ID: 950288611

View in Genome Browser
Species Human (GRCh38)
Location 3:11765131-11765153
Sequence AGTTCTTTTGGAGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950288611_950288615 6 Left 950288611 3:11765131-11765153 CCTGTTTTTCCTCCAAAAGAACT No data
Right 950288615 3:11765160-11765182 ATAAGCCTTTTCTCTGGCTCTGG No data
950288611_950288614 0 Left 950288611 3:11765131-11765153 CCTGTTTTTCCTCCAAAAGAACT No data
Right 950288614 3:11765154-11765176 GACAATATAAGCCTTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950288611 Original CRISPR AGTTCTTTTGGAGGAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr