ID: 950287899

View in Genome Browser
Species Human (GRCh38)
Location 3:11759459-11759481
Sequence GTTGAAGGAGTTCCCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950287899_950287908 28 Left 950287899 3:11759459-11759481 CCTCCTGAGGGAACTCCTTCAAC No data
Right 950287908 3:11759510-11759532 AACACTGGAATAAAGACACCTGG No data
950287899_950287906 13 Left 950287899 3:11759459-11759481 CCTCCTGAGGGAACTCCTTCAAC No data
Right 950287906 3:11759495-11759517 GATGTCCTCACGTGTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950287899 Original CRISPR GTTGAAGGAGTTCCCTCAGG AGG (reversed) Intergenic
No off target data available for this crispr