ID: 950266363

View in Genome Browser
Species Human (GRCh38)
Location 3:11576111-11576133
Sequence GGGCAGGTGAGATGCTTTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950266363_950266369 0 Left 950266363 3:11576111-11576133 CCGGTAAAGCATCTCACCTGCCC 0: 1
1: 0
2: 0
3: 20
4: 119
Right 950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 45
950266363_950266370 1 Left 950266363 3:11576111-11576133 CCGGTAAAGCATCTCACCTGCCC 0: 1
1: 0
2: 0
3: 20
4: 119
Right 950266370 3:11576135-11576157 CACGTTAGCAACTGTTGCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950266363 Original CRISPR GGGCAGGTGAGATGCTTTAC CGG (reversed) Intronic
903967069 1:27097504-27097526 GGGCAAAGGAGATGCTTTCCTGG + Intergenic
904750852 1:32741021-32741043 GGGCAGGTGAGAGGTGTGACTGG - Intergenic
908836953 1:68237948-68237970 GGGCAGGTAAGAAACTTTACAGG + Intergenic
910219110 1:84872376-84872398 GCTCAGGTGAGCTGCTTTTCTGG - Intronic
910351681 1:86305931-86305953 GAGCATATGAGTTGCTTTACGGG - Intergenic
915008960 1:152666772-152666794 GCTCAGGTAAGAGGCTTTACTGG - Intergenic
922912860 1:229232149-229232171 GGGCAGGTGGGAGGCTCTCCAGG + Intergenic
924245538 1:242080145-242080167 AGGCAAGTGAGATGCTTTTGGGG + Intergenic
924505936 1:244683692-244683714 GGGCAGGTGTGATGCTCTTAAGG - Intronic
1068593202 10:58872031-58872053 GGGTAGGTGAAAGGCCTTACTGG - Intergenic
1069775946 10:70927213-70927235 AGGCAGGTGAGTTGGTTTAAAGG + Intergenic
1070237247 10:74641405-74641427 GGGCAGCTGCCATGCTTTGCAGG + Intronic
1072462940 10:95637095-95637117 GGGCAGCACAGATGCTGTACTGG + Exonic
1076713929 10:132353840-132353862 GGGCAGCTGGCATGCTTGACAGG - Intronic
1079210397 11:18455871-18455893 TGGCAGGTGTGATGCTTGGCAGG - Exonic
1079210399 11:18455887-18455909 TGGCAGGTGTGATGCTTGGCAGG - Exonic
1079210401 11:18455903-18455925 TGGCAGGTGTGATGCTTGGCAGG - Exonic
1079983140 11:27173168-27173190 GTGCAGCTGAGATGCAATACAGG + Intergenic
1084369524 11:68731087-68731109 GGGCAGGAGACAATCTTTACAGG + Intronic
1085130093 11:74030839-74030861 CGGCAGGTGATATCATTTACTGG - Intronic
1086982284 11:93211471-93211493 GTGCAGGTGAGATACTCTCCAGG + Intergenic
1089302939 11:117509512-117509534 GGGCAGGTGCGATGCATGGCTGG + Intronic
1097306719 12:58077115-58077137 GGCCAGGTGAGATGCCTTGAGGG + Intergenic
1099364712 12:81754044-81754066 GGGCAAGTGAGAGGCTTTCCTGG + Exonic
1103782167 12:123406201-123406223 AGCCAGGTGAGCTGCTTAACAGG - Intronic
1106589398 13:31086538-31086560 TGTCAGGTGGGATGCTATACAGG - Intergenic
1115565479 14:34621596-34621618 GGGCAGGTTAGATGCCTCACAGG + Intronic
1118306192 14:64657542-64657564 AGGCAGGAGAGATGCTTGAACGG - Intergenic
1119324442 14:73751454-73751476 GGGCAGGTGAGTGGCTTTGAAGG + Intronic
1120712470 14:87807035-87807057 GGGAAGGTAATCTGCTTTACTGG + Intergenic
1121035696 14:90701529-90701551 GGGCAGGCGAGTTGCTCTTCTGG - Intronic
1122321806 14:100859950-100859972 AGGCAGGTGTGACGCTTTCCAGG - Intergenic
1130944068 15:88537790-88537812 GGGCAGGGGAAATGCATTCCAGG - Intronic
1133388025 16:5386502-5386524 GGGCAGGAGAGGTGATTTACGGG - Intergenic
1133406826 16:5531171-5531193 GGGAAGGTGGGATACTTTAGGGG + Intergenic
1134182510 16:12059207-12059229 GGGCAGGTGCGATGTTCTGCTGG - Intronic
1138603389 16:58071244-58071266 GGGGAAGTGAGATGGATTACTGG + Intergenic
1144125837 17:12202308-12202330 GAGCATGTCTGATGCTTTACTGG + Intergenic
1144754897 17:17673547-17673569 GGTAGGGTGAGATGCTTGACTGG - Intergenic
1146982748 17:37181184-37181206 CGGCAGGTAAGATGCCTAACTGG - Exonic
1152331766 17:79677665-79677687 GGGCAGGGGAGAGGCTGAACAGG + Intergenic
1157139745 18:45093967-45093989 GGGCAGGTCAAAAGCTTTACTGG + Intergenic
1157497021 18:48163325-48163347 GGGCTGGTCAGATGCTTTCTAGG + Intronic
1159148181 18:64482059-64482081 GGAGGGGTGAGATGCTTTAAAGG - Intergenic
1162526573 19:11209942-11209964 GGGCAGGTGAGAGGGTGGACAGG - Intronic
1162526582 19:11209972-11209994 GGGCAGGTGAGAGGGTGGACAGG - Intronic
1163807596 19:19409178-19409200 GGGCAGCTCAGATGCTTTTCTGG + Intronic
925820412 2:7794242-7794264 GTGCAGGTGAGAGGCTGCACAGG + Intergenic
927733254 2:25494766-25494788 GGGCAGGCCAGAGGCTTTGCTGG - Intronic
928222151 2:29413000-29413022 TGGCATGTGACATGCTTGACGGG + Intronic
932516676 2:72358189-72358211 ATGCATGTGAAATGCTTTACAGG - Intronic
933218417 2:79658334-79658356 GGACAAGTGAGATGGTTTAAAGG + Intronic
933309502 2:80642990-80643012 GGGCAGGAGAGCTGTTTTATAGG - Intronic
933979763 2:87540116-87540138 GGGGAAGGGAGATGCTTTACAGG - Intergenic
936314058 2:111410675-111410697 GGGGAAGGGAGATGCTTTACAGG + Intergenic
936816768 2:116469823-116469845 GGGTAGGTCACATGCTTTAAGGG + Intergenic
942608592 2:177717668-177717690 GGACAGGTGAAAGGCTTTGCTGG - Intronic
946130710 2:217604525-217604547 GGGCAGGAGAGATGTTTTGCGGG + Intronic
946593307 2:221275886-221275908 GGGGAGGTGAGTTTCTTTACAGG + Intergenic
946969443 2:225075310-225075332 GGGCAGTTGAGATGTCTTCCTGG - Intergenic
947844408 2:233232438-233232460 GGACAGGTGTGAAGCTTTAGCGG + Intronic
1174190951 20:48740132-48740154 GGGCTGGTGAGATGCTAATCGGG - Intronic
1175248449 20:57595202-57595224 GGGCAGGTCATATGCTTCACAGG + Intergenic
1175787567 20:61721683-61721705 GGGCTGGTGATATGCTTCTCTGG + Intronic
1179881588 21:44295326-44295348 GGGCAGGTGACAGGCTTCCCCGG + Intronic
1181343550 22:22201056-22201078 GGGCAGGTCACATGCTTTCCTGG + Intergenic
1181470875 22:23138823-23138845 GGGCAGGTGGGATGCTGTTCTGG - Exonic
1181673770 22:24438868-24438890 GGGCTGGGGAGATGATTTTCTGG - Intronic
1182696952 22:32204372-32204394 GGGAAGGTTGGGTGCTTTACCGG - Intergenic
1182775000 22:32824390-32824412 GAGCAGCTGAGATGCTTTTAGGG + Intronic
950266363 3:11576111-11576133 GGGCAGGTGAGATGCTTTACCGG - Intronic
951224683 3:20107560-20107582 GGGCAGGAGAGTTGCTTGAATGG + Intronic
951949243 3:28180998-28181020 GGGCAAGTGAGATGCTTAGCTGG - Intergenic
955193067 3:56779911-56779933 GGGTAGGAGCTATGCTTTACAGG + Intronic
955704935 3:61718084-61718106 AGGCAGGAGAGTTGCTTGACTGG + Intronic
956958235 3:74366508-74366530 TGGGAGGTGAGATGCCTTACTGG + Intronic
959131061 3:102356627-102356649 GGGCTGCTGAGATCCTTCACGGG + Intronic
961471367 3:127115275-127115297 ATGCAGGTGAGATGCTGTATGGG + Intergenic
961601750 3:128067736-128067758 GGGCAGTTCAGAAGCTTTAAGGG + Intronic
962340295 3:134576659-134576681 GGCCAGGTGAGATGCTGAAAAGG + Intergenic
963248310 3:143082972-143082994 TGGCAGGTGTGAGGCTTTAGAGG + Intergenic
966738589 3:183211004-183211026 GGGGCTGTGAGATGCTTTAGGGG + Intronic
968771569 4:2510883-2510905 TGGCAGGTGAGAGGCTTGTCAGG + Intronic
970855898 4:20649168-20649190 GGGCTGGAGAGAAGTTTTACAGG + Intergenic
976163906 4:82232955-82232977 GGGCAGGGAAAATGCTTCACGGG - Intergenic
977871024 4:102091195-102091217 GGGCTGGGGAGATTCTTTAGTGG - Intergenic
978580343 4:110225642-110225664 CTGCTGGTGAGATGCTTTAGTGG + Intergenic
980645290 4:135635789-135635811 GAGCAGGTGTGATGCATTGCAGG + Intergenic
984901508 4:184590655-184590677 GGGAGGGTGAGATGCTTTCTCGG + Intergenic
985643389 5:1074102-1074124 GGACAGGTGACATGCTAGACAGG + Intronic
991918454 5:71629108-71629130 AGGCAGGGGAATTGCTTTACTGG + Intronic
995291694 5:110463800-110463822 GGGCAGGTGAGATGCAATGGAGG - Intronic
1000959533 5:167583742-167583764 AGGCAGGGGAGATGCTGTATGGG - Intronic
1002436599 5:179235509-179235531 GGCCAGGTGAGTTTCTTTAAGGG - Intronic
1003526419 6:6901674-6901696 GGGCAGGTGAAGTGCTTTGGTGG + Intergenic
1003549635 6:7091750-7091772 AGGCAGGAGAAATGCTTTCCCGG - Intergenic
1004374654 6:15080801-15080823 AGGCAGGAGAATTGCTTTACAGG + Intergenic
1007724114 6:43904159-43904181 GGCCAGATGAGATGCCTTCCAGG - Intergenic
1008693773 6:54010182-54010204 AGGCAGGTGGGATGATTTACAGG + Intronic
1009952382 6:70412952-70412974 GGGCAGGACAGATGCCTTTCGGG - Intronic
1011490322 6:87884850-87884872 TGGCAGGTGACATGATTTAGAGG + Intergenic
1012398942 6:98828799-98828821 GGGCGGGAGAGATGCTTTTCTGG - Intergenic
1013482245 6:110562801-110562823 GGGCAGGCTAGATGCTGGACAGG - Intergenic
1013685296 6:112574436-112574458 GGGCTGGTTAGCTGCTTTAGTGG + Intergenic
1015870956 6:137775924-137775946 GGGAAGTTGACATGCTGTACTGG - Intergenic
1018635622 6:165856799-165856821 GGGCACTTGAAATGCTTAACAGG - Intronic
1020745339 7:12072460-12072482 GGGCAGTTCAGATTCTTAACAGG - Intergenic
1020983506 7:15102435-15102457 GGGCAGGTGGGATGCTTTCTGGG - Intergenic
1021510601 7:21428348-21428370 GGGCCGCTGAGATGCTTTAAGGG + Intronic
1029262079 7:99309694-99309716 GGGCAGGGGACCTGCTTTAAAGG - Intergenic
1029319315 7:99743470-99743492 GGGAAGGTGAGAAGCATTTCAGG + Intergenic
1029903484 7:104067188-104067210 TGGCAGGTGGGAGGCTTTCCTGG + Intergenic
1030237738 7:107284915-107284937 GAGCAGGTTAGATGTTTTAAAGG - Intronic
1031401227 7:121328408-121328430 TGGCAGATGAGATGCTAGACTGG + Intronic
1033928056 7:146488516-146488538 GAGCAGGTGAGAAGCTTTTGTGG - Intronic
1035224553 7:157426116-157426138 GGGCTGGGGAGTTGGTTTACTGG + Intergenic
1038408461 8:27340354-27340376 GGTTGGGTGAGGTGCTTTACAGG + Intronic
1039291830 8:36103878-36103900 GGGTACATGAGATACTTTACAGG + Intergenic
1039591831 8:38756481-38756503 GGGCATGAGAGATGCTCTAAAGG + Intronic
1048397866 8:134031925-134031947 AGGAAGGTGATATGCTTTAGTGG - Intergenic
1048589618 8:135809301-135809323 GAACAGATGAGATGCTATACAGG + Intergenic
1049447605 8:142638584-142638606 GGGGAGGTGAGTCGCTTCACAGG + Intergenic
1049512771 8:143038101-143038123 AGGCAGGTGAGCTGCTTAAGAGG - Intergenic
1050035474 9:1431410-1431432 GGGCAGATGAGCTGCTGGACAGG + Intergenic
1051364195 9:16309472-16309494 GGGCAGGTCAGAAGCTCTTCGGG + Intergenic
1056629861 9:88284257-88284279 AGGCAGGTTAGATACTTCACTGG - Intergenic
1057785743 9:98086259-98086281 GGACAGGTCAGATGCTTGCCTGG + Exonic
1061484750 9:130914584-130914606 GGGCAGGTGAGCTGATGTACAGG + Intronic
1062177654 9:135173193-135173215 GGGGAGGGGAGATGCTGAACTGG - Intergenic
1186331726 X:8541675-8541697 GGACATGTGAAATGCTTTATAGG - Intronic
1188184636 X:27098875-27098897 AGGCAGGAGAATTGCTTTACTGG - Intergenic
1188529827 X:31127633-31127655 GGGAAAGGGAGATGCTGTACAGG - Intronic
1189150589 X:38702317-38702339 GGGCAGGGGAAATGCTTTGGAGG + Intergenic
1189311756 X:40023988-40024010 TGTCAGGTGTGATGCTATACAGG - Intergenic
1190470102 X:50770131-50770153 GGGCAGGGGAGTTGCTGTGCTGG - Intronic
1193949108 X:87776356-87776378 TGGCAGGTGAGTGGCTTTTCAGG + Intergenic
1195116381 X:101702863-101702885 GGGGAGGTGGGATGCTTAATGGG + Intergenic
1197467948 X:126829358-126829380 GTGCAGGAGAGATGCTTTTATGG - Intergenic
1199519808 X:148722790-148722812 GGGCAGTTGAGATGCTACAGTGG - Intronic
1201430889 Y:13900943-13900965 GGACATGTGAAATGCTTTATAGG + Intergenic