ID: 950288618

View in Genome Browser
Species Human (GRCh38)
Location 3:11765193-11765215
Sequence ACCCATGATCAAGTGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950288613_950288618 27 Left 950288613 3:11765143-11765165 CCAAAAGAACTGACAATATAAGC No data
Right 950288618 3:11765193-11765215 ACCCATGATCAAGTGGACCCAGG No data
950288616_950288618 5 Left 950288616 3:11765165-11765187 CCTTTTCTCTGGCTCTGGTTAAG No data
Right 950288618 3:11765193-11765215 ACCCATGATCAAGTGGACCCAGG No data
950288612_950288618 30 Left 950288612 3:11765140-11765162 CCTCCAAAAGAACTGACAATATA No data
Right 950288618 3:11765193-11765215 ACCCATGATCAAGTGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950288618 Original CRISPR ACCCATGATCAAGTGGACCC AGG Intergenic
No off target data available for this crispr