ID: 950304524

View in Genome Browser
Species Human (GRCh38)
Location 3:11907814-11907836
Sequence CTGGGACTCCACCACTGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950304524_950304530 19 Left 950304524 3:11907814-11907836 CCGCAGCAGTGGTGGAGTCCCAG No data
Right 950304530 3:11907856-11907878 AGCCCTTCAGCGTGACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950304524 Original CRISPR CTGGGACTCCACCACTGCTG CGG (reversed) Intergenic
No off target data available for this crispr