ID: 950294615

View in Genome Browser
Species Human (GRCh38)
Location 3:11818187-11818209
Sequence TGTCAGGGGGAGTAGAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 497}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950294609_950294615 0 Left 950294609 3:11818164-11818186 CCTTTGTTGGAGAGGGAGCAAAT 0: 1
1: 0
2: 0
3: 22
4: 204
Right 950294615 3:11818187-11818209 TGTCAGGGGGAGTAGAGAGGTGG 0: 1
1: 0
2: 1
3: 46
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950294615 Original CRISPR TGTCAGGGGGAGTAGAGAGG TGG Intronic
900120332 1:1046104-1046126 TGTGAAGGGGAGTGGGGAGGAGG + Intronic
902464312 1:16606290-16606312 TGTCAGGGGTGGAGGAGAGGAGG + Intronic
903156515 1:21447419-21447441 TGTCAGGGGTGGAGGAGAGGAGG - Intronic
903541074 1:24096663-24096685 TGTCTTGGGCAGTAGACAGGTGG - Intronic
904261720 1:29291427-29291449 TAACACGGGGAGGAGAGAGGTGG + Intronic
904418771 1:30378239-30378261 TGTCGGGGGAAGGAGAGAGCAGG + Intergenic
904738404 1:32652470-32652492 TGTGGGGGGCAGTAGAGACGAGG - Intronic
904813873 1:33181435-33181457 CGCCAGGGGCAGCAGAGAGGGGG + Exonic
904908579 1:33916959-33916981 AGTCAGTGGGAGTAGGGAGGAGG - Intronic
905472537 1:38204364-38204386 TGAGAGGGGGAGTGGAGAAGTGG + Intergenic
906119872 1:43382296-43382318 TGCCTGGGGGAGGTGAGAGGGGG + Intergenic
906211907 1:44016823-44016845 GGTGAGGGGGAGGAGAGTGGGGG - Intronic
906608918 1:47189006-47189028 TGTCTGGGGCAGGAGAAAGGTGG + Intronic
906943332 1:50275058-50275080 TGCCAGGGGGACCAGAGAGAGGG - Intergenic
908379966 1:63588373-63588395 TTTCAGGGGTAGGAGGGAGGAGG + Intronic
909243177 1:73240506-73240528 TGCCAGGGGGTGGGGAGAGGGGG + Intergenic
909304427 1:74055358-74055380 TGTCAGGGGCAGAAGAGAGGGGG - Intronic
910921160 1:92348817-92348839 TGTAAGGGGGAGAAGAGGGGTGG - Intronic
911105638 1:94129350-94129372 TGTCTGGGTGAGAAGGGAGGGGG - Intergenic
911168982 1:94751498-94751520 TGTCATGGGGTGGGGAGAGGGGG - Intergenic
911649968 1:100376715-100376737 TGTTAGGGGATGAAGAGAGGGGG + Intronic
911790312 1:102006695-102006717 TGTGAGGGGTAGGGGAGAGGAGG - Intergenic
913174139 1:116258410-116258432 GGTTAGGGGGAGGAGGGAGGAGG + Intergenic
913601183 1:120422396-120422418 TGTCAGGGGTGGAGGAGAGGAGG - Intergenic
913993051 1:143633274-143633296 TGTCAGGGGTGGAGGAGAGGAGG + Intergenic
914085861 1:144454205-144454227 TGTCAGGGGTGGAGGAGAGGAGG + Intronic
914191758 1:145418185-145418207 TGTCAGGGGTGGAGGAGAGGAGG + Intergenic
914353921 1:146865283-146865305 TTTCAGGGGGGGTGGAGAGATGG + Intergenic
914362369 1:146945952-146945974 TGTCAGGGGTGGAGGAGAGGAGG - Intronic
914489305 1:148141131-148141153 TGTCAGGGGTGGAGGAGAGGAGG + Intronic
914589683 1:149096186-149096208 TGTCAGGGGTGGAGGAGAGGAGG + Intronic
915268765 1:154737086-154737108 GGACTGTGGGAGTAGAGAGGAGG + Intronic
915293729 1:154905060-154905082 ACTCAGGGGGAGCTGAGAGGTGG - Intergenic
915331641 1:155116476-155116498 GGGCAGGGGGAATAGGGAGGAGG - Intergenic
915467370 1:156105420-156105442 TCTCAGGAGGAGTGGGGAGGGGG - Intronic
917265122 1:173212536-173212558 TTTCACGGGGAGGAGGGAGGAGG + Intergenic
918756683 1:188346211-188346233 TGTCAGGGGTAGTGGAGGGATGG + Intergenic
919628485 1:199936036-199936058 AGGCAGCGGGAATAGAGAGGAGG - Intergenic
920137561 1:203782224-203782246 CCTCAGTTGGAGTAGAGAGGTGG - Intergenic
920695550 1:208179126-208179148 GGTTATGGGGAGGAGAGAGGCGG + Intronic
921460513 1:215420856-215420878 TGTCAGGGGCTGCAGGGAGGGGG - Intergenic
922024398 1:221737312-221737334 TGTCTTGGGGAGCAAAGAGGAGG - Intronic
922534184 1:226367808-226367830 GGCCTGGGGGAGTTGAGAGGTGG + Intronic
922541681 1:226424984-226425006 TGGCAGTGGGAGGAGAGAAGAGG + Intergenic
923012873 1:230102864-230102886 TTGCAGGGGCAGTGGAGAGGCGG + Intronic
923998433 1:239523071-239523093 TCTCAGGTGGATTAGACAGGTGG - Intronic
924769859 1:247069850-247069872 AGTCAGGGGGACTAGGGAAGAGG + Intronic
924880507 1:248157030-248157052 TGTCATGGGGTGGAGGGAGGGGG - Intergenic
1063181290 10:3602975-3602997 TGTCAGGGGGTGTGGGGTGGGGG - Intergenic
1063540129 10:6924845-6924867 GGTCATGGAGAGTAGGGAGGAGG - Intergenic
1064287951 10:14009211-14009233 TTTCAGGAGGAGTAGAGATGGGG - Intronic
1064510971 10:16091038-16091060 TGTCATGGGGTGGGGAGAGGAGG + Intergenic
1067039146 10:42939829-42939851 TGGCACGGGAAGGAGAGAGGTGG + Intergenic
1067342241 10:45415430-45415452 TGTCATGGGGTGGGGAGAGGGGG + Intronic
1068819599 10:61358992-61359014 TGTCAGGGGCTGCAGAGAGAGGG - Intergenic
1069088508 10:64170945-64170967 AGCCAGCGGAAGTAGAGAGGCGG - Intergenic
1070504961 10:77104824-77104846 TGTGAGAGGGAGGAGAGAGCTGG + Intronic
1071088744 10:81894914-81894936 TGCCAGGGGCTGTGGAGAGGTGG + Intronic
1071518699 10:86315751-86315773 TGTGAGTGGGAGTAGATAGATGG - Intronic
1071847461 10:89535470-89535492 TGTCAGGGAGAGGGAAGAGGGGG + Exonic
1072734007 10:97867083-97867105 TGTCATGGGGAGCTGAGAGGGGG - Exonic
1073182856 10:101595990-101596012 TGTGTGGAGGAGTAGAGAAGTGG - Intronic
1073510801 10:104041253-104041275 TGGGAGGGGGAGGTGAGAGGTGG - Intronic
1073964631 10:108974834-108974856 TCTCTGGTGGAGGAGAGAGGTGG + Intergenic
1074152707 10:110771742-110771764 GGTGAAGGGGAGTAGGGAGGAGG + Intronic
1074297389 10:112203101-112203123 TGGTAGGGGGAGCAGAGGGGAGG + Intronic
1074894563 10:117763782-117763804 TGTCAGAGAGGGTAGATAGGAGG + Intergenic
1075047801 10:119159755-119159777 TGGCAGGAAGAGAAGAGAGGAGG + Intronic
1075833083 10:125427897-125427919 TGTGAGGGGGACAAAAGAGGAGG - Intergenic
1076121849 10:127942702-127942724 TGTCAGGGGCTGGAGAGAGAGGG + Intronic
1076313267 10:129523077-129523099 TGTCATGAGGAGTAAAGAGGTGG - Intronic
1076511777 10:131019389-131019411 TGTCAGGGCGAGGAGAGGGACGG - Intergenic
1078452997 11:11454124-11454146 TTTCAGAGGGAGTAGAAAGGGGG + Intronic
1078963043 11:16302064-16302086 TGGCAGGGGAAGAAGAGAGAAGG - Intronic
1079693277 11:23446423-23446445 TGTCATGGGGTGGAGGGAGGGGG + Intergenic
1079808817 11:24969148-24969170 GGGCAGGAGGAGTAGAAAGGAGG - Intronic
1080367463 11:31592073-31592095 TGCCAGGGGCAGGAGAGAAGGGG + Intronic
1080475042 11:32582879-32582901 TGCCAGGGGCTGGAGAGAGGTGG + Intergenic
1080475373 11:32585082-32585104 GGGCGGGGGGAGGAGAGAGGGGG - Intronic
1080506670 11:32921327-32921349 TGCCAGGGGCAGAAGAGAGGAGG + Intronic
1081344377 11:41965091-41965113 TGTCATGGGGTGGGGAGAGGGGG - Intergenic
1082719986 11:56662325-56662347 TGTGAGGTGGAGCAGAGGGGAGG - Intergenic
1083270886 11:61571986-61572008 GGGCAGGGGGAGGAGAGAGCAGG - Intronic
1083455448 11:62775785-62775807 TGTCAGAGCGAGAAGAGCGGCGG + Exonic
1084091018 11:66879430-66879452 TGTCAGGTGTTGCAGAGAGGGGG + Intronic
1084309237 11:68306871-68306893 TGTCAGAAGGAGGAGAGAAGTGG + Intergenic
1084829809 11:71760230-71760252 TGAATGGGGGAGTAGTGAGGTGG - Intergenic
1085634663 11:78149273-78149295 TCTCTGGGGGAGCAGGGAGGCGG - Intergenic
1086504704 11:87493280-87493302 TGACAGGAGGAGTGGACAGGAGG + Intergenic
1086987794 11:93268909-93268931 TGTCAGGGTGAGTAGTTTGGTGG - Intergenic
1087094205 11:94304831-94304853 TCTCAGGGGGAGGAGGGAGCAGG + Intergenic
1088111644 11:106268073-106268095 TGGCAGGGGGAGTGGGGCGGGGG + Intergenic
1088846507 11:113672900-113672922 TGACAGGGGCAGTAGAGTAGGGG - Intergenic
1089391053 11:118102152-118102174 TGTCGGGGGGAGGCGGGAGGAGG - Intronic
1089432859 11:118437163-118437185 GGTCAGGGGGAGGAGAGCGGGGG - Intronic
1089554026 11:119305001-119305023 TGCCAGGGAGAGCAGAGATGTGG + Exonic
1089580349 11:119477794-119477816 TGTCTGGGGGTGAAGAGAGGTGG + Intergenic
1089700518 11:120241317-120241339 TTTCTGGGAGAGTAGGGAGGAGG + Intronic
1091080773 11:132665562-132665584 TGGCTGTGGGAGGAGAGAGGAGG + Intronic
1091285325 11:134405556-134405578 CGTCTGAGGGAGAAGAGAGGAGG + Intronic
1091755924 12:3051490-3051512 TGTCAAGGGAAGGGGAGAGGAGG - Intergenic
1091774732 12:3177022-3177044 TGGCCGGGGGAGTGGGGAGGTGG + Intronic
1092030341 12:5278556-5278578 TGGCAGGGTGAGGAGGGAGGGGG - Intergenic
1092326198 12:7534020-7534042 TGTCATGGGGTGGAGGGAGGGGG + Intergenic
1092602001 12:10077411-10077433 TTTTGGGGGGAGCAGAGAGGTGG - Intronic
1092644875 12:10559482-10559504 TGAAAGCGGGAGAAGAGAGGAGG - Intergenic
1094067277 12:26374690-26374712 AGTAAAGGGGAGTACAGAGGAGG + Intronic
1095179064 12:39126124-39126146 TGTTAGGGGGAGTAAAAATGTGG - Intergenic
1095384240 12:41631391-41631413 TGTATGGGGGAGGACAGAGGAGG + Intergenic
1096621425 12:52867993-52868015 TGCCAGGGGGAACTGAGAGGTGG + Intergenic
1096772535 12:53945236-53945258 GGTCAGGTGGAGTGGAGATGAGG - Exonic
1098357974 12:69629001-69629023 GGACAGGGGGAGGAGAGATGGGG + Intergenic
1099918484 12:88926536-88926558 TATCAGTGGGAGTAGTGAGAAGG + Intergenic
1100926812 12:99558174-99558196 GGTCAGTGGGAGTGGAGTGGCGG + Intronic
1100949262 12:99827376-99827398 TGGTAGGGGGAGTAGAACGGGGG + Intronic
1101037844 12:100722531-100722553 TGTCAAGGGGAAAAGAGAGGGGG - Intronic
1102104909 12:110313181-110313203 AATCATGGGGAGTAGAGAGGAGG - Intronic
1102416371 12:112766491-112766513 TGGCAGGGGGAATAGAGAAAAGG + Intronic
1102555719 12:113725257-113725279 TGGCAGAGGGAGGAGACAGGAGG + Intergenic
1103220277 12:119238733-119238755 TTTCAGAGGAAGTATAGAGGAGG - Intergenic
1103322798 12:120101713-120101735 TGTCTGGGGAAGCAGACAGGTGG - Intronic
1104420473 12:128630476-128630498 AGTCAGGGGGCCTAGTGAGGAGG - Intronic
1105614449 13:21999696-21999718 TTTCAGGGAAAGAAGAGAGGTGG + Intergenic
1105623014 13:22087420-22087442 TGTCAGCGGAAGAGGAGAGGTGG - Intergenic
1105795116 13:23843965-23843987 TGTTTGTGGGAGAAGAGAGGAGG + Intronic
1106229929 13:27813953-27813975 TGTCAGGGGCAGGAGGGTGGCGG - Intergenic
1106674207 13:31940482-31940504 TGTCAGGGGTAGTGTAGAGAGGG + Intergenic
1107522743 13:41199624-41199646 TGTAAGGGGTAGTGGGGAGGTGG + Intergenic
1107994936 13:45850602-45850624 GGTTAGGGGTAGTAGGGAGGAGG - Intronic
1108081268 13:46738926-46738948 TGGCAGGGAGAGGAGAGAGGTGG - Intronic
1108211748 13:48146343-48146365 TGCCAAGGGGAGTGAAGAGGGGG - Intergenic
1108327688 13:49350024-49350046 TGTCAGGGGCTGGAGGGAGGAGG + Intronic
1110746855 13:79064070-79064092 TTTCAGGGGAAGAAGAGAGAAGG - Intergenic
1110893987 13:80726334-80726356 TGTCAGGGGAAGGGGAGGGGAGG - Intergenic
1111329195 13:86742004-86742026 TGTTGGGGGGAGAGGAGAGGAGG + Intergenic
1111550957 13:89811943-89811965 TGACAGGGTGAGTGGAGAGTGGG - Intergenic
1111992699 13:95132898-95132920 TGCCAGGGGGTGGAGAGAAGGGG + Intronic
1112951108 13:104997876-104997898 TGTCATGGGGTGTGGGGAGGGGG + Intergenic
1113728879 13:112625476-112625498 TGTCTGGGGGAGCCCAGAGGTGG + Intergenic
1113755376 13:112807822-112807844 TCTCAAGGGGAGCAGAGAGAAGG + Intronic
1113767054 13:112888271-112888293 GGTCATGGGGAGAAGAGGGGAGG + Intergenic
1113954343 13:114089239-114089261 TGTTCGGAGGAGGAGAGAGGAGG + Intronic
1115416977 14:33146804-33146826 GGGCAGGAGGAGTAGAGAAGAGG + Intronic
1115596187 14:34911648-34911670 TGTCAAGGGCTGTAGGGAGGGGG + Intergenic
1115725010 14:36204278-36204300 TGCCAGGGGGAGTGGGGAGAAGG + Intergenic
1116724377 14:48544085-48544107 TGTCATGGGGTGTGGGGAGGGGG - Intergenic
1117210417 14:53492437-53492459 TGTCAGGGGCTGTAGGGAGATGG - Intergenic
1117217313 14:53564899-53564921 TGGCAGGGGGAGGTGGGAGGAGG + Intergenic
1117543623 14:56772369-56772391 TGTTAGGGTGAGATGAGAGGAGG - Intergenic
1119193646 14:72701548-72701570 GGTCGGGGGGAGCAGGGAGGAGG + Intronic
1119531499 14:75364463-75364485 GGTCAGAGGGAGGAGATAGGAGG + Intergenic
1119624368 14:76159427-76159449 TGTCCACGGGAGTAGAGAAGGGG - Intronic
1119716895 14:76866131-76866153 TGTCAGAGAGAGGGGAGAGGAGG + Intronic
1120332956 14:83116941-83116963 TGGCAAGGGGAGGGGAGAGGAGG - Intergenic
1120893404 14:89509029-89509051 TATCAGTGGGGGTAGAGCGGAGG - Intronic
1121348953 14:93157425-93157447 TGGCAGGAGGAATAGAGAAGGGG - Intergenic
1122319073 14:100842534-100842556 TGTCAGGGGAAGTTGTAAGGGGG + Intergenic
1122557891 14:102591621-102591643 TGCCGGGGGGAGTAGGGAGGCGG + Intergenic
1122621830 14:103062605-103062627 TGCCAGGGAGGGTAAAGAGGTGG + Intergenic
1122621839 14:103062642-103062664 TGCCAGGGAGGGTAAAGAGGTGG + Intergenic
1122621848 14:103062679-103062701 TGCCAGGGAGGGTAAAGAGGTGG + Intergenic
1122621857 14:103062716-103062738 TGCCAGGGAGGGTAAAGAGGTGG + Intergenic
1122621866 14:103062753-103062775 TGCCAGGGAGGGTAAAGAGGTGG + Intergenic
1122621875 14:103062790-103062812 TGCCAGGGAGGGTAAAGAGGTGG + Intergenic
1122621884 14:103062827-103062849 TGCCAGGGAGGGTAAAGAGGTGG + Intergenic
1122624811 14:103079095-103079117 TGGCAGTGGCAGGAGAGAGGGGG + Intergenic
1124211824 15:27770428-27770450 TCTCAGGGAGAGCAGACAGGCGG - Intronic
1125261492 15:37830850-37830872 GGTTTGGGGAAGTAGAGAGGAGG - Intergenic
1125363193 15:38886468-38886490 TCTCAGGGGGTGTAGTGGGGTGG - Intergenic
1126096895 15:45096279-45096301 GGGAAGAGGGAGTAGAGAGGAGG - Intronic
1126409457 15:48356935-48356957 TGTCAGTGGGACTTTAGAGGGGG + Intergenic
1126566649 15:50108198-50108220 GGGGTGGGGGAGTAGAGAGGCGG - Intronic
1127288086 15:57547800-57547822 TGGCAGGGGGAGTGATGAGGGGG - Exonic
1127505749 15:59596312-59596334 TGGCAGGGAGAGAAGAGAAGAGG + Intronic
1128375428 15:67071146-67071168 TGGGAGGAGGTGTAGAGAGGAGG + Intronic
1128451054 15:67806107-67806129 TGTCAGGGGAAGTGGGGAGGGGG - Intronic
1128703149 15:69819009-69819031 TGATAGGGAAAGTAGAGAGGGGG - Intergenic
1129244700 15:74272179-74272201 TGGGAGGGGGAGTGGGGAGGTGG - Intronic
1130199449 15:81811324-81811346 TGTGCTGGGGAGGAGAGAGGAGG - Intergenic
1130204642 15:81864738-81864760 TGCCAGGGGTTGAAGAGAGGAGG + Intergenic
1131131700 15:89904566-89904588 TGCCAGGGCCAGGAGAGAGGAGG - Intronic
1132925735 16:2428438-2428460 TGTCTGGTGGAGGACAGAGGGGG - Intergenic
1133074813 16:3271784-3271806 TGTGAGGGAGGGTAGAGATGGGG - Intronic
1133234330 16:4380851-4380873 TGTCCCTGGGAGCAGAGAGGAGG - Exonic
1133607294 16:7400328-7400350 GTTCAGTGGGAGGAGAGAGGGGG - Intronic
1134115552 16:11545233-11545255 TGCCAGGGGTTGTGGAGAGGAGG + Intergenic
1135285611 16:21190333-21190355 TTTAAGGGGAAGTTGAGAGGGGG - Intergenic
1136128534 16:28203321-28203343 TGACAGGGGGAAAGGAGAGGTGG + Intronic
1136219655 16:28820553-28820575 TGTCAATGAGGGTAGAGAGGTGG + Intergenic
1136655169 16:31705325-31705347 TGTCAGGAACAGGAGAGAGGAGG - Intergenic
1136748026 16:32609244-32609266 TGTCATAGGGAGCAGCGAGGGGG - Intergenic
1137943170 16:52708795-52708817 CCTCAAGGGGAGTAGAGAGAGGG + Intergenic
1139762051 16:69192227-69192249 TGGCAGTGGGAATAGAGAGGAGG + Intronic
1140161696 16:72502502-72502524 TGTCAGTGAGAGTAGAAAGTAGG + Intergenic
1140341416 16:74167883-74167905 TGTCAGGAGGTGTGGGGAGGGGG - Intergenic
1140660903 16:77190807-77190829 TGGCGGGGGGAGTAGACAGCGGG + Intergenic
1141067659 16:80927199-80927221 TGTCAGGGGGCCGGGAGAGGTGG - Intergenic
1141492262 16:84382131-84382153 TGTCAGGGGGTGTGGGGAGAGGG - Intronic
1141946050 16:87310816-87310838 GGTCAGGGAGAGTGCAGAGGGGG + Intronic
1141977655 16:87528174-87528196 TGTCAGGGGCCGGAGGGAGGAGG - Intergenic
1203050163 16_KI270728v1_random:868451-868473 TGTCATAGGGAGCAGCGAGGGGG - Intergenic
1143847746 17:9785887-9785909 TGTGGGGAGGAGCAGAGAGGGGG + Intronic
1143923315 17:10348227-10348249 TGTCAGGGGCAAGAGAGAGAAGG - Intronic
1144684361 17:17216277-17216299 TGTCATGGGTTGTGGAGAGGAGG - Intronic
1145885652 17:28380967-28380989 TCTCAAGGGGAGGAGGGAGGGGG + Intronic
1145934519 17:28706938-28706960 TATGAGGGGGAGGGGAGAGGGGG + Intronic
1147137634 17:38443429-38443451 TGGCAGGGGGAGGCGGGAGGAGG + Intronic
1147444697 17:40467653-40467675 TGTCAGGGGGTGTGGAGGAGGGG - Intergenic
1147946983 17:44085960-44085982 TTTCAGGAGGAGTCAAGAGGGGG - Intronic
1148262056 17:46192954-46192976 CGTCGGGGGGAGGAGAGCGGCGG - Intronic
1148474775 17:47920951-47920973 TGTCAGGGGCTGCAGAGAGGAGG - Intronic
1148814172 17:50314705-50314727 AGTCATGGGGAGTGGGGAGGTGG + Intergenic
1149548050 17:57518964-57518986 TGAGATGGGGTGTAGAGAGGAGG - Intronic
1149696636 17:58621442-58621464 TCTCAGGGAGAGGAGAGAGAGGG + Intronic
1150483186 17:65526374-65526396 TGTCAGGGGCTGGAGTGAGGGGG + Intergenic
1150878398 17:68995507-68995529 TGTCAGGGTGTGTGGAGATGGGG - Intronic
1151006582 17:70444451-70444473 AGTATGGGGTAGTAGAGAGGAGG + Intergenic
1152464300 17:80457097-80457119 TATCTGGGGGAGTAGCCAGGAGG - Intergenic
1152627558 17:81394809-81394831 GGTCATGGGGAGGAGAGAGCCGG + Intergenic
1153980450 18:10304398-10304420 TGACAGGGAGAGTGGAGAGTGGG + Intergenic
1154080398 18:11250526-11250548 TGTTAGGGGAAGTAGGGAGTTGG - Intergenic
1154491431 18:14925224-14925246 TGTCAGGAGGAGTGGAGACATGG + Intergenic
1155558495 18:27049184-27049206 TGGCAGTGGGAGTGGAGAGGAGG + Intronic
1155831184 18:30516385-30516407 TGTCATGGGGTGGAGGGAGGGGG + Intergenic
1157622754 18:49025775-49025797 TGCCAGGGTGTGTGGAGAGGGGG - Intergenic
1158479121 18:57804756-57804778 TGCCAGGGGAAGTAAAAAGGAGG + Intergenic
1158773488 18:60550435-60550457 TCTCATGGGGAGGTGAGAGGGGG + Intergenic
1159596305 18:70385683-70385705 GTTCTGGGGGAGTTGAGAGGAGG + Intergenic
1160082735 18:75744861-75744883 TGTCAGGGGGATGATGGAGGTGG + Intergenic
1160118211 18:76102067-76102089 TAGCAGGGAGAGGAGAGAGGTGG - Intergenic
1161027037 19:2041641-2041663 GGTTAGGGGGAGTACAGAGTAGG + Intronic
1161148688 19:2695275-2695297 CGTCCAGGGGGGTAGAGAGGGGG - Intronic
1161203358 19:3028280-3028302 TGCCAGGGTGAGGGGAGAGGCGG - Intronic
1162954619 19:14091069-14091091 TGCCGGGGGGAGTGGAGAGGGGG + Intergenic
1164760932 19:30727797-30727819 TGTGAGGAGGAGGAGAGAGTCGG + Intergenic
1165861231 19:38910660-38910682 TGGCAGGGGGCCGAGAGAGGCGG - Exonic
1165897985 19:39154922-39154944 TGACAGGGGGTGGACAGAGGTGG + Intronic
1165904829 19:39187509-39187531 GGGCAGGGGTAGTAGAAAGGTGG - Intergenic
1166301992 19:41916117-41916139 TGGCAGGGAGAGAAGGGAGGAGG - Intronic
1166572411 19:43805996-43806018 TGCCAGGGGGTGTGGGGAGGAGG - Intronic
1166622703 19:44316823-44316845 TGGCAAGGGTAGTAGGGAGGAGG - Intergenic
1166828617 19:45625054-45625076 AGTCAGGGGGACCAGAGAGAGGG - Intronic
1166939334 19:46353364-46353386 GGGCAGGGGGAGGAGAGATGAGG - Intronic
1167212007 19:48139340-48139362 TGTCAGGGTGAGGAGGCAGGAGG - Intronic
1168056655 19:53868321-53868343 GGTCTGCGGGAGTAGAGAGATGG + Intronic
1168487797 19:56779361-56779383 TGTCAAGGTGAGTAGTGAGGGGG - Exonic
925157508 2:1658790-1658812 GGTCTGGGAGAGTAGAGTGGGGG - Intronic
925943786 2:8842475-8842497 TGAGAGGTGGGGTAGAGAGGTGG - Intergenic
926099810 2:10107470-10107492 TGTCAGGGGCTATAGGGAGGGGG + Intergenic
926387829 2:12354834-12354856 TGACAGGTGGAGAAGAGAGTTGG - Intergenic
927057873 2:19384116-19384138 TGTCGTGGGGTGGAGAGAGGTGG - Intergenic
927293375 2:21426033-21426055 TGACATGGGGAGTATAGATGGGG - Intergenic
928245011 2:29619502-29619524 TGTCAGGGAGAGCAGAGAGAAGG - Intronic
928838861 2:35580912-35580934 TGTCAGTGGGAGTCCAGATGTGG - Intergenic
930227163 2:48805573-48805595 AGACAGAGGGAGAAGAGAGGGGG + Intergenic
931265127 2:60653755-60653777 TATCATGGGGTGTGGAGAGGAGG - Intergenic
931265896 2:60660319-60660341 TGCCAGGGGGTGTAGACAGTGGG + Intergenic
931747880 2:65306770-65306792 TTTATTGGGGAGTAGAGAGGGGG - Intergenic
931879846 2:66556919-66556941 TGGGAGGGGGCGCAGAGAGGGGG + Intronic
931883056 2:66587209-66587231 GGTGAGGGGGAGTAGAGATCAGG + Intergenic
932170177 2:69548069-69548091 TATCAGGGGCTGTGGAGAGGGGG + Intronic
932952575 2:76311027-76311049 TGTGAGAGGGAGAAGAGAGTTGG + Intergenic
933127664 2:78630929-78630951 TGGCAAGGGTAGGAGAGAGGAGG - Intergenic
933719976 2:85391537-85391559 GGTCAGGGGGAGAAGAGAGTGGG - Exonic
934673555 2:96232764-96232786 TGTCCTGTGGAGTAGAGAAGAGG + Intergenic
935302284 2:101703205-101703227 TGGCAGTGGTGGTAGAGAGGAGG + Intronic
936082699 2:109445738-109445760 GGTGTGGGGAAGTAGAGAGGGGG + Intronic
936249167 2:110854203-110854225 TCTGAGGGGAAGAAGAGAGGGGG + Intronic
937132864 2:119526085-119526107 TGTCAAAGGAAGGAGAGAGGAGG - Intergenic
937406574 2:121634976-121634998 TGCCAGGGAGAGTAGGAAGGAGG - Intronic
937908600 2:127064642-127064664 TGTCAGGGGGACCCTAGAGGAGG + Intronic
938100129 2:128492888-128492910 AGTGAGGAGGAGGAGAGAGGAGG - Intergenic
938344449 2:130557199-130557221 TGTGAGGGGGAGTGCAGGGGTGG - Intergenic
938345384 2:130563523-130563545 TGTGAGGGGGAGTGCAGGGGTGG + Intergenic
939756963 2:146126239-146126261 TGTCATGGGGTGGGGAGAGGAGG - Intergenic
939906729 2:147925519-147925541 TGTGAGGGAGTGTAGAGAAGAGG + Intronic
940143498 2:150521686-150521708 TTACAGGGGAAGTGGAGAGGGGG - Intronic
941003167 2:160222044-160222066 AGCCAGGGGGAGTAGGCAGGAGG - Intronic
941542512 2:166804271-166804293 TGCCAGGGGCAGGAGTGAGGCGG + Intergenic
942116487 2:172734716-172734738 AGTCAGGGGGACTGGAGAGAAGG - Intergenic
942616680 2:177798245-177798267 TGTTAGGGGAAGCATAGAGGAGG - Intronic
942656748 2:178221748-178221770 TGTTTTGGGGAGTAGGGAGGAGG + Intronic
942727348 2:179025057-179025079 TGTAAGGAGCAGTAGAGAAGAGG - Intronic
942810115 2:179989067-179989089 GGTCAGGGAGAGTAGGGGGGTGG - Intronic
942927257 2:181448881-181448903 TGTCATGGGGTGCAGGGAGGTGG - Intergenic
943916098 2:193634138-193634160 TGTCATGGGGAGGGGGGAGGCGG + Intergenic
944443379 2:199764860-199764882 GGTCAGGGGGAGTAGGGAAGCGG - Intronic
945901586 2:215543802-215543824 TCTCAGTGGGTGTATAGAGGAGG + Intergenic
946236987 2:218330211-218330233 GGCCAGGGGGAGTAGGAAGGAGG - Intronic
946412040 2:219520293-219520315 GGGCAGGGAGAGGAGAGAGGAGG - Intronic
948091774 2:235301702-235301724 GGGAAGGGGGAGGAGAGAGGTGG - Intergenic
948145733 2:235707124-235707146 TGTCAGTGGGAGGAGAGTAGAGG + Intronic
948346922 2:237306444-237306466 GGACAGGGGGGTTAGAGAGGAGG - Intergenic
948464046 2:238143708-238143730 GGTCAGGGGCTGAAGAGAGGGGG + Intronic
948748232 2:240110867-240110889 GGTGAGGAGGAGAAGAGAGGAGG - Intergenic
948932684 2:241142116-241142138 TGTCTGAGGGTGTAGAGCGGAGG - Intronic
1169274076 20:4221461-4221483 GGTAAGGGGGACCAGAGAGGCGG - Exonic
1169834769 20:9865871-9865893 TGTAAGAAGGAGTAGAGAGCTGG + Intergenic
1170035599 20:11986386-11986408 TGTGGGGTGGAGTGGAGAGGAGG - Intergenic
1170358372 20:15517625-15517647 TGGGAGGGGGAGTAGAGAAAGGG + Intronic
1170862173 20:20116751-20116773 GGTCAGGAAGAGTAGAGGGGTGG - Intronic
1172331838 20:34080815-34080837 TGTCAGGGGCAGGAAAGGGGTGG - Intronic
1172429122 20:34875925-34875947 TTCCAGGGTGAGCAGAGAGGAGG + Intronic
1172563553 20:35910560-35910582 GCTCAGGGGGAGGGGAGAGGTGG - Intronic
1172845973 20:37930268-37930290 GGACAGGGGGATGAGAGAGGTGG + Intronic
1173824039 20:46035936-46035958 TGTCAGGGGGTGGTGAGGGGAGG - Intronic
1174903959 20:54530545-54530567 GGTCATGGGAAGTAGAGAAGAGG - Intronic
1175017201 20:55804579-55804601 TGTGAGGGAGGGCAGAGAGGAGG - Intergenic
1175110520 20:56644840-56644862 TGACAGGGGAAGTGGAGAGTAGG + Intergenic
1175155100 20:56965767-56965789 TGTCAGGGGGGAAAAAGAGGTGG + Intergenic
1179273487 21:39869558-39869580 TGTGAGGGGGAGAAGAGGGCAGG - Intronic
1181693581 22:24581297-24581319 TGTCAGTGGGCATGGAGAGGCGG + Intronic
1181812276 22:25410805-25410827 TGTCAGAAGGAGGAGAGAAGTGG - Intergenic
1181919620 22:26310646-26310668 TGGCAGTGGGAGCAGAGAGGAGG - Intronic
1181954012 22:26575102-26575124 TGTCTGGGGAAGTGGAGGGGCGG - Intronic
1182057540 22:27371524-27371546 TTTCAGGGAGCCTAGAGAGGAGG + Intergenic
1183100834 22:35583136-35583158 TGCCAGTGGGAGGAGGGAGGTGG + Intergenic
1183235098 22:36610911-36610933 AGCCACGGGGAGTAGGGAGGTGG - Intronic
1183640746 22:39090901-39090923 TTTCTGGGGGGGTAGGGAGGAGG + Intergenic
1183949274 22:41343635-41343657 TGTGATGGGGAGTAGAGCAGCGG - Intronic
1184320195 22:43735747-43735769 TGGCAGGGGGAGGTGAGAGATGG + Intronic
1184468728 22:44683744-44683766 AGCCATGGGGAGGAGAGAGGGGG - Intronic
1185023095 22:48391969-48391991 AGTCAGGAGGAGAAGAGGGGAGG + Intergenic
1185341484 22:50293236-50293258 TGTCCAGGGGAGAGGAGAGGAGG + Intronic
949900073 3:8806183-8806205 TGTGAGGTGGAGATGAGAGGAGG + Intronic
950294615 3:11818187-11818209 TGTCAGGGGGAGTAGAGAGGTGG + Intronic
950626383 3:14250409-14250431 AGGGAGGGGGAGGAGAGAGGAGG - Intergenic
950721591 3:14886619-14886641 TGTGAGAGGGAGTGCAGAGGAGG - Intronic
951719162 3:25679685-25679707 GGAAAGGGGGAGTACAGAGGAGG + Intergenic
953024688 3:39138067-39138089 TGTCTGGGGTAGCTGAGAGGAGG + Intronic
953668767 3:44945126-44945148 GGACAGTGGGAGAAGAGAGGAGG + Intronic
953904405 3:46861234-46861256 TGGCAGGGGTAGCAGTGAGGAGG + Intronic
954460163 3:50621940-50621962 TGTTAAGGAGAGTAGAGTGGTGG + Intronic
954844458 3:53543352-53543374 TGTCAGGGTGAGGAGAAAGTGGG + Intronic
954859534 3:53675911-53675933 CTTCTGGGGGAGTAGAGAGGAGG - Intronic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
955213435 3:56963116-56963138 GCTCAGAGGGAGTAGAGAGTAGG - Intronic
955487145 3:59446801-59446823 TGCCAGTGGGGCTAGAGAGGTGG - Intergenic
955567507 3:60263658-60263680 GGCCAGGGGTGGTAGAGAGGAGG + Intronic
955990708 3:64624053-64624075 TGCCAGGGGCAGGAGGGAGGGGG + Intronic
956309872 3:67867058-67867080 TGTCAGGGGATGTTGGGAGGAGG - Intergenic
956541962 3:70349561-70349583 TCTCAGGGGTTGTTGAGAGGAGG + Intergenic
956825971 3:72997085-72997107 GGTGAGGGGGAATGGAGAGGGGG - Intronic
957124915 3:76146725-76146747 TGTCTGGTGGAGGGGAGAGGTGG + Intronic
957525159 3:81371082-81371104 TGTGAGGGGGATTTGGGAGGAGG + Intergenic
958449587 3:94257483-94257505 TTTCAGTGGGAGGAGAGAGTTGG - Intergenic
958464881 3:94444870-94444892 TGTCATGGGGTGGGGAGAGGGGG + Intergenic
958720109 3:97833568-97833590 TGTCAGGGGGTGTCTAGGGGAGG + Intronic
960645109 3:119871675-119871697 TGGAAGGGGGAGTAGAGAGAGGG + Intronic
961873036 3:130002268-130002290 GGGCAGCGGGAGTTGAGAGGAGG - Intergenic
963842602 3:150122915-150122937 TGTCATGGGGTGGGGAGAGGGGG - Intergenic
965014681 3:163141212-163141234 TGTCAGGGGTAGTAGAAGGGTGG + Intergenic
965088120 3:164125881-164125903 TGTCATGGGGTGGGGAGAGGGGG - Intergenic
968073352 3:195801915-195801937 TGGCAAGGGGAGTGGAGTGGAGG - Intronic
968185831 3:196633062-196633084 AGTCAGAGGGAGCAGAGAAGGGG + Intergenic
968186485 3:196636346-196636368 TGCCAGAGAGAGTAGAGAGTGGG + Intergenic
969680291 4:8639621-8639643 GGTAAGGGGGAGGGGAGAGGTGG + Intergenic
969848281 4:9936741-9936763 TGACAGGGAGAGGAAAGAGGAGG + Intronic
971259588 4:25044025-25044047 GGCCAGGGGGAGCAGACAGGGGG + Intergenic
971737935 4:30481236-30481258 AGTCAGGGGAAGGAGAGAGGGGG + Intergenic
971823899 4:31596323-31596345 TGGTGGAGGGAGTAGAGAGGAGG - Intergenic
971830477 4:31685936-31685958 TGTCATGGGGTGGGGAGAGGTGG + Intergenic
972042179 4:34616471-34616493 GGCAATGGGGAGTAGAGAGGTGG - Intergenic
972475173 4:39443362-39443384 TTTTGGGGGGAGTAGGGAGGAGG - Intronic
973306255 4:48654399-48654421 TGCCTGGGTGTGTAGAGAGGTGG - Intronic
973572556 4:52255493-52255515 TGTCAGTGGGAGGAGAGAAGTGG + Intergenic
973650127 4:52991018-52991040 TGTGATGAGGAGTAGAGAGTAGG + Intronic
973727340 4:53789627-53789649 TTTCAGGTGGAGGAGGGAGGTGG - Intronic
973763819 4:54145547-54145569 TGACAGGAGGAGTGGAGAGCTGG + Intronic
975119548 4:70713536-70713558 TGTCAGAGGGAGTGGTGGGGCGG + Intronic
976684245 4:87793916-87793938 TGACAGTGGGAGTGGTGAGGAGG - Intergenic
976690932 4:87866437-87866459 TGTCAGGGGGAATAGATAAAAGG - Intergenic
977630845 4:99240968-99240990 TGGCAAAGGGAGTACAGAGGTGG - Intergenic
977872191 4:102105567-102105589 TGCCAGGGGGATTGGAGAGAGGG - Intergenic
979535677 4:121817859-121817881 GGTCTGGGGGAGAAGAGAGAAGG - Intronic
980961399 4:139480067-139480089 TGTCATGGGGTGGGGAGAGGGGG - Intergenic
981740850 4:148000071-148000093 TGTCATGGGGTGGGGAGAGGGGG - Intronic
982410351 4:155069081-155069103 TGTCATGGGGTGGAGAGAAGAGG + Intergenic
983418724 4:167490650-167490672 TGTCATGGGGTGAGGAGAGGGGG + Intergenic
983457362 4:167982168-167982190 TGTCAGGGGGTGGGGGGAGGGGG - Intergenic
983985296 4:174052458-174052480 TGTTAGTGGGGGTTGAGAGGAGG - Intergenic
984957382 4:185058847-185058869 TGTCAGGTAGAGGAAAGAGGAGG - Intergenic
984990064 4:185371655-185371677 TGTCATAGGGAGTAGGGATGTGG + Intronic
985576297 5:674986-675008 TGGCCGGGGGAGCAGTGAGGGGG + Intronic
985576308 5:675017-675039 TGGCCGGGGGAGCAGTGAGGGGG + Intronic
986365773 5:7029087-7029109 TGTCAGGGGGTGGAGAGGGTAGG + Intergenic
988272967 5:29041174-29041196 TGACATGGGAAGTGGAGAGGAGG + Intergenic
989152607 5:38315273-38315295 TGTCACAGGGAGTAGAGAAGAGG - Intronic
989367538 5:40673721-40673743 TGGGAGGGAGAGTTGAGAGGGGG - Intergenic
989476349 5:41878309-41878331 TGTCAGGGGCTATAGGGAGGAGG + Intergenic
989661621 5:43805087-43805109 AGTCAGTGGGAGTAGATAAGTGG + Intergenic
990418923 5:55613339-55613361 TGTGGGGAGGTGTAGAGAGGCGG + Intergenic
990593940 5:57294498-57294520 AGTCAGGGGGAGGAGAGGTGAGG - Intergenic
991360822 5:65818377-65818399 TGTATGGGGGGGTAGAGAAGTGG - Intronic
991629185 5:68637213-68637235 TGTCAGGAGGAGAGAAGAGGAGG + Intergenic
993742810 5:91561366-91561388 TGTCATGGGGTGCAGGGAGGGGG + Intergenic
993833356 5:92786982-92787004 TGTGGGTGGGAGTAGAGATGGGG + Intergenic
994986458 5:106939869-106939891 TGTCATGGGGTGTGGGGAGGGGG + Intergenic
995271238 5:110221620-110221642 TGTCAGAGGGAGAAGAGATGGGG - Intergenic
995586809 5:113656442-113656464 TGTGAGGGGCAGTGGAGAAGGGG - Intergenic
995830074 5:116345240-116345262 TCTCAGGGGTAGGAGGGAGGGGG + Intronic
997167870 5:131681070-131681092 TTTCTGGGGAAGTGGAGAGGAGG - Intronic
997250311 5:132383956-132383978 TGTCATGGGGAGTGGGGAGGGGG + Intronic
997931781 5:138078389-138078411 GCTGAGAGGGAGTAGAGAGGGGG - Intergenic
998214636 5:140227872-140227894 GGTCAGGGTGTGGAGAGAGGTGG - Intronic
998947237 5:147352835-147352857 TGTCTTGGGGAGAAGGGAGGTGG + Intronic
999205362 5:149843973-149843995 TGCCAGGGGCTGCAGAGAGGAGG + Intronic
999262445 5:150246101-150246123 TGAGAGGGGGAGTTGGGAGGAGG + Intronic
1000629190 5:163572623-163572645 TGGTAGGGGGAGCAGGGAGGAGG - Intergenic
1000710245 5:164565843-164565865 TGTCAGAGGGACTTGAGAAGGGG - Intergenic
1001988048 5:176092569-176092591 TGTCATGGGGAGCAGCGAGGCGG - Intronic
1001989248 5:176102604-176102626 TGTCATGGGGAGCAGCGAGGGGG - Intronic
1001989924 5:176107924-176107946 TGTCATGGGGAGCAGCGAGGGGG - Intronic
1002159186 5:177304882-177304904 TCTCGGGGGGAGGGGAGAGGGGG - Intronic
1002163719 5:177332244-177332266 TGTCTGGGGGAGAAGAAACGGGG + Exonic
1002226947 5:177730214-177730236 TGTCATGGGGAGCAGCGAGGGGG + Intronic
1002227622 5:177735534-177735556 TGTCATGGGGAGCAGCGAGGGGG + Intronic
1002228820 5:177745571-177745593 TGTCATGGGGAGCAGCGAGGCGG + Intronic
1002266526 5:178038212-178038234 TGTCATGGGGAGCAGCGAGGCGG - Intronic
1002982865 6:2159213-2159235 TGTGAGGGGGAGGAGACAGAGGG + Intronic
1003474709 6:6470724-6470746 TGGGAGTGGGAATAGAGAGGAGG - Intergenic
1004757129 6:18622624-18622646 TGGTAGGGGAAGTAGACAGGAGG + Intergenic
1004772525 6:18800366-18800388 TGTCAATGGGAATAGAGAAGTGG + Intergenic
1004831052 6:19476871-19476893 TATCAGAGGGGGTATAGAGGAGG + Intergenic
1005771500 6:29077459-29077481 TGTCTGGGGGTGGAGAGGGGAGG - Intergenic
1006383719 6:33716801-33716823 CATCAGGGGGAGGAGAGAGGAGG + Intergenic
1006934930 6:37710656-37710678 TGGCGGGGGCAGGAGAGAGGGGG - Intergenic
1007044263 6:38756666-38756688 TGTCATGGGGTGGAGGGAGGGGG - Intronic
1007662731 6:43496504-43496526 TGTCAGGGGGAGGAGGCTGGCGG + Intronic
1007725861 6:43915232-43915254 TGTACTGGGGAATAGAGAGGTGG - Intergenic
1007751884 6:44076055-44076077 GGACAGGGGGAGGAGAGGGGAGG + Intergenic
1008522996 6:52380167-52380189 TGCCAGGGAGAGTAGAAATGCGG + Intronic
1009342093 6:62568670-62568692 TGGCAGGAGGAAGAGAGAGGTGG - Intergenic
1009457396 6:63873148-63873170 TGTCATGGGGTGTAGGGAGGGGG - Intronic
1010377835 6:75193722-75193744 TGTCATGGGGTGTGGGGAGGGGG - Intronic
1011936918 6:92791250-92791272 TGTCATGGGGTGTGGGGAGGGGG - Intergenic
1012269493 6:97191128-97191150 TCTGTGTGGGAGTAGAGAGGTGG - Intronic
1012826801 6:104156434-104156456 TGTTGTGGGGAGTAGGGAGGGGG - Intergenic
1012904256 6:105046162-105046184 TGTCATGGGGTGGAGGGAGGGGG - Intronic
1014110902 6:117617611-117617633 TGCCAGGGGGAGAGCAGAGGAGG + Intergenic
1014129622 6:117816040-117816062 TGTCATGGGGTGGAGGGAGGGGG - Intergenic
1014299610 6:119665368-119665390 TGTCATGGGGTGGGGAGAGGGGG + Intergenic
1014577657 6:123093048-123093070 TGTAAGTGGGAGTGGGGAGGTGG + Intergenic
1015194026 6:130505608-130505630 TGTGAAGGGTAGTAGGGAGGAGG + Intergenic
1015879888 6:137861391-137861413 TGCCAGGGAGTGAAGAGAGGTGG + Intergenic
1016177444 6:141097979-141098001 TGTCATGGGGTGTGGGGAGGAGG - Intergenic
1016785348 6:148005492-148005514 TGTCAGGGAAAGGAAAGAGGAGG + Intergenic
1016812580 6:148275520-148275542 TGGCCAAGGGAGTAGAGAGGTGG - Intronic
1018065726 6:160124027-160124049 GGACAGGTGGAGTAGAGGGGAGG + Intronic
1018152574 6:160954276-160954298 TGTCAGTGGGGGTCGAGAGGAGG + Intergenic
1018552698 6:165016586-165016608 TGTCATGGGGTGGAGGGAGGCGG - Intergenic
1019328183 7:449669-449691 TTGCAGGGGGAGCAGAGACGAGG - Intergenic
1019949481 7:4359731-4359753 TGTCATGGGGTGGAGGGAGGGGG + Intergenic
1020560903 7:9727893-9727915 TGTCAGGGAGAATGGAGAAGGGG + Intergenic
1020885704 7:13816849-13816871 TATCAGGGGAAGGAGAGAAGAGG - Intergenic
1021044617 7:15907036-15907058 GCACAGGGGGAGTAGAGAGAAGG - Intergenic
1022474009 7:30698665-30698687 GGCCAGGTGGAGGAGAGAGGTGG - Intronic
1022608006 7:31835268-31835290 TGACAGGGGGAGTGGAGATTTGG + Intronic
1022941625 7:35246929-35246951 TCTCTGGGGGACTTGAGAGGAGG - Intronic
1023019788 7:36001169-36001191 TGCCAGGGGGAGGAGGGGGGAGG - Intergenic
1023264434 7:38391462-38391484 CACCTGGGGGAGTAGAGAGGAGG + Intronic
1023650670 7:42365588-42365610 TGTCAGGGGGTGGGGAGCGGGGG - Intergenic
1023836145 7:44068304-44068326 TTTCAGGGAGAGTACAGAGAAGG + Intronic
1024624010 7:51188614-51188636 TGTCCAAAGGAGTAGAGAGGGGG + Intronic
1027915246 7:84309420-84309442 GGTCAGTGGGAGCAGAGAGATGG + Intronic
1029452176 7:100647348-100647370 TGGGAGGGGGAGCAGGGAGGGGG - Intronic
1029677580 7:102081026-102081048 TGTGATGGGGAGTAGCGAAGTGG - Intronic
1030085474 7:105811884-105811906 TGTGAGGGGAAGAGGAGAGGTGG - Intronic
1031927181 7:127650194-127650216 TGTCAAGGGGAGTTGGGAAGGGG - Intergenic
1031948797 7:127869584-127869606 TGGCAAGGGTAGTAGAGAGAGGG + Intronic
1031988151 7:128177222-128177244 TGGCAGAGGGGGTGGAGAGGAGG + Intergenic
1032097611 7:128947390-128947412 TGCCAGGGGGAGGAGCCAGGGGG - Exonic
1032193066 7:129775401-129775423 TGGCAGGTTGGGTAGAGAGGAGG - Intergenic
1032240371 7:130154695-130154717 AGCCAGGCGGAGGAGAGAGGCGG - Intergenic
1032856763 7:135841387-135841409 TGTCAGGGGTGGAAGTGAGGTGG + Intergenic
1033448544 7:141442319-141442341 AGTCAGGGCGTTTAGAGAGGAGG - Intronic
1034680657 7:152925372-152925394 TCTCAGGGAGAGGGGAGAGGCGG + Intergenic
1037562988 8:20091316-20091338 TGTAAGGGGGAACAGAGAAGTGG - Intergenic
1037700168 8:21266757-21266779 TGTCAGGGGGACAAGATGGGAGG - Intergenic
1037846840 8:22290798-22290820 TCTCAGGAGGACTAGAGACGAGG - Intronic
1038100269 8:24365707-24365729 TGTCAGAGGGGGTTGGGAGGAGG - Intergenic
1039438540 8:37578482-37578504 TGAAAGGGAGAGTGGAGAGGGGG - Intergenic
1041256477 8:55983466-55983488 TGTCAGGGGGAGGAGACACCTGG - Intronic
1041823527 8:62065709-62065731 TGTCATGGGGTGGGGAGAGGGGG + Intergenic
1042046332 8:64656346-64656368 TGTCATGGGGGGTAGAGATGTGG + Intronic
1042533377 8:69835763-69835785 TGGCAGGGGGCATGGAGAGGAGG + Intergenic
1043506070 8:80904447-80904469 TGTAAGGAGGAGTTGAGAGGGGG - Intergenic
1044360521 8:91278074-91278096 TGGCAGGGGGAGGAGGGAAGTGG + Intronic
1044370958 8:91410119-91410141 TTTCTGGGGCAGTAGAGAGAGGG - Intergenic
1044725952 8:95194433-95194455 TGTGAGGAGGAGTAGAAATGTGG + Intergenic
1046239737 8:111475255-111475277 TTTCAGTGAGAGTAGAGAGGTGG - Intergenic
1048982120 8:139708213-139708235 TGGCAGGTGGAGAAGAGAAGGGG - Intergenic
1049238565 8:141525137-141525159 TGTCAGCGGCGGTAGAGAAGTGG + Intergenic
1049439484 8:142602670-142602692 GGTCAGAGGGAGGACAGAGGTGG + Intergenic
1049499856 8:142955997-142956019 TGGCAGGTGGAGTGGGGAGGGGG + Intergenic
1050323005 9:4472602-4472624 TGTCATGGGGTGTGGGGAGGGGG + Intergenic
1051258962 9:15243150-15243172 TGTCAGAAGGAGGAGAGAGAGGG + Intronic
1051568001 9:18522586-18522608 TGTCATGGGGTGTGGGGAGGGGG - Intronic
1053021242 9:34695774-34695796 GGTGAGAGGGAGTAGAGAGTAGG + Intergenic
1053047144 9:34929164-34929186 TGACAGTGGGAGTATGGAGGTGG - Intergenic
1053562392 9:39209861-39209883 TGCCAGAGGGACTAGAAAGGAGG + Intronic
1053828198 9:42047853-42047875 TGCCAGAGGGACTAGAAAGGAGG + Intronic
1054134759 9:61409178-61409200 TGCCAGAGGGACTAGAAAGGAGG - Intergenic
1054602361 9:67139601-67139623 TGCCAGAGGGACTAGAAAGGAGG - Intergenic
1054937884 9:70708823-70708845 TGCCAGGGGCTGCAGAGAGGGGG - Intronic
1054939575 9:70726816-70726838 TGCCAGGGGCTGCAGAGAGGGGG - Intronic
1055358198 9:75459914-75459936 TGTCAGGGGGAGGGGAGATGGGG + Intergenic
1056605178 9:88079369-88079391 TGTCAGGGAGAGGAGAGGGTTGG + Intergenic
1056764190 9:89434826-89434848 TGTCAGGGAATGTAGAGGGGAGG + Intronic
1057274395 9:93668597-93668619 TTGCAGGGGGAGTGGAGATGGGG + Intronic
1057412577 9:94830187-94830209 TGTCACGGGGAGCAGGGAGAGGG - Intronic
1057936301 9:99242062-99242084 TGTCATGGGGTGAAGGGAGGGGG - Intergenic
1058633827 9:107017367-107017389 TGTGAGATGGAGTAGGGAGGGGG + Intergenic
1059199877 9:112404579-112404601 TGGGAGGGGGAGTAGGGAAGTGG + Intronic
1059232570 9:112735101-112735123 TGTAAAGTGGAGGAGAGAGGTGG + Intergenic
1060857448 9:126926330-126926352 TGTCATGGGAAGTAGAGTAGTGG + Intronic
1061165439 9:128919643-128919665 TGGCAGGGGGAGAAGAGGGAGGG - Intergenic
1061281684 9:129601336-129601358 TGTGAGGGGAAGCACAGAGGGGG + Intergenic
1061428961 9:130519159-130519181 GGTTGTGGGGAGTAGAGAGGAGG - Intergenic
1061480305 9:130894777-130894799 TGCCATGTGGAGTACAGAGGAGG - Intergenic
1061637471 9:131922018-131922040 TGTCATGGGGAGGGGGGAGGGGG + Intronic
1062074322 9:134576160-134576182 TCTCAGGAGGAGAAGACAGGAGG + Intergenic
1203344327 Un_KI270442v1:22639-22661 CGTGAGGTGGAGAAGAGAGGAGG + Intergenic
1188126777 X:26377889-26377911 TGTCATGGGGAGTGGGGAGAGGG - Intergenic
1190111186 X:47590137-47590159 TGTGAGGGGGAAAAGAGAGAGGG - Intronic
1190430912 X:50377047-50377069 TGACAGGGGGAATGGACAGGGGG - Intronic
1190873085 X:54440811-54440833 TGTGTGGGGGTGTGGAGAGGAGG + Intronic
1190898394 X:54643768-54643790 TGGCAAGGGTAGTGGAGAGGTGG - Intergenic
1191863328 X:65683844-65683866 AGTCAGGGGCAGAAGACAGGAGG - Intronic
1192628022 X:72750300-72750322 TGTCAGGGGGTGGAGGGATGGGG - Intergenic
1192653687 X:72970508-72970530 TGTCAGGGGGTGGAGGGATGGGG + Intergenic
1195669646 X:107458858-107458880 TGGCAGTGGGCATAGAGAGGAGG + Intergenic
1195670461 X:107465526-107465548 TGTCTGGGAGAGTAGTGTGGAGG - Intergenic
1195883792 X:109619564-109619586 TATCAGGCAGAGTACAGAGGTGG - Intergenic
1196066008 X:111464987-111465009 TGTCATGGGGTGGGGAGAGGGGG + Intergenic
1196201655 X:112892982-112893004 TGCCAGGGGCTATAGAGAGGGGG + Intergenic
1196243144 X:113366773-113366795 TGCCAGGGGAAGGGGAGAGGTGG + Intergenic
1196695248 X:118604452-118604474 TGCTAGGGGAAATAGAGAGGTGG - Intronic
1196788834 X:119445863-119445885 TGTCAGGGGCAACAAAGAGGTGG + Intronic
1197637481 X:128931193-128931215 TGTCAGGGTGACAAGAAAGGGGG + Intergenic
1197992295 X:132331203-132331225 TGTCTGGGGGCTTAGAGAAGAGG - Intergenic
1198859072 X:141050079-141050101 TGTCAGCGGGTGGGGAGAGGGGG + Intergenic
1198903624 X:141537310-141537332 TGTCAGGGGGTGGGGAGAGGGGG - Intergenic
1198916522 X:141678681-141678703 TGTCAGGGGGTGGGGAGAGTGGG - Intronic
1199055352 X:143287495-143287517 TATAAAGGGGAGCAGAGAGGGGG + Intergenic