ID: 950312050

View in Genome Browser
Species Human (GRCh38)
Location 3:11967301-11967323
Sequence TAGATGACACCCACCCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950312050_950312054 8 Left 950312050 3:11967301-11967323 CCAATATGGGTGGGTGTCATCTA No data
Right 950312054 3:11967332-11967354 AGGGCTTGGATAGAACGAAAAGG No data
950312050_950312053 -6 Left 950312050 3:11967301-11967323 CCAATATGGGTGGGTGTCATCTA No data
Right 950312053 3:11967318-11967340 CATCTAATCTAGTGAGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950312050 Original CRISPR TAGATGACACCCACCCATAT TGG (reversed) Intergenic
No off target data available for this crispr