ID: 950315546

View in Genome Browser
Species Human (GRCh38)
Location 3:11998812-11998834
Sequence GGATTAAATCAGATAGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950315536_950315546 28 Left 950315536 3:11998761-11998783 CCTATATTGCTTCACTGGTAAAA No data
Right 950315546 3:11998812-11998834 GGATTAAATCAGATAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950315546 Original CRISPR GGATTAAATCAGATAGCACA TGG Intergenic
No off target data available for this crispr