ID: 950284493

View in Genome Browser
Species Human (GRCh38)
Location 3:11733964-11733986
Sequence AAGCAGATGGAGAAAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950284484_950284493 25 Left 950284484 3:11733916-11733938 CCAGCCTCTGGGGCCCCAGAGTT No data
Right 950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG No data
950284486_950284493 12 Left 950284486 3:11733929-11733951 CCCCAGAGTTCATTGCATGACCC No data
Right 950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG No data
950284485_950284493 21 Left 950284485 3:11733920-11733942 CCTCTGGGGCCCCAGAGTTCATT No data
Right 950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG No data
950284488_950284493 10 Left 950284488 3:11733931-11733953 CCAGAGTTCATTGCATGACCCTC No data
Right 950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG No data
950284489_950284493 -8 Left 950284489 3:11733949-11733971 CCCTCTTTAGCCAGCAAGCAGAT No data
Right 950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG No data
950284490_950284493 -9 Left 950284490 3:11733950-11733972 CCTCTTTAGCCAGCAAGCAGATG No data
Right 950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG No data
950284487_950284493 11 Left 950284487 3:11733930-11733952 CCCAGAGTTCATTGCATGACCCT No data
Right 950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950284493 Original CRISPR AAGCAGATGGAGAAAGAGCA TGG Intergenic
No off target data available for this crispr