intergenic
915107972 1:153546120-153546142 CTCCTTTCCTAGGTCCCCATGGG - Intronic
915725096 1:158011676-158011698 CTCCTTCCCTGGGCCACAGTGGG + Intronic
916771116 1:167909633-167909655 CGGCTTCCCTGGGGCACAATTGG - Intronic
924073152 1:240304446-240304468 CACCTTTCCCTGGGCACAAGTGG + Intronic
924433182 1:244015005-244015027 CTCCTTTCTTTTGGCACTTTGGG - Intergenic
1065444583 10:25785105-25785127 CTCCTTTCGCTGGGCAACATAGG + Intergenic
1070601044 10:77866435-77866457 CTCCTTTCATTGACCACAGTTGG - Intronic
1071284956 10:84136041-84136063 CTCCTCTCCTGGGCCACAACTGG + Intergenic
1072513409 10:96151607-96151629 CTTCCTTACTTGGGCATAATGGG + Intronic
1072534617 10:96352733-96352755 CACCTGTCCTTGGGCTCCATGGG - Intronic
1073153610 10:101328943-101328965 TTCCTTTCCTTTGGCCCAAGTGG + Intergenic
1076167547 10:128294592-128294614 ATCCTTTCTTTGAGCACAGTGGG + Intergenic
1076208892 10:128625122-128625144 CTCCTTGCCTTGGGGAGAGTGGG + Intergenic
1076440947 10:130481136-130481158 CTTGTTTCCCTGGGAACAATGGG + Intergenic
1077262107 11:1628206-1628228 CTCCTTCCCTCGGGTACAAGAGG - Intergenic
1078034883 11:7793546-7793568 CACCTTTCCTTAGGGTCAATTGG - Intergenic
1079316007 11:19408337-19408359 CTCCTTTCCATGATCTCAATGGG - Intronic
1079539635 11:21557307-21557329 CTGCTTTTATTGTGCACAATAGG + Intronic
1081644178 11:44778311-44778333 CCCCTTTCCTTGGGGCCAAGAGG + Intronic
1084429052 11:69101320-69101342 CTCCTTCCCTGGTGCACACTGGG - Intergenic
1085097123 11:73770311-73770333 CTCCTTTCCTTGGACTTTATAGG - Intergenic
1086445541 11:86867036-86867058 CTCTTTCTCTAGGGCACAATGGG - Intronic
1086944890 11:92835200-92835222 CTCCTATTCTTGGGGACAAATGG - Intronic
1087200704 11:95341657-95341679 CTCCTTTTCTGGACCACAATTGG + Intergenic
1087345359 11:96964913-96964935 CTCCTTTCCTCAGGCAGAAGGGG - Intergenic
1088754301 11:112872906-112872928 CTCCTGGCCTTGGGCACAACTGG + Intergenic
1090627431 11:128619022-128619044 CACCTTTCCTAAGGCACAGTGGG - Intergenic
1090777551 11:129978699-129978721 CTACTTTCCTTGTGCACAAAGGG + Intronic
1091104226 11:132903273-132903295 CTCCTGTCCTTGGTCACATATGG - Intronic
1095577628 12:43758605-43758627 CACCTTTCTTTGGGCGCAAAGGG + Exonic
1096833251 12:54330972-54330994 CTCCTGTTTTTGGGCAGAATAGG + Intronic
1097536843 12:60882889-60882911 CTGCTTTCTTTGGGCACAATGGG + Intergenic
1100613948 12:96216267-96216289 CTCCTTCCCTGGGGTACATTCGG - Intronic
1101523105 12:105503179-105503201 CACTTTTCCTTAGGCACACTTGG - Intergenic
1102967844 12:117141736-117141758 CTCCTTTCCTAGAACACAACTGG + Intergenic
1103125486 12:118418600-118418622 CCACTTGCCTTGGGAACAATGGG - Intergenic
1103200992 12:119087830-119087852 CACCTTTCCTTGAGAACACTGGG + Intronic
1104469312 12:129016698-129016720 AGGCTTTCCTTGGTCACAATGGG + Intergenic
1104665441 12:130644162-130644184 TTCCTTTCCTTCGTCTCAATGGG - Intronic
1106681507 13:32013096-32013118 CTCCTTACCTTGGGCATCCTTGG + Intergenic
1108508346 13:51133642-51133664 CACCTTTCCTGGGGCCCATTGGG - Intergenic
1109858280 13:68162555-68162577 CTTCTATACTTGGGCAAAATGGG - Intergenic
1115037685 14:28879942-28879964 ATGCTTCCCTTGGGAACAATGGG + Intergenic
1115520012 14:34224012-34224034 CTCTCTCCCTTGGGCACAATTGG - Intronic
1116994489 14:51308267-51308289 CTTCTTTCCTGGCACACAATAGG - Intergenic
1117870774 14:60198209-60198231 CTCCTTTTCTCAGGCAGAATGGG - Intergenic
1119345726 14:73922222-73922244 CTCCTTTATTTGGGAAAAATGGG + Intronic
1122142696 14:99672381-99672403 TTACTTTCTTTGGGCACAAAGGG - Exonic
1125187410 15:36947222-36947244 CTCCTTTCCTGAAGCACATTTGG + Intronic
1125371515 15:38983322-38983344 TGCATTTCCTTGGGCACAAGGGG + Intergenic
1127576740 15:60299053-60299075 CTCATTTCCTTGTGCACAAATGG - Intergenic
1128112767 15:65087019-65087041 CTCCCTTCCATGGGCACCAGGGG + Intergenic
1129240675 15:74250286-74250308 CTCTTTACTTTGGGAACAATGGG - Intronic
1132485327 16:187354-187376 CTCCTTTCCTTGGAGACAGTTGG + Intergenic
1135530004 16:23245216-23245238 CTCCATCCCTTGGGCAAATTGGG + Intergenic
1136255429 16:29035811-29035833 CTGGTTTCCTTGCGTACAATGGG - Intergenic
1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG + Intergenic
1138873793 16:60925519-60925541 CTACTTTCCTTCAGCTCAATGGG + Intergenic
1140365106 16:74375115-74375137 CTGGTTTCCTTGCGTACAATGGG - Intergenic
1141497978 16:84423242-84423264 CTCTTCTCCTTTGGCATAATCGG + Exonic
1142057815 16:88010890-88010912 CTCCTTTCCATGTGCACGAATGG - Intronic
1142201258 16:88762137-88762159 CTCCCTTCCCAGGGCACAGTGGG - Intronic
1145997611 17:29113584-29113606 GTCCTCTACTTGGGGACAATGGG + Intronic
1146483886 17:33227870-33227892 CACCTTTCCTAGAGCACAACAGG - Intronic
1146544664 17:33727935-33727957 CTTCTTTTCTTGGGCACCTTTGG + Intronic
1147166841 17:38598068-38598090 CTCCTCTACCTGGGCACTATGGG - Intronic
1147728737 17:42583370-42583392 CTCCTTGTCTTGGGAACAAGGGG + Intronic
1148712607 17:49692747-49692769 CTCCTTTCCTTTAGCAAAAGAGG + Intergenic
1151256815 17:72883844-72883866 CTCCTTTCTATGGGCAGAATTGG - Intronic
1152560402 17:81075782-81075804 CTCCCCTCCGTGGGCACATTGGG + Intronic
1153837870 18:8980596-8980618 CTCCTTTCCTTTTCCATAATAGG + Intergenic
1156099122 18:33572554-33572576 GACATTTCCTTGGCCACAATGGG + Intergenic
1162597777 19:11642068-11642090 TTCCATTCCTTGGGGACACTTGG + Intergenic
1163102870 19:15108311-15108333 CTCCCTTCCCTGGGAACATTGGG - Intronic
1164483165 19:28632212-28632234 CTGCTTTCCTTGGGTCCCATTGG - Intergenic
1164633379 19:29776032-29776054 CTCCTTTCCATCTGCAAAATGGG - Intergenic
1166714624 19:44958926-44958948 CTTCTTTCATTGGGCATAATGGG + Intronic
1166751969 19:45168522-45168544 CTCCTTTCCTTGTGCATCCTTGG - Intronic
925588538 2:5487406-5487428 CTCCTTTCCTCAGGCAGAAGGGG - Intergenic
925686828 2:6481791-6481813 CTCCTTTCTTTGGGGACATCAGG - Intergenic
928932329 2:36637241-36637263 CTCCTTTCCTTAAGCAGAAGGGG - Intronic
931555473 2:63498936-63498958 CTCCATTCTTTGGGTACAATAGG - Intronic
942401621 2:175609303-175609325 TTTCTTTCCTTGGGAACAAACGG - Intergenic
942859451 2:180591509-180591531 CTGCTTTCCTTGGCTACAAAAGG + Intergenic
944046159 2:195414181-195414203 CTGCTTTTCTTGGGCACAAGGGG - Intergenic
945606059 2:211933138-211933160 CTCTTTTCCCTGAGCACCATAGG + Intronic
946112178 2:217429621-217429643 CTGCTTTCCTTGGGAGTAATAGG + Intronic
947531321 2:230910370-230910392 CTCCTTCCCATGGGCATCATGGG - Exonic
948764635 2:240213106-240213128 CTCCCTCCCTTGGACACACTGGG - Intergenic
1168899934 20:1354807-1354829 CTCCTTTCCTTAGGCAGAAGGGG + Intronic
1172550423 20:35794771-35794793 CTCTTTTCCCTGAGCACAAAGGG + Intronic
1175390457 20:58624166-58624188 CTCCTCTCCTTGAGGACGATGGG + Intergenic
1178040407 21:28634410-28634432 GCCCTTTCCTTGGGGAAAATTGG - Intergenic
1178174877 21:30085476-30085498 CACCTTTTCAAGGGCACAATAGG + Intergenic
1184596527 22:45517385-45517407 CTCCTCCCTTGGGGCACAATGGG + Intronic
950140187 3:10609896-10609918 CTCCCATCCTCGGCCACAATGGG + Intronic
950266280 3:11575506-11575528 CTCCTTTCCTTGGGCACAATCGG + Intronic
950284800 3:11736252-11736274 TTCCTTTCCATGGGCACATGTGG - Intergenic
952094725 3:29936170-29936192 CACCTTTCGTTGGGCACAACAGG + Exonic
953179500 3:40582866-40582888 CTCCTTTCCTTGGCCACCCAGGG + Intergenic
957211483 3:77264436-77264458 CTCCTGTGCTTGTGCACATTTGG + Intronic
963761872 3:149292943-149292965 CCTCTCTCCTTGGGCACAAATGG + Intergenic
964075487 3:152686899-152686921 TTCCTTCCCTTGTGCACCATGGG + Intergenic
967705297 3:192642705-192642727 CTCTTTTCCTTGAGAACCATTGG - Intronic
969703051 4:8778162-8778184 CTCCTTTGCTGGCACACAATAGG - Intergenic
981019893 4:140014802-140014824 CTCCCTTCCTTAGGGACACTAGG + Intronic
989122466 5:38018318-38018340 CTCCTTTCCTTAGCCACATGTGG - Intergenic
989262248 5:39431140-39431162 CTCCTTTCCTTGGCCACATATGG + Intronic
990308518 5:54517277-54517299 CTCCTCTCCTTGAGCAGAAGAGG + Intergenic
991939834 5:71839861-71839883 CTCATGTCCTGGGGGACAATAGG - Intergenic
991951188 5:71948108-71948130 CTCCTTTCCCTGGGCCCTTTGGG + Intergenic
1001069386 5:168571218-168571240 CTGACTTCCTTGGGAACAATTGG - Intronic
1002606980 5:180389385-180389407 CCCCCTTCCCTGGGCACCATGGG + Intergenic
1010912624 6:81578780-81578802 CTCCTTTCCTTGGCTAGAAAAGG - Intronic
1013124783 6:107172362-107172384 CTAGTTTCCTTGGGCAGAAGTGG - Intronic
1013995915 6:116307759-116307781 CTTCTTTCCTTGTGCAGCATGGG - Intronic
1016510701 6:144839762-144839784 AGCCTGTCCTTGGTCACAATGGG + Intronic
1016664558 6:146621401-146621423 CTCCTTTCCAGGGGAGCAATTGG - Intronic
1021044787 7:15909169-15909191 CTTCTTTCCTAGGGCCCAACTGG + Intergenic
1024709661 7:52001260-52001282 TCCCTTTCCTTGGGCATACTGGG - Intergenic
1029568301 7:101354245-101354267 CTCCTTTCCTTGGTGACATTTGG - Intergenic
1030647768 7:112082462-112082484 CTCCTTTACTGGGGGATAATAGG + Intronic
1030836017 7:114286797-114286819 CTCCTTTCCTTGGGTACTTTTGG - Intronic
1031090644 7:117349647-117349669 CTCCTTTCACTGAGCACCATAGG + Intergenic
1031624204 7:123973609-123973631 CTCCTTTCATTGGGCTCACATGG - Intergenic
1033265147 7:139879102-139879124 CTCCCTACCATGGGGACAATAGG + Intronic
1033416693 7:141167836-141167858 CTGCTTCCCTGGGGCACAACGGG - Intronic
1036760362 8:11504456-11504478 GCCCTTTCCTTGGCCACAAAGGG - Intronic
1036918798 8:12832046-12832068 CTCCTATCCTTGGCCACTAGTGG + Intergenic
1038143584 8:24872644-24872666 CTCCTATCCTTGGCTACAACAGG + Intergenic
1040582400 8:48708287-48708309 CTCCTTTCCCTGGGCCCAGCCGG + Intergenic
1041418438 8:57640358-57640380 CTGCCTTCTTTGGGCACATTGGG + Intergenic
1041791484 8:61700497-61700519 CTCCATTCGTTGTGCACAGTTGG - Intronic
1043710540 8:83411847-83411869 CTCCTTTCTTTGGCCATAAATGG + Intergenic
1044043641 8:87401888-87401910 CTCTCTTCCTTGTGCACAATTGG + Intronic
1046770213 8:118110833-118110855 CTTCGTTCCTTGGGATCAATTGG - Exonic
1047881008 8:129193336-129193358 CTACTCTCTTTGGGAACAATGGG - Intergenic
1049341179 8:142113467-142113489 CTACTTTCCGTGGTCAGAATTGG + Intergenic
1050210777 9:3253524-3253546 CTGCCTTTCTTGGGCAGAATTGG - Intronic
1051191595 9:14518724-14518746 CTCCTTTCCTTGCCAGCAATGGG + Intergenic
1052823205 9:33155785-33155807 CTCATCTTCTTGGGCACAAAAGG - Intronic
1053174725 9:35914530-35914552 CTCCTGCCCTTGGGGACAATAGG - Intergenic
1053288801 9:36866615-36866637 CTCCTGTCCTTGTGCAGAACTGG - Intronic
1053492420 9:38518850-38518872 CTCCTTTCCGTGGGCACCAAAGG + Intergenic
1056582504 9:87902359-87902381 CCCCTTTCCTTGGGCAGGAAAGG - Intergenic
1056706234 9:88954694-88954716 CTTCTTTTCTTGGGCTTAATTGG - Intergenic
1057303173 9:93898112-93898134 CACATTGCCTTGGGCACGATGGG + Intergenic
1057672665 9:97107795-97107817 CTCCTTTCCATGGGCACCAAAGG + Intergenic
1060806781 9:126582704-126582726 CACCTTTCCTTAGACACACTTGG - Intergenic
1061035045 9:128108766-128108788 CTCCTTTCCTTTGGCAGGTTGGG + Exonic
1062028846 9:134352927-134352949 CTTCTCTCCTTGGGGACACTTGG + Intronic
1062167745 9:135116476-135116498 CTCCTTCCCATGGGCAGAAGGGG - Intronic
1187648025 X:21370546-21370568 CTCCTTTCTTTGGTCCCAAAGGG + Intergenic
1194709444 X:97217264-97217286 CTGGTTTCCTTGGGCCGAATGGG + Intronic
1195968209 X:110448455-110448477 CTCTTTTCTTTGGGCAGAGTGGG + Intronic
1197891462 X:131274379-131274401 CTCCTTTCCTTGGGGAAAAGAGG + Intronic
1200213144 X:154355791-154355813 CCCCTTTCCTCGGGCACTCTGGG - Intronic