ID: 950287366

View in Genome Browser
Species Human (GRCh38)
Location 3:11755361-11755383
Sequence TTGTGGGGAAGGAATGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950287358_950287366 4 Left 950287358 3:11755334-11755356 CCCAGGAAGAAACTAAGAAGAGT No data
Right 950287366 3:11755361-11755383 TTGTGGGGAAGGAATGCGGAAGG No data
950287357_950287366 18 Left 950287357 3:11755320-11755342 CCTCTCACAAGGGACCCAGGAAG No data
Right 950287366 3:11755361-11755383 TTGTGGGGAAGGAATGCGGAAGG No data
950287359_950287366 3 Left 950287359 3:11755335-11755357 CCAGGAAGAAACTAAGAAGAGTC No data
Right 950287366 3:11755361-11755383 TTGTGGGGAAGGAATGCGGAAGG No data
950287356_950287366 19 Left 950287356 3:11755319-11755341 CCCTCTCACAAGGGACCCAGGAA No data
Right 950287366 3:11755361-11755383 TTGTGGGGAAGGAATGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950287366 Original CRISPR TTGTGGGGAAGGAATGCGGA AGG Intergenic
No off target data available for this crispr