ID: 950266369

View in Genome Browser
Species Human (GRCh38)
Location 3:11576134-11576156
Sequence CCACGTTAGCAACTGTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950266363_950266369 0 Left 950266363 3:11576111-11576133 CCGGTAAAGCATCTCACCTGCCC 0: 1
1: 0
2: 0
3: 20
4: 119
Right 950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950266369 Original CRISPR CCACGTTAGCAACTGTTGCC AGG Intronic
908541026 1:65122115-65122137 CCGCGTGAGCCACTGTTCCCCGG + Intergenic
920241608 1:204555989-204556011 CCACATTTGCTACTGTTGACAGG - Exonic
1073434514 10:103508111-103508133 CCACTTTCCCAGCTGTTGCCTGG - Intronic
1089806186 11:121092974-121092996 CCACCTTAGCATCTGCTTCCTGG - Intergenic
1101800245 12:108015730-108015752 CCACGTTACCAAGTGTTCCCAGG - Intergenic
1109265494 13:60194264-60194286 CCATGTTACCAACTGTTACTTGG - Intergenic
1113258925 13:108538843-108538865 CCAAGTTTGCAACTGGTGACTGG - Intergenic
1114928085 14:27430758-27430780 CCTCGTTAGAAACTATTGCCAGG + Intergenic
1122138146 14:99646219-99646241 CCAAGTGGGCAAATGTTGCCTGG + Intronic
1130080437 15:80728113-80728135 CCACCTTGTAAACTGTTGCCAGG + Intronic
1135257934 16:20956222-20956244 AAACGTTAGCAACTCTGGCCGGG - Intronic
1141161101 16:81629665-81629687 CCATTTTAGCAGCTGTGGCCAGG + Intronic
1142340581 16:89519675-89519697 AAATGTTAGCAACTGCTGCCGGG - Intronic
1148617041 17:49008688-49008710 CATGGTTAGCAACTGTAGCCTGG + Intronic
1149651839 17:58280586-58280608 CCACCTTGGGAACTGTTACCTGG + Exonic
1152202457 17:78955047-78955069 CCACGTTCCCACCTGGTGCCGGG + Intergenic
1153298889 18:3575522-3575544 CAATGTAACCAACTGTTGCCAGG + Intronic
1158704457 18:59779301-59779323 CACAGTCAGCAACTGTTGCCAGG + Intergenic
1163760323 19:19132931-19132953 TCAAGTTAGCATCTGTTTCCTGG - Intronic
927042392 2:19242439-19242461 CAAAGTTAGCAATTGTTGCTTGG + Intergenic
937500337 2:122471608-122471630 CCACATTTTCAACTGTTTCCTGG - Intergenic
941623182 2:167801825-167801847 CCATATTAGCAAGTGTTGCATGG + Intergenic
945275530 2:207983910-207983932 CCACTTCACCCACTGTTGCCAGG + Intronic
946073626 2:217055365-217055387 CTACTTTAGCATCTGATGCCAGG + Intergenic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1174916933 20:54663458-54663480 CCACTTTAGGAACTGTTGTGTGG + Intergenic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
952131576 3:30370293-30370315 CCATGGTCCCAACTGTTGCCAGG - Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
971691050 4:29836645-29836667 CCAAGATAACTACTGTTGCCTGG + Intergenic
984904347 4:184612930-184612952 CCACCTTAGCACGTGTTGTCAGG - Intergenic
985965545 5:3336670-3336692 CCACGATAGCAGCTGGTCCCCGG + Intergenic
998322355 5:141244628-141244650 CCACCTCAGCAACTGTAGCTGGG - Intergenic
1006616022 6:35327506-35327528 GCGTGTTAGCAACTATTGCCAGG + Intergenic
1013935380 6:115587496-115587518 CCCCTGTAGCAACTTTTGCCTGG - Intergenic
1017307822 6:152939710-152939732 ATAAATTAGCAACTGTTGCCAGG + Intergenic
1027506015 7:79017560-79017582 CCTAGTTAGGAACTGTTGCTGGG - Intronic
1032563020 7:132912300-132912322 TCTGGTTAGTAACTGTTGCCTGG + Intronic
1036780691 8:11644961-11644983 CCATGTTAGCATCTGTTTCTGGG + Intergenic
1039893293 8:41698765-41698787 TCACATTAGAAACTATTGCCAGG - Intronic
1040610880 8:48980864-48980886 CTACTTTAGCAACTGTAACCTGG + Intergenic
1043654509 8:82645716-82645738 CCAGGTTTGCAACTGGTGTCTGG - Intergenic
1048378561 8:133844340-133844362 CCACCTTAGAGACTGTTTCCTGG - Intergenic
1049473924 8:142788205-142788227 CCACATTTGCATCTGGTGCCTGG + Intergenic
1052915448 9:33921738-33921760 CCACGTGGGCAACTGTTTCAGGG - Exonic
1057913029 9:99035020-99035042 CCAGGTAAGCCTCTGTTGCCAGG - Exonic
1058205401 9:102099983-102100005 CCACGTTGGCACCTATTTCCTGG + Intergenic
1061950218 9:133931894-133931916 CCACCTAAGCAACTGGTGCACGG - Intronic