ID: 950270975

View in Genome Browser
Species Human (GRCh38)
Location 3:11614601-11614623
Sequence CCAGCCATCCAGGTTTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950270972_950270975 -5 Left 950270972 3:11614583-11614605 CCAAGTCAGATATCTCAGCCAGC 0: 1
1: 0
2: 0
3: 10
4: 119
Right 950270975 3:11614601-11614623 CCAGCCATCCAGGTTTCCCACGG 0: 1
1: 0
2: 4
3: 32
4: 296
950270971_950270975 -4 Left 950270971 3:11614582-11614604 CCCAAGTCAGATATCTCAGCCAG 0: 1
1: 0
2: 0
3: 16
4: 153
Right 950270975 3:11614601-11614623 CCAGCCATCCAGGTTTCCCACGG 0: 1
1: 0
2: 4
3: 32
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950270975 Original CRISPR CCAGCCATCCAGGTTTCCCA CGG Intronic