ID: 950321764

View in Genome Browser
Species Human (GRCh38)
Location 3:12061944-12061966
Sequence CTGCATCTACAGATCAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 833
Summary {0: 1, 1: 2, 2: 41, 3: 186, 4: 603}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950321764 Original CRISPR CTGCATCTACAGATCAAGTT GGG (reversed) Intronic
900006279 1:55498-55520 CTGCAACTCCAGATCCAATTTGG + Intergenic
900296322 1:1952984-1953006 TTGAATCTATAGATCAATTTGGG - Intronic
900811906 1:4809818-4809840 TTGAATCTATAGATCAAGTTGGG - Intergenic
902903930 1:19540353-19540375 TTGAATCCATAGATCAAGTTGGG + Intergenic
903150959 1:21408418-21408440 TTGAATCTATAGATCAATTTGGG + Intergenic
903424703 1:23245167-23245189 CTGCAGCTTCAGTTCCAGTTCGG + Intergenic
903644169 1:24882350-24882372 CTGAATCTATAGATCAGGTTGGG + Intergenic
904958823 1:34314033-34314055 TTGAATCTATAGATCAAATTGGG + Intergenic
904985295 1:34542314-34542336 TTGAATCTATAGATTAAGTTGGG - Intergenic
905288080 1:36898607-36898629 TTGAATCTACAGATCACTTTGGG - Intronic
905288310 1:36902155-36902177 CTGTATCTATAAATCAATTTGGG - Intronic
905558102 1:38903650-38903672 TTGAATCTATAGATCAACTTGGG - Intronic
905713795 1:40130771-40130793 TTGAATCTGCAGATCAATTTGGG + Intergenic
905963893 1:42072231-42072253 TTGAATCTATAGATCAAATTGGG + Intergenic
906089965 1:43170759-43170781 CTGCATCTGCAGATCAGATTTGG + Exonic
906368735 1:45234257-45234279 TTGAATCTACAGATAAATTTGGG - Intronic
906951609 1:50339054-50339076 TTGAATCTATAGATCAAGTTAGG + Intergenic
907154312 1:52319273-52319295 TTGAAGCTACAGATCAATTTGGG - Intronic
908012693 1:59797333-59797355 CTGAATCTGTAGATCAATTTGGG + Intergenic
908793613 1:67808866-67808888 CTGAATCTATAGGTCAAGTTAGG - Intronic
909098280 1:71317252-71317274 TTGAATCTATAGATCAAGCTGGG - Intergenic
909179261 1:72400342-72400364 TTGAATCTATAGATCAAGCTGGG + Intergenic
909589567 1:77330778-77330800 TTTAATCTACAGATCAATTTGGG + Intronic
909887013 1:80954525-80954547 CTGAATCTACAGATCAATTTGGG - Intergenic
910372668 1:86533652-86533674 TTGAATCTATACATCAAGTTGGG + Intergenic
910412321 1:86959867-86959889 CTGAATCTATAGATCACGTTGGG - Intronic
911250068 1:95565559-95565581 TTGAATCTATAGATCAATTTGGG + Intergenic
911403186 1:97402189-97402211 TTGCATCTATAGATCAAGCTGGG + Intronic
911425731 1:97708704-97708726 CTGAATCTATAGATCTAATTGGG + Intronic
912275197 1:108249887-108249909 TTGCATCTGGAGATCAATTTGGG + Intergenic
912293025 1:108444462-108444484 TTGCATCTGGAGATCAATTTGGG - Intronic
912479357 1:109968320-109968342 TTGAATCTACAGATTGAGTTGGG - Intergenic
912767149 1:112424584-112424606 TTGAATCTAGAGATCAATTTGGG + Intronic
913028134 1:114867320-114867342 TTGAATCTGTAGATCAAGTTGGG + Intronic
913235070 1:116773917-116773939 CGGAATCTACAGATTGAGTTGGG - Intergenic
913664953 1:121039062-121039084 TTGAATCTTTAGATCAAGTTGGG - Intergenic
914016344 1:143822333-143822355 TTGAATCTTTAGATCAAGTTGGG - Intergenic
914161440 1:145138666-145138688 TTGAATCTTTAGATCAAGTTGGG + Intergenic
914654961 1:149730875-149730897 TTGAATCTTTAGATCAAGTTGGG - Intergenic
915388250 1:155517024-155517046 TTGAATCTACAGATCACTTTAGG - Intronic
915707343 1:157858010-157858032 CTAAATCTATAGATCAATTTAGG - Intronic
915871728 1:159567802-159567824 TTAAATCTACAGATCAAGTTGGG - Intergenic
916775635 1:167960909-167960931 TTGAATCTATAGAACAAGTTGGG + Intronic
916937934 1:169649522-169649544 TTAAATCTAAAGATCAAGTTGGG - Intergenic
917001084 1:170360526-170360548 TTGAATCTACAGATTAATTTAGG - Intergenic
917008332 1:170441407-170441429 TTGAATCTATAGATCAATTTGGG - Intergenic
917157129 1:172015334-172015356 TTGAATCTATAGATTAAGTTGGG + Intronic
917568572 1:176237710-176237732 CTGAATCTATAGATCATGTTAGG + Intergenic
917572088 1:176277936-176277958 CTGTATCTATATATCAAATTAGG + Intergenic
918090041 1:181282700-181282722 TTGAATCTACAGATCAAGTTGGG + Intergenic
918227713 1:182500574-182500596 CTGAATCTATAGATCATTTTGGG + Intronic
918274127 1:182935245-182935267 CTGGATCTACAGATCAAGTTGGG + Intronic
918532120 1:185535041-185535063 GTGAATCTACAGATCATTTTGGG + Intergenic
918539895 1:185619727-185619749 ATGAATCTATAGATCAAGTTGGG + Intergenic
918539921 1:185620413-185620435 TTGACTCTATAGATCAAGTTGGG - Intergenic
918665658 1:187147259-187147281 TTGAATCTATAGATCAAGTTGGG + Intergenic
919004197 1:191873416-191873438 CTGAATCTATAGACCAATTTTGG - Intergenic
919717051 1:200789725-200789747 TTGAATCTGTAGATCAAGTTGGG + Intronic
920926941 1:210350342-210350364 TTGAATCTATAGATTAAGTTGGG + Intronic
920985013 1:210880162-210880184 TTAAATCTACAGATCAATTTGGG - Intronic
921093289 1:211863545-211863567 TTGAATCTACAGATCAAGTTGGG + Intergenic
921107589 1:211997922-211997944 TTACATCTAAAGATCAATTTGGG - Intronic
921237136 1:213144596-213144618 CAGCATTTAAAGATCAAGTGGGG - Intronic
921605501 1:217149010-217149032 ATAAATCTATAGATCAAGTTGGG - Intergenic
922181444 1:223236917-223236939 TTGAATCTATAGAGCAAGTTGGG + Intronic
922254521 1:223881893-223881915 TTGAATATACAGATCAATTTTGG - Intergenic
922640794 1:227229573-227229595 CTGTATCTGTAGATCAATTTGGG + Intronic
922656021 1:227384206-227384228 TTGAATTTATAGATCAAGTTAGG - Intergenic
923059840 1:230461338-230461360 TTGAATCTATAGATCAAGTTAGG - Intergenic
923420083 1:233804790-233804812 TTAAATCTATAGATCAAGTTGGG - Intergenic
923429043 1:233903278-233903300 TTGAATCTATAGATGAAGTTGGG + Intergenic
923619071 1:235562721-235562743 TTGAATCTACAGATCAAGTTGGG + Intronic
924204011 1:241692225-241692247 TTGACTCTACATATCAAGTTGGG - Intronic
924260856 1:242229523-242229545 TTGGATCTATAGATCAATTTGGG + Intronic
924364575 1:243278056-243278078 TTGGATCTATTGATCAAGTTGGG + Intronic
1062962519 10:1583657-1583679 TTGAATCTACAAATCAAGTGAGG - Intronic
1062980829 10:1721112-1721134 CTGCATCTCCAGCTCAAGTTTGG + Intronic
1063732259 10:8711187-8711209 TTGAATCTCCAGATCAATTTGGG + Intergenic
1063976475 10:11421572-11421594 TTGAATCTATAGACCAAGTTAGG - Intergenic
1064781874 10:18849500-18849522 TTGCATCTGTAGATCAAGCTGGG + Intergenic
1064946606 10:20797547-20797569 CTGTATCTTGAGATCATGTTGGG - Intronic
1064947478 10:20806972-20806994 CTGCATCTACAGAACCAGGAAGG + Intronic
1065277703 10:24102464-24102486 TTGAATCTATACATCAAGTTGGG - Intronic
1065365531 10:24932708-24932730 TTGAATCTATAGATCAATTTGGG - Intronic
1065556914 10:26925055-26925077 TTGAATCTAGAGAGCAAGTTGGG - Intergenic
1065607549 10:27435006-27435028 ATAAATCTACAGATCAATTTGGG - Intergenic
1065941700 10:30570384-30570406 TTGAGTCTATAGATCAAGTTGGG + Intergenic
1066251778 10:33640166-33640188 TTGCATCTATAGAACAATTTGGG + Intergenic
1066391985 10:34984368-34984390 CTGCATCTATACATCAATTTAGG + Intergenic
1066519659 10:36201809-36201831 CTGAATCTACAGATCAAGTTGGG + Intergenic
1068357745 10:55932052-55932074 CTACATTTACACATCAATTTAGG - Intergenic
1068824829 10:61424482-61424504 TTGAATCTAAAGATCAATTTGGG - Intronic
1069022891 10:63508547-63508569 TTGAATCTATAGATCAAGTTGGG + Intergenic
1069154287 10:65006192-65006214 CTGAATCTATAGATCAAGTTGGG + Intergenic
1069468633 10:68665340-68665362 TTGAATCTAGAGATCAATTTTGG + Intronic
1069644594 10:69984205-69984227 CTGAATATACAAATCAAGTTAGG - Intergenic
1070245544 10:74728244-74728266 CAGCATCTATAGATCAATTTGGG - Intergenic
1070317198 10:75325683-75325705 ATGAATCTACAGATCAATTTGGG + Intergenic
1070652759 10:78249817-78249839 CTGCATATGCAGATTAAATTTGG + Intergenic
1070945203 10:80385177-80385199 TTGAATCTATAGTTCAAGTTGGG + Intergenic
1071036638 10:81255312-81255334 CTGAATCTGTAGATCAATTTGGG + Intergenic
1071047112 10:81393699-81393721 CAGAATCTACAGATCACATTGGG + Intergenic
1071081018 10:81811284-81811306 TTGAATCTATTGATCAAGTTGGG - Intergenic
1071214340 10:83381849-83381871 TTGTATCTACAGATCAAGTTGGG - Intergenic
1071426002 10:85552270-85552292 ATTCATTTACAGATCAAATTGGG - Intergenic
1072082262 10:92044142-92044164 CTTCATCTTCATATCAAGTCTGG - Intergenic
1072123778 10:92427842-92427864 TTGAGTCTATAGATCAAGTTGGG - Intergenic
1072173362 10:92890037-92890059 TTGAATCTATAGATGAAGTTGGG + Intronic
1072174543 10:92905342-92905364 TTGAATCTGTAGATCAAGTTGGG + Intronic
1072908546 10:99478921-99478943 TTGAATCTACAGATCATTTTGGG - Intergenic
1073283423 10:102371497-102371519 TTGAATTTACAGATCAATTTGGG - Intronic
1073365073 10:102933198-102933220 TTGCATCTGTAGATCAATTTAGG + Intronic
1073957099 10:108885171-108885193 CTGAATCTATAGATCACTTTGGG - Intergenic
1074099982 10:110347265-110347287 GTGCATTTACACATCCAGTTAGG - Intergenic
1074628805 10:115225793-115225815 TTAAATCTACAGATCAATTTGGG - Intronic
1074629670 10:115238318-115238340 CTGAATCTGCATATCAAGCTGGG + Intronic
1075501210 10:122976353-122976375 TTGAATCTATAGATCAAGTTGGG - Intronic
1076020998 10:127073228-127073250 GTGAATCTGTAGATCAAGTTGGG - Intronic
1076352612 10:129828253-129828275 CTGAATCTGTAGATCAATTTTGG + Intergenic
1076499038 10:130921373-130921395 CTTTATCTATAGATCAATTTTGG + Intergenic
1076633076 10:131864037-131864059 TTGAACCTATAGATCAAGTTGGG - Intergenic
1076669950 10:132114666-132114688 TTGAATCTATAGATCAATTTGGG + Intronic
1077290810 11:1791105-1791127 TCGAATCTACAGATGAAGTTGGG + Intergenic
1078050255 11:7959481-7959503 TTGAATCTACAGATCAAACTGGG + Exonic
1078611712 11:12825579-12825601 CTGAATCTACAAATCATTTTAGG - Intronic
1078881604 11:15454835-15454857 TTGAATCTATAGATCAATTTGGG + Intergenic
1078936903 11:15959852-15959874 TTGCTTCTACAGATCTAGTTTGG + Intergenic
1078977135 11:16491448-16491470 CTGAATCTCCAGATTAATTTGGG - Intronic
1079072644 11:17361256-17361278 TTGAATCTAGAGATCAAGTTGGG + Intronic
1079564300 11:21862865-21862887 TTGAATCTATAAATCAAGTTGGG + Intergenic
1079695695 11:23479799-23479821 ATTCATCTGCATATCAAGTTTGG - Intergenic
1080273537 11:30476814-30476836 CTGAATCTACAGATCAATTTAGG + Intronic
1081422355 11:42884360-42884382 TTGAATCTACAGATAAATTTGGG - Intergenic
1081839761 11:46190584-46190606 CTGAATCTATAAATCAAGTTGGG - Intergenic
1083916838 11:65751698-65751720 TTGAATCTATAGACCAAGTTAGG + Intergenic
1084015493 11:66377787-66377809 CTTAATCTATAGATCAAGTTGGG + Intergenic
1084282887 11:68110622-68110644 TTAAATCTACAGATCAAGTTGGG - Intronic
1084339409 11:68484953-68484975 TTGAATCTGTAGATCAAGTTAGG + Intronic
1084790016 11:71469043-71469065 CTGAATCCACAGATCAACTTAGG - Intronic
1085612688 11:77966845-77966867 CTGAATCTGCAGATCATTTTGGG + Intronic
1085654768 11:78303732-78303754 CTGAATCTATTGATCAATTTAGG + Intronic
1085938617 11:81180921-81180943 TTGAACCTATAGATCAAGTTTGG + Intergenic
1086000651 11:81980962-81980984 TTGAATCTATAGATCAACTTTGG + Intergenic
1086969253 11:93063101-93063123 CTGCAGATGCAGATCAAGTTTGG - Intergenic
1087637882 11:100723345-100723367 TTCAATCTATAGATCAAGTTGGG + Intronic
1087808670 11:102585176-102585198 TTGAATCTACAGATCAATTTGGG + Intronic
1088710343 11:112502390-112502412 TTGAATCTATAGATCAAATTGGG + Intergenic
1088960624 11:114661175-114661197 TTGAATCTATAGATCAATTTTGG - Intergenic
1089421536 11:118335591-118335613 TTGCATTTATAGATCAATTTGGG - Intergenic
1090113051 11:123937044-123937066 TTGAATCTATAGATCAAATTGGG + Intergenic
1090754405 11:129776587-129776609 TGGAATCTATAGATCAAGTTGGG - Intergenic
1090841476 11:130492062-130492084 CTGGATCTATAGATCAAGTTAGG + Intergenic
1091454318 12:594753-594775 TTGAATCTATAGATCAAGTTAGG - Intronic
1091949130 12:4577695-4577717 TTGAATCTACAGATTAAGTTGGG + Intronic
1093343203 12:18005433-18005455 TTGAATCTATAGATCAAGCTGGG - Intergenic
1093488198 12:19675793-19675815 CTGAATTTATAGATCAATTTGGG + Intronic
1093612525 12:21179830-21179852 CTGTATCTACATATAAAGATGGG - Intronic
1093631175 12:21411645-21411667 TTGAAGCTACAGATCAATTTGGG + Intronic
1093759088 12:22886124-22886146 TTGAATCTATAGATCAAGTTGGG + Intergenic
1093900806 12:24629663-24629685 TTGAATCTACAGATAAATTTGGG + Intergenic
1094145404 12:27223249-27223271 TTAAATCTATAGATCAAGTTGGG - Intergenic
1094758661 12:33501920-33501942 CTGAATCTATAGATCACTTTGGG + Intergenic
1095835540 12:46634540-46634562 TTGAATCTGTAGATCAAGTTGGG + Intergenic
1096568567 12:52502683-52502705 TTGAATCTGTAGATCAAGTTGGG + Intergenic
1096932709 12:55231930-55231952 TTGAATCTATAGATAAAGTTGGG - Intergenic
1097367794 12:58739408-58739430 CTGAATCTGCAAATCACGTTGGG - Intronic
1097778682 12:63678012-63678034 TTGAATATATAGATCAAGTTGGG + Intergenic
1097803127 12:63937179-63937201 CTGCATCAAAAAATTAAGTTGGG + Intronic
1097965659 12:65577597-65577619 TTGAAGCTACAGATCAATTTGGG - Intergenic
1098242831 12:68485933-68485955 CTGGATATATAGATCAATTTAGG - Intergenic
1098808521 12:75053170-75053192 CTAAATCTACAGATAAAATTGGG - Intronic
1099044351 12:77697214-77697236 GTGCATCTACAGGCCAAGGTAGG - Intergenic
1099243908 12:80171724-80171746 TTAAATCTACAGATCAATTTGGG + Intergenic
1099306426 12:80961940-80961962 TTAAATCTACAGATCAATTTGGG + Intronic
1100298376 12:93284207-93284229 TTGAATCTATAGATCAATTTAGG - Intergenic
1100683395 12:96956320-96956342 CCGAATCTACAGATCAATGTGGG - Intergenic
1101279157 12:103233390-103233412 CTGAATCTATAGATCAAGTTGGG + Intergenic
1102203168 12:111072181-111072203 CTGAGTCTATAGATCAAGTTGGG + Intronic
1102319833 12:111923009-111923031 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1104504700 12:129320221-129320243 CTGGGACTACAGATTAAGTTTGG + Intronic
1105554582 13:21433723-21433745 CTGAACTTACAGATCAACTTGGG + Intronic
1105730217 13:23206889-23206911 CTGAATCTACAGATCACTTTTGG - Intronic
1106150143 13:27092291-27092313 CTGAACCTATAGATGAAGTTGGG - Intronic
1106299997 13:28455076-28455098 TTGAATCTGCAGATCAAGTTGGG - Intronic
1106771644 13:32966834-32966856 TTGAATCTATAGATCAAGTTGGG + Intergenic
1107763417 13:43707323-43707345 TTGAATCTACAAATCAACTTTGG - Intronic
1107767542 13:43753235-43753257 TTGAATCTATAGATCAATTTGGG + Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1107847333 13:44529996-44530018 CTGAATCTAAAGATCAAGTTGGG - Intronic
1108464635 13:50702417-50702439 TTGAATCTACAGATCACTTTAGG - Intronic
1109628868 13:65016941-65016963 CTGCATCTATAGATCCATCTGGG + Intergenic
1109992434 13:70076058-70076080 TTTAATTTACAGATCAAGTTTGG - Intronic
1110051698 13:70910232-70910254 ATGCTTCTACAGATAAACTTGGG - Intergenic
1110612298 13:77502478-77502500 CTGCAGCTACAGATTAAATTTGG + Intergenic
1110827015 13:79983202-79983224 CAGAATCTATAGATCAAGTTGGG + Intergenic
1111341129 13:86887859-86887881 TTGAATCTATAGATCAATTTGGG - Intergenic
1111558258 13:89909999-89910021 CTGTATCTATAAATCAATTTTGG + Intergenic
1111787842 13:92813818-92813840 CTGAATGTACAGATTAATTTAGG - Intronic
1113275451 13:108723889-108723911 TTGAATCTACAGATCAATTTGGG + Intronic
1113920170 13:113903308-113903330 CTACATCCACTGATAAAGTTCGG + Intergenic
1114505931 14:23213430-23213452 TTGAATCTATAGATCAAATTGGG - Intronic
1114520756 14:23333700-23333722 CTGAATCTGTAGATCAATTTAGG + Intergenic
1114863411 14:26556078-26556100 TTGCATCTATAGATCAAGTAGGG - Intronic
1115064979 14:29247799-29247821 TTGCATCTATAGTTCAAGTTTGG + Intergenic
1115169424 14:30487343-30487365 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115639877 14:35327832-35327854 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115678322 14:35706911-35706933 TTGAATCTACAGATTAAGTAGGG + Intronic
1115686542 14:35802596-35802618 TTGAATCTATAGATCAATTTGGG - Intronic
1115706025 14:35998862-35998884 CTGCATCTGCAGATGAACTTCGG + Intergenic
1115719170 14:36141301-36141323 TTGAATCTATAGATCAAGTTGGG + Intergenic
1116307694 14:43279374-43279396 CAGAAACTACAGATCAACTTGGG + Intergenic
1116356116 14:43933415-43933437 TTGAATCTATAAATCAAGTTTGG - Intergenic
1116665782 14:47773186-47773208 TTGAATTTACAGATCAAGTTTGG - Intergenic
1116692845 14:48132745-48132767 ATGAATGTACAGATCCAGTTTGG - Intergenic
1117259339 14:54014625-54014647 TTGAATCCAGAGATCAAGTTGGG + Intergenic
1117607677 14:57447305-57447327 TTGACTCTATAGATCAAGTTTGG + Intergenic
1118840910 14:69510262-69510284 TTGAATCTATAGATCAAGTTGGG + Intronic
1119202093 14:72763177-72763199 TTGCATCTATAGATCCATTTGGG - Intronic
1119451151 14:74711999-74712021 CTCCAGCTACTGATCAAGCTGGG - Intronic
1119801159 14:77446517-77446539 TTGAATGTACAGATCAATTTTGG - Intronic
1119822394 14:77628720-77628742 CTGAATCTGTAGATCAATTTGGG - Intergenic
1120078988 14:80193765-80193787 TTGAATCTACAGATCACATTGGG - Intergenic
1120336242 14:83159109-83159131 CTGAATCTATAGATTAATTTGGG - Intergenic
1120581832 14:86261153-86261175 ATGAATCTATAGATCAAATTTGG + Intergenic
1121036825 14:90712684-90712706 CTGAATCTTTAGATCAATTTGGG - Intronic
1121430872 14:93887397-93887419 TTGAATCTATAGATCAAGTTGGG + Intergenic
1122305108 14:100760199-100760221 TTGACTCTACAGATCAATTTGGG - Intergenic
1122381728 14:101312055-101312077 CTGAATCTATAGATCAAATTGGG - Intergenic
1122841650 14:104467601-104467623 CTGCTTATACAGATCATGTAAGG + Intergenic
1123453463 15:20390735-20390757 TTGAATCTATAGATCAATTTTGG + Intergenic
1123953089 15:25303691-25303713 TTGAATCTACAGATCACTTTGGG + Intergenic
1123969835 15:25497220-25497242 ATGAATCTATGGATCAAGTTGGG - Intergenic
1124029553 15:25997467-25997489 TTGGATCTACAGATCAACTTGGG + Intergenic
1124115042 15:26833196-26833218 TTGCATCTATTGATCAAATTGGG + Intronic
1124599624 15:31122752-31122774 TTGCATCTATAGATCAAGTTGGG - Intronic
1124713746 15:32037481-32037503 TTGAATCTGTAGATCAAGTTGGG + Intronic
1124792716 15:32744741-32744763 CTGCCTCTACAGAACCAGTTTGG - Exonic
1125167001 15:36718421-36718443 TTGAATTTACAGATCAATTTGGG + Intronic
1126611737 15:50536870-50536892 TTGTATTTACAGATCAAGTTGGG - Intronic
1126658625 15:51008800-51008822 TTGAATCTAAAGATCAAGTTGGG + Intergenic
1126863405 15:52910422-52910444 CTTAATCTATAGATCGAGTTGGG - Intergenic
1127406862 15:58658565-58658587 CTGAATCTGCAGAACAATTTGGG + Intronic
1127994217 15:64143331-64143353 CTGCATCTTGTGATAAAGTTGGG + Intronic
1128339918 15:66814282-66814304 TTGAATCTATAGAACAAGTTGGG - Intergenic
1128421719 15:67497932-67497954 TTGAATCTATAGATCAATTTGGG - Intronic
1129369471 15:75080284-75080306 TTAAATCTACTGATCAAGTTGGG - Intronic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1131320143 15:91381315-91381337 TTCAATTTACAGATCAAGTTGGG + Intergenic
1132447242 15:101935460-101935482 CTGCAACTCCAGATCCAATTTGG - Intergenic
1133540310 16:6746186-6746208 TTGAATCTACAGATCAATTAGGG - Intronic
1133863626 16:9620577-9620599 TTGAATCTATAGATCAAATTAGG - Intergenic
1133874799 16:9723531-9723553 CTAGATCTTAAGATCAAGTTAGG - Intergenic
1134438162 16:14280879-14280901 TTGAATCTACAGATGAATTTGGG - Intergenic
1134468155 16:14497395-14497417 CTGCATCTACAGATTCAAGTTGG + Intronic
1135273732 16:21092038-21092060 TTGAATCTATAGATCAAGTTGGG - Intronic
1135375190 16:21940353-21940375 CAGCATCTCAAGAGCAAGTTTGG + Intergenic
1135466357 16:22689021-22689043 TTGAATCTATACATCAAGTTGGG + Intergenic
1135996076 16:27249828-27249850 TTGAATCTATAGATCAATTTGGG + Intronic
1137436634 16:48459875-48459897 TTGAATCTATAGATCAAGTTAGG + Intergenic
1138793498 16:59938912-59938934 TTGAATCTAGAGATCAAGTAGGG + Intergenic
1139121825 16:64028190-64028212 TTGAATCTATAGATCAAGCTGGG + Intergenic
1140243146 16:73222642-73222664 CTGAATCTATAAATCATGTTGGG - Intergenic
1140693452 16:77507734-77507756 GTGAATCTAGAGATCAATTTGGG + Intergenic
1141037222 16:80638406-80638428 TTGAGTCTATAGATCAAGTTGGG - Intronic
1141327225 16:83072674-83072696 CTCCATGCACAGATCAAGCTTGG - Intronic
1141902462 16:87000870-87000892 CTGAATCTATAGATCGATTTGGG - Intergenic
1143308111 17:5964809-5964831 TTGAATCTATAGATCAAGTTAGG + Intronic
1143665857 17:8359673-8359695 CTGCACCTACAGATGAAGAAGGG + Intergenic
1143989892 17:10948323-10948345 TTGAATCTACAGATCAAGTTTGG + Intergenic
1144048463 17:11474914-11474936 TTGAATCTATAGATCAAGTTGGG + Intronic
1144378468 17:14669135-14669157 CTGCATTTACAGCTCAGGCTTGG - Intergenic
1145045213 17:19608879-19608901 CTGAATCTGTAGATCAACTTAGG - Intergenic
1146554105 17:33808593-33808615 CTGAATCTATGGATCAAGTTGGG + Intronic
1146612227 17:34317741-34317763 TTGAAGGTACAGATCAAGTTGGG - Intergenic
1146802344 17:35836189-35836211 GTGTGTCTACAGATCAAGTTGGG + Exonic
1146970911 17:37071362-37071384 CTGACTCTATAGATCAATTTGGG + Intergenic
1147062254 17:37889934-37889956 CTGAATCTCCAGATGAGGTTAGG + Intergenic
1148247187 17:46040714-46040736 CTGACTCTACAGATCAATTTGGG + Intronic
1148893678 17:50827143-50827165 GTGAATCTATAGATCTAGTTGGG + Intergenic
1149508774 17:57219248-57219270 TTGAATCTATAGGTCAAGTTGGG - Intergenic
1149853613 17:60058180-60058202 CTGAATCTATAGATCAAGTTGGG + Intronic
1150461101 17:65353644-65353666 TTGAATCTACAGATCAGTTTAGG - Intergenic
1150480987 17:65510453-65510475 CTGAATCTATAGATCAATTTGGG - Intergenic
1153503976 18:5776452-5776474 TTGTATCTGCAGATCAATTTAGG + Intergenic
1153751358 18:8234179-8234201 CTGAATCTATAGATCAATTTGGG + Intronic
1153817153 18:8800450-8800472 CTGCATATACCGATCAACCTTGG + Intronic
1154083585 18:11280853-11280875 CTGCATCTGCAGAGGAAGTGCGG + Intergenic
1154103040 18:11494187-11494209 CTGCTTCTACAGATGAACTATGG + Intergenic
1154319002 18:13329553-13329575 CTGCATTTACAGTTACAGTTAGG + Intronic
1154948947 18:21189216-21189238 TTGAATCTACAGATCACTTTTGG + Intergenic
1154951320 18:21212893-21212915 ATGAATCTATAGATCAAGTTGGG + Intergenic
1155451328 18:25965803-25965825 ATTCATCATCAGATCAAGTTTGG - Intergenic
1155513602 18:26601582-26601604 TTGAATCTGCAGATCAATTTGGG + Intronic
1155665338 18:28300838-28300860 CAGAATCTATAGATCAAGATGGG - Intergenic
1156039689 18:32806641-32806663 CTTCATCTACAGATTAACTGAGG + Intergenic
1156813844 18:41284781-41284803 TTGAATCTATAGATTAAGTTGGG - Intergenic
1157057167 18:44244071-44244093 CTGCATGTACAGAATAAGATTGG - Intergenic
1157244819 18:46044062-46044084 TTGGATCTATAGATCAATTTGGG - Intronic
1157343156 18:46798401-46798423 TTGATTCTATAGATCAAGTTGGG - Intergenic
1157509324 18:48258613-48258635 TTGAATCTACAGATCAATTTGGG - Intronic
1157961840 18:52162981-52163003 TTGAATCTATAGATCAATTTGGG + Intergenic
1159579831 18:70222652-70222674 TTGAATCTGCAGATCAATTTGGG - Intergenic
1159588488 18:70305625-70305647 TTGAATCTATAGATCAATTTTGG + Intronic
1159758519 18:72395478-72395500 CTTCATTTAGGGATCAAGTTTGG + Intergenic
1160056384 18:75485569-75485591 TTGAATCTAAAGATCAAATTAGG - Intergenic
1160110244 18:76021584-76021606 CTGCATCTACATATCACATTAGG - Intergenic
1160472616 18:79151017-79151039 CTGAATCTACAGATCAATTTAGG - Intronic
1160536229 18:79595257-79595279 TTGAATCTATAGATCAAATTGGG - Intergenic
1160638034 19:97073-97095 CTGCAACTCCAGATCCAATTTGG + Intergenic
1160835348 19:1122272-1122294 GTGCATCCCCAGATCAAGTACGG - Exonic
1161184791 19:2910038-2910060 TTGAATCTATAGATCAAGTTGGG + Intronic
1161881971 19:6961447-6961469 TTGGATCTATAGATCAAGTTGGG + Intergenic
1163219644 19:15907705-15907727 CTGAATCTATAGATTTAGTTGGG - Intergenic
1163226852 19:15968490-15968512 TTGAATCTATAGATCAAGTTGGG - Intergenic
1164113388 19:22192374-22192396 CTGAATCTAGAGATCACTTTGGG - Intronic
1164644790 19:29850580-29850602 CTGAAGCTATAGATCAATTTGGG - Intergenic
1164815529 19:31198851-31198873 CTGAGTCTATAGATCAAGTTGGG - Intergenic
1164893784 19:31850296-31850318 TTGAATCTATAGATCAAGTTGGG - Intergenic
1164915714 19:32050953-32050975 CTGCAGCTACAGGTCAAATTTGG - Intergenic
1165375951 19:35442056-35442078 CTGAATCCATAGATCAATTTGGG - Intergenic
1165876516 19:39011464-39011486 CTGAATCTGTAGATCAATTTAGG + Intronic
1166138890 19:40794949-40794971 CTTGATCTACAGATCAAGCCAGG - Intronic
1167400367 19:49263507-49263529 CTGAATCTGTAGATCAATTTGGG - Intergenic
1168495867 19:56849837-56849859 CTGAATCTACACATCACTTTGGG + Intergenic
925179586 2:1808427-1808449 CTGCGTCTACAAATTAATTTCGG + Intronic
925392547 2:3506619-3506641 CTGAACCTATAGATTAAGTTTGG - Intronic
925565364 2:5247968-5247990 CTGAATCTATAGATCAAGTTGGG - Intergenic
926481829 2:13408489-13408511 TTGAATCTATAGATCAATTTTGG - Intergenic
927237757 2:20890791-20890813 TTGCATCTGTAGATCAATTTGGG + Intergenic
927736606 2:25528964-25528986 CTGAATCTAAAGATCAAATTGGG - Intronic
928050097 2:27983524-27983546 TGGGATCTACAGATCAACTTGGG + Intronic
928184699 2:29099760-29099782 CTAAATCTACAGATCACGCTGGG + Intronic
928493519 2:31808053-31808075 CTGAATCCATAGATCAACTTAGG + Intergenic
928851157 2:35748824-35748846 CTGAATCTATAGGTCAATTTGGG - Intergenic
929072045 2:38040785-38040807 TTAAATCTACAGATCAGGTTAGG + Intronic
929767820 2:44864038-44864060 CTGAATCTATAGATCAAATTGGG - Intergenic
929801348 2:45106307-45106329 CTGCATCTGTAGATCAATTTGGG - Intergenic
929866377 2:45720636-45720658 ATGCATCAATACATCAAGTTTGG - Intronic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
930875853 2:56214938-56214960 TTGAACCTACAGATCAAGTTGGG + Intronic
930977720 2:57484341-57484363 TTGAATCTGTAGATCAAGTTGGG + Intergenic
931003703 2:57822200-57822222 TTGCATCTGTTGATCAAGTTAGG - Intergenic
931339452 2:61385281-61385303 CTGAATCTATAGATGAATTTCGG - Intronic
931865078 2:66400851-66400873 CTGATTTTACAGATTAAGTTGGG + Intergenic
931965306 2:67526968-67526990 TTGAATCTACAGATAAAGTTGGG - Intergenic
932470840 2:71955149-71955171 TTGAATATATAGATCAAGTTGGG + Intergenic
932743368 2:74309589-74309611 TTGCATCTATAGATCAAGTTGGG + Intronic
932919312 2:75891461-75891483 CAGCATCTGCAGAGCAAGTCTGG - Intergenic
933076138 2:77929076-77929098 CTGAATCTACAGATCACTCTGGG + Intergenic
933661799 2:84933734-84933756 TTGAGTCTACAGATCAGGTTGGG - Intergenic
933838817 2:86268554-86268576 TTGAATCTATAGATCAAGTTGGG - Intronic
935510695 2:103969518-103969540 TTGAATCCGCAGATCAAGTTGGG + Intergenic
935518612 2:104077348-104077370 TTAAATCTATAGATCAAGTTGGG + Intergenic
935750438 2:106228135-106228157 TTTGATCTACAGATTAAGTTGGG + Intergenic
935867449 2:107405817-107405839 CTGCATCTACAGAGTGGGTTAGG + Intergenic
935875944 2:107507847-107507869 TTGAATCTATAGAGCAAGTTGGG + Intergenic
936005167 2:108880342-108880364 TTGTATCTATAGATCAAGTTGGG - Intronic
936120828 2:109742596-109742618 TTGGATCTACAGATTAAGTTGGG - Intergenic
936125384 2:109785010-109785032 CTGGGTCTATAGATCAAGTTTGG - Intergenic
936219309 2:110586458-110586480 CTGGGTCTATAGATCAAGTTTGG + Intergenic
936223869 2:110628877-110628899 TTGGATCTACAGATTAAGTTGGG + Intergenic
936268095 2:111026342-111026364 TTGCATCTATAGATCAATATGGG + Intronic
936498411 2:113044032-113044054 TTGGATCTACAGGTCAAGTTGGG + Intronic
936772301 2:115928668-115928690 ATGAATCTACAGAACAAGTTGGG + Intergenic
936781027 2:116032759-116032781 CTGAATCTATAGATCAATTTTGG + Intergenic
937743563 2:125384837-125384859 CTGAATCTATAGATCAAATTGGG - Intergenic
937850646 2:126631277-126631299 TTGCATCTATAGTTCAAGTTGGG - Intergenic
937961243 2:127461151-127461173 TTGCATCTATAGATCAATTTGGG - Intronic
938198113 2:129350091-129350113 TTGAATGTATAGATCAAGTTGGG + Intergenic
938203710 2:129399241-129399263 CTGCTTATACAGAACAAGTAAGG - Intergenic
938554326 2:132410533-132410555 TTGAATCTATAGATCAATTTTGG + Intergenic
938872670 2:135497169-135497191 CTGCATCTATAGATCAGTTTGGG - Intronic
939507669 2:143069443-143069465 CTGCAGCTACAGAGCATGCTAGG + Intergenic
939747922 2:146000854-146000876 CTGAATCTGTAGATCAATTTGGG - Intergenic
939802294 2:146724920-146724942 TTGAATTTATAGATCAAGTTGGG - Intergenic
940472908 2:154121393-154121415 TTGAATTTATAGATCAAGTTGGG + Intronic
940619312 2:156090930-156090952 TTGAAACTATAGATCAAGTTGGG + Intergenic
940620189 2:156102959-156102981 TTGAATCTGAAGATCAAGTTGGG - Intergenic
940714156 2:157200147-157200169 TTGAATCTATAGATCAAGTTGGG - Intergenic
940732600 2:157410654-157410676 CTGAATCTACAGATTAAGTTGGG + Intergenic
940852038 2:158697134-158697156 TTGAATCTATAGATCAAGTTGGG - Intergenic
941242594 2:163058088-163058110 TTGAGTCTATAGATCAAGTTAGG + Intergenic
941879411 2:170465771-170465793 CTGCTCCTACAGATCAAAATTGG - Intronic
942012807 2:171780004-171780026 CTGAATTTATAGATCAATTTGGG - Intergenic
942271427 2:174279493-174279515 TTGAATCTATAGATCAATTTGGG + Intergenic
942405054 2:175645303-175645325 CTGAATCTATAGAGCAAGTTGGG + Intergenic
942770834 2:179517310-179517332 CTGGATCTATAGATCAATTGGGG + Intronic
943097155 2:183443270-183443292 CTAGATCTACAGATCAAGAGTGG + Intergenic
943235350 2:185311075-185311097 TTGCATCTACAGATTATGTCAGG - Intergenic
943932673 2:193874535-193874557 GTGAATCTAAAGATCGAGTTGGG + Intergenic
944392730 2:199234783-199234805 CTGAATCTATAAATCTAGTTGGG + Intergenic
944700753 2:202243881-202243903 CTGAATCTATATATCAAGTTGGG + Intergenic
945021485 2:205576861-205576883 TTGAATCTGTAGATCAAGTTGGG + Intronic
945327836 2:208503348-208503370 TTGAATCTATAGATCAATTTTGG + Intronic
945341420 2:208660471-208660493 ATGCATGTATAGATCAATTTGGG + Intronic
945472572 2:210244164-210244186 CTGAATCTATTGATCAAATTGGG + Intergenic
945674226 2:212835727-212835749 TTGAATCTATAGATGAAGTTAGG + Intergenic
945953198 2:216059956-216059978 CTGAATCTACAGATCAATTTGGG + Intronic
946270230 2:218586131-218586153 CTGAATCTATAGATCAGTTTGGG - Intronic
946816638 2:223585072-223585094 CTGCATCCACAGAAAAGGTTAGG + Intergenic
947030696 2:225790193-225790215 TTGAATCTATAGATCAAGTTAGG + Intergenic
947510564 2:230749554-230749576 CTGCATGTATAGATAAAGATGGG + Intronic
948240274 2:236426201-236426223 CTGAATCTATAGATCACTTTGGG + Intronic
948469165 2:238166424-238166446 CTGCATCTTAAGATCCAGGTGGG - Intronic
1169032933 20:2426070-2426092 TTGAATCTATAGATCAAGCTAGG + Intronic
1169152438 20:3300254-3300276 CTGAACCTACAGATCATGTTGGG + Intronic
1169312567 20:4558233-4558255 TTGGATCTATAGATCAAGTCAGG - Intergenic
1169952535 20:11061486-11061508 CTGCATTTACAGAAAAATTTAGG + Intergenic
1170161491 20:13317365-13317387 TTGAATCTATAGATCAAGTTGGG - Intergenic
1170378152 20:15725159-15725181 TTGAATCTATAGATCAAGTTGGG + Intronic
1170755304 20:19198740-19198762 CTAAATCTGCAGATCATGTTGGG + Intergenic
1171432921 20:25096608-25096630 TTGAATCTATAGATTAAGTTAGG - Intergenic
1172089235 20:32416033-32416055 TTGAATCTACAAATCAAATTGGG - Intronic
1172785115 20:37463675-37463697 TTGAATCTATAGATCAATTTGGG + Intergenic
1175317809 20:58063704-58063726 TTGAATCTACGGATCAACTTGGG - Intergenic
1175338537 20:58212623-58212645 CTGTACATACAGATCAAGTCAGG + Intergenic
1177125498 21:17188406-17188428 TTGAATCTATAGATCAATTTGGG - Intergenic
1177349581 21:19919423-19919445 TTGAATCTCTAGATCAAGTTGGG - Intergenic
1177468740 21:21526552-21526574 CTGACTCTACAGATCAAGTTGGG - Intronic
1177799221 21:25811396-25811418 TTGAATCTATAGATCAATTTGGG - Intergenic
1178031500 21:28531867-28531889 TTGAATCTATAGATCAAGTTGGG + Intergenic
1180003798 21:45009812-45009834 CTGAATGTGCAGATCAATTTGGG + Intergenic
1180094223 21:45547913-45547935 CTGAATCTATGGATCAATTTGGG - Intergenic
1182581613 22:31316198-31316220 TTTGATCTATAGATCAAGTTGGG - Intergenic
1182824263 22:33250102-33250124 TTGAATCTACAGATAAAGTTAGG + Intronic
1182970641 22:34572122-34572144 TTGCATCCATAAATCAAGTTAGG + Intergenic
1183133288 22:35860752-35860774 CTGAATCTACAGATCACTTTGGG + Intronic
1183694159 22:39410776-39410798 TTAAATCTACAGATCAATTTGGG - Intronic
1185164149 22:49248627-49248649 TTGAATCTATAGATCAATTTAGG + Intergenic
1185308607 22:50139155-50139177 CTGCATTTACAGACCACGTGAGG - Intronic
1185350589 22:50335005-50335027 TTGGATCCACAGATCAATTTGGG + Intergenic
949292227 3:2480680-2480702 TCGAATCTATAGATCAAGTTGGG - Intronic
949389875 3:3548423-3548445 TTGAATCTATAGATCAAGTTAGG + Intergenic
949486875 3:4548271-4548293 CTGCATTCAAACATCAAGTTTGG + Intronic
949915267 3:8957247-8957269 TTGAATCTAGAGATCAATTTGGG - Intronic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
950352148 3:12365969-12365991 TTGAATCTATAGATCAAGTTGGG + Intronic
950843517 3:15990769-15990791 TTGAATCTATAGATCAATTTGGG + Intergenic
950959115 3:17085986-17086008 TTGAATCTATATATCAAGTTGGG - Intronic
950994137 3:17476662-17476684 CTGAATCTATAGATCAATTTGGG + Intronic
951265920 3:20566657-20566679 TTGAATCTATAAATCAAGTTGGG + Intergenic
951331283 3:21371626-21371648 CTGAATATATTGATCAAGTTGGG + Intergenic
951533070 3:23716351-23716373 CTGAATCTATAGATCAAGCTGGG + Intergenic
951616631 3:24553997-24554019 TTGAATCTGCAGATCAATTTTGG + Intergenic
952128135 3:30327149-30327171 TTGAATCTATACATCAAGTTGGG - Intergenic
952167152 3:30762958-30762980 GTCCATCTACAGATAAAGTATGG - Intronic
952203772 3:31158484-31158506 CTACATCTTCAGAGCAATTTTGG - Intergenic
952426239 3:33177292-33177314 TTCAATCTATAGATCAAGTTGGG + Intronic
952473262 3:33678842-33678864 TTGAATCCATAGATCAAGTTGGG - Intronic
952559222 3:34570293-34570315 TTGAATCTACAGGTCAATTTGGG + Intergenic
952635967 3:35531803-35531825 CTGAATCTACAGATCATTTTGGG - Intergenic
952703930 3:36357450-36357472 TTGAATCTATAGATCAAGTTGGG + Intergenic
953192778 3:40703727-40703749 TTGACTCTATAGATCAAGTTGGG + Intergenic
953422733 3:42767508-42767530 TTGAATCTATAGATCAAGTTGGG - Intronic
953600102 3:44354478-44354500 TTGAATCTATAGATCAAGTTGGG + Intronic
954253409 3:49386141-49386163 CTGAATCTACAGATCGATTTGGG + Intronic
954846090 3:53557919-53557941 CTGAATCTATAGATCGATTTGGG + Intronic
955169990 3:56554272-56554294 TTGAATCTATAGATCAAGTTGGG + Intergenic
955262881 3:57411754-57411776 TTGAATCTACATGTCAAGTTTGG - Intronic
957037200 3:75304929-75304951 TTGAATCTACAGATCAATTTGGG + Intergenic
957400440 3:79705744-79705766 CTGAATCTATAGAACAAGTTGGG + Intronic
958001732 3:87759324-87759346 TTGAATCTATAGATCAAGTTGGG - Intergenic
958443724 3:94189085-94189107 TTGAATCTATAGACCAAGTTGGG + Intergenic
958581826 3:96035889-96035911 TTGCATCTATAGATCAAGTTGGG + Intergenic
959499935 3:107094949-107094971 TTGAATCTATAGATCAAGTTGGG - Intergenic
959666572 3:108929004-108929026 TTGAATCTACAGATCAACTTGGG + Intronic
960187787 3:114664811-114664833 GTACATATACAGAACAAGTTAGG + Intronic
960220557 3:115103274-115103296 TTGAATCTATAGATCAATTTGGG - Intronic
960227073 3:115181041-115181063 TTGAATCTACAGATCAAGTCAGG - Intergenic
960547321 3:118930806-118930828 CTGAATCTATAGATCAATTTAGG - Intronic
960652736 3:119969422-119969444 TTGAATTTGCAGATCAAGTTGGG - Intronic
960822966 3:121753734-121753756 TTGAATCTACAGATAAAGTTGGG - Intergenic
960860909 3:122152812-122152834 TTGAATCTGCAGATCAATTTGGG + Intergenic
960889250 3:122429629-122429651 TTGAATCTATAGATCAAGTTGGG - Intronic
960982898 3:123248656-123248678 TTGAATCTATAGACCAAGTTGGG - Intronic
961914790 3:130362694-130362716 TTAAATCTACAGATCAATTTGGG + Intronic
962000680 3:131292480-131292502 TTGCATCTATTGATGAAGTTGGG + Intronic
962194322 3:133347202-133347224 TTGAATCTGTAGATCAAGTTGGG + Intronic
962290476 3:134132142-134132164 ATGAATCTAGAGATCAAATTGGG - Intronic
962326386 3:134436715-134436737 TTACATCTACAGATCAATTTGGG + Intergenic
963406853 3:144876257-144876279 TTGAATCTACAGATCACTTTTGG + Intergenic
963514073 3:146286295-146286317 TTGTATCTATAGATCAATTTGGG + Intergenic
964460814 3:156925003-156925025 TTGAATCTATAGATCAATTTGGG + Exonic
965326527 3:167310917-167310939 ATGAATCTATAGATCAAGTTGGG - Intronic
965848922 3:172998104-172998126 TTGAATCTATGGATCAAGTTTGG + Intronic
966131542 3:176646228-176646250 TTAAATCTATAGATCAAGTTGGG - Intergenic
967244533 3:187471936-187471958 CTGCATGTACACATCCAGATGGG - Intergenic
967353181 3:188537675-188537697 TTGCATCTATATATCAAATTGGG - Intronic
967358987 3:188608736-188608758 CTGCATCTATAGATAACTTTGGG + Intronic
967490402 3:190084131-190084153 CTGAATCTACACATCAAGTTAGG + Intronic
968535130 4:1121549-1121571 TTGAATCTATAGAACAAGTTGGG - Intergenic
968840250 4:2998784-2998806 TTGAATCTATAGATCAATTTGGG - Intronic
969625164 4:8299051-8299073 TTGAATTTACAGATCAATTTGGG + Intronic
970534470 4:17015799-17015821 TTGAATCTACAGATCAATATGGG + Intergenic
970979239 4:22077484-22077506 CTGCATCTACACAGAAAGTGGGG - Intergenic
971526004 4:27620038-27620060 TTGAATCTATAGATCAATTTGGG - Intergenic
972327416 4:38029976-38029998 ATGCATTTACAATTCAAGTTGGG + Intronic
972830089 4:42804522-42804544 TTGAATCTACAGATCAAATTGGG + Intergenic
973028711 4:45308403-45308425 CTGAATATATAAATCAAGTTGGG + Intergenic
974170238 4:58257524-58257546 TTGAATTTATAGATCAAGTTGGG - Intergenic
974355670 4:60809583-60809605 CTGCTACTACAGATCAAATATGG - Intergenic
974475012 4:62367291-62367313 TTGAATCTACAGATCAAATTGGG - Intergenic
974655779 4:64819137-64819159 TTGAATCTACAGATCAATCTGGG + Intergenic
975115988 4:70681482-70681504 CTGCATCTAGAAAACAGGTTTGG - Intronic
975958394 4:79870276-79870298 TTGAAGCTATAGATCAAGTTGGG - Intergenic
976060301 4:81119946-81119968 TTGAATTTATAGATCAAGTTGGG + Intronic
976346451 4:84008377-84008399 TTGACTCTACAGATCAAGTGGGG + Intergenic
976422686 4:84864428-84864450 CTTAATCTACAGATCATTTTCGG + Intronic
977232856 4:94472694-94472716 CGGCATTTATAGATAAAGTTGGG + Intronic
977454478 4:97240730-97240752 TTGAATCTATAGATCAAGTTGGG - Intronic
977482965 4:97601855-97601877 CTAAATTTATAGATCAAGTTGGG + Intronic
977488726 4:97684169-97684191 TTGTATCTATAGATCAAATTGGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978129397 4:105176690-105176712 CTGAATCTATAGATCAAGTTGGG - Intronic
978176508 4:105738454-105738476 CTGAATCTATAGATCACTTTTGG + Intronic
978213563 4:106169137-106169159 TTGAATCTACATATCAATTTGGG - Intronic
978415481 4:108471144-108471166 TTGAATCCATAGATCAAGTTGGG - Intergenic
978665763 4:111179441-111179463 TTGAATCTAAAGACCAAGTTTGG + Intergenic
978718020 4:111869223-111869245 CTTACTCTACAAATCAAGTTTGG - Intergenic
978918482 4:114152797-114152819 CTGCTTCTACAGATGAAGTAAGG - Intergenic
979749906 4:124266370-124266392 TTGAATCTACAAATCAATTTGGG - Intergenic
979781454 4:124656014-124656036 CTGAATCTACAGATAAACTGCGG - Intergenic
979903360 4:126252265-126252287 TTGAACCTATAGATCAAGTTGGG - Intergenic
979952594 4:126912718-126912740 TTGAATCTATAAATCAAGTTGGG - Intergenic
980584798 4:134797922-134797944 TTAAATCTACAGATCAAATTGGG - Intergenic
981185516 4:141797731-141797753 CTGAATCTATATATCAAGTCGGG + Intergenic
981396583 4:144256759-144256781 TTAGATCTACAGATCAATTTAGG + Intergenic
981947420 4:150364186-150364208 ATGCATCTAGAGGTCAACTTGGG + Intronic
982134499 4:152260535-152260557 TTGAATCTATAGATCAATTTGGG - Intergenic
982161176 4:152571060-152571082 CAGAATCTATAGATCAAGTTGGG + Intergenic
982352506 4:154431131-154431153 TTGCATCTAAAGATCAGTTTAGG + Intronic
982491412 4:156034370-156034392 TTGAATCTATAGATCAAGTTGGG + Intergenic
982566053 4:156988226-156988248 TTAAATCTACAGATCAATTTGGG + Intergenic
982588818 4:157278042-157278064 TTGAATCTATAAATCAAGTTGGG - Intronic
982631577 4:157836625-157836647 TTACATCTACAGATTAATTTGGG - Intergenic
982895416 4:160916100-160916122 CTGATTCTATAGATCAAGTTGGG + Intergenic
983461723 4:168032639-168032661 TTGAATCTATAGATCAATTTAGG + Intergenic
983562832 4:169118096-169118118 CTTCATCTACAGAACAAGCTAGG + Intronic
983571614 4:169214496-169214518 TTGAATCTATAGATCAAGTTGGG + Intronic
984074310 4:175155494-175155516 CTGAATCTATACATCAATTTTGG + Intergenic
984259027 4:177422165-177422187 TTGAATCTGCAGGTCAAGTTGGG + Intergenic
984319799 4:178179346-178179368 TTGAATCTGCAGATCAATTTGGG - Intergenic
984369060 4:178838338-178838360 CAGCATCTCCAGATCAATTTAGG - Intergenic
984636632 4:182117856-182117878 TTGAATCTGTAGATCAAGTTGGG + Intergenic
985352344 4:189078419-189078441 TTGAATCTATAGATCAATTTTGG - Intergenic
985527076 5:410585-410607 TTATATCTACAGATCAATTTAGG + Intronic
985759647 5:1739661-1739683 TTGAATCTACAGATCAATTTGGG + Intergenic
985914480 5:2907059-2907081 CACCATCTATAGATCAAGGTTGG + Intergenic
987478147 5:18417977-18417999 CTTCAATTACAGTTCAAGTTTGG - Intergenic
987689654 5:21250674-21250696 TTGAATCTACAGATCACTTTGGG + Intergenic
987819634 5:22946331-22946353 CTGAATCTACAGAGGAACTTGGG + Intergenic
988007438 5:25435066-25435088 TTGAATCTATAGATCAAGTTGGG - Intergenic
988123598 5:26999474-26999496 CTGTACCTACATAGCAAGTTTGG - Intronic
988186991 5:27877844-27877866 ATGAATCTATAGATCAAGTTGGG + Intergenic
988647701 5:33112282-33112304 GTGAATCTACAGATCAAGTTGGG + Intergenic
989288689 5:39735423-39735445 TTGAATCTATAGATTAAGTTGGG + Intergenic
989373874 5:40739320-40739342 CTGAGTTTACAGATCAATTTCGG + Intronic
989776717 5:45217628-45217650 TTGGATCTATAGATCAAGTCAGG - Intergenic
990096978 5:52128087-52128109 TTGAATCTATAGATCAAGTTGGG - Intergenic
990142072 5:52716826-52716848 TTTAATCTACAGATCAAGCTGGG + Intergenic
990326684 5:54683689-54683711 TTGAATCTACAGATCAAGTAAGG + Intergenic
991119146 5:62991077-62991099 TTGAATCTGTAGATCAAGTTGGG + Intergenic
991619197 5:68527755-68527777 CTGTGTCTATAAATCAAGTTGGG + Intergenic
991647254 5:68813117-68813139 TTGAGTATACAGATCAAGTTGGG + Intergenic
992276644 5:75127697-75127719 CTGAATCTATAGATCAATTTGGG + Intronic
992411170 5:76506941-76506963 TTGGACCTATAGATCAAGTTGGG - Intronic
992485812 5:77193734-77193756 TTGAATCTATAGATCAATTTAGG + Intergenic
992533653 5:77676186-77676208 CTGACTCTACAGATCAAGTTGGG - Intergenic
992544686 5:77801062-77801084 TTGAATCTATGGATCAAGTTAGG - Intronic
992601074 5:78400433-78400455 TTGAATCTGTAGATCAAGTTGGG + Intronic
992694269 5:79269503-79269525 TTGAATTTATAGATCAAGTTAGG + Intronic
993588747 5:89766757-89766779 TTGAATCTACAGATCAATGTGGG + Intergenic
993785610 5:92131189-92131211 TTGGATCTATAGATCAATTTGGG + Intergenic
993810860 5:92474152-92474174 CTGCAGCTACTGATCAGGATAGG - Intergenic
994617498 5:102123770-102123792 TTGAATCTATAGATCAAGTTGGG + Intergenic
994864564 5:105250227-105250249 TTGTATCTACAGATCACTTTGGG - Intergenic
995285344 5:110382309-110382331 TTAAATCTATAGATCAAGTTGGG + Intronic
996592897 5:125167779-125167801 TTGAATCTGTAGATCAAGTTGGG - Intergenic
996778931 5:127161914-127161936 TTGAATCTATAGATCAAGTTGGG + Intergenic
996803003 5:127424436-127424458 TTGAATCTATAGATCAATTTGGG + Intronic
997041583 5:130262326-130262348 TTACATCTACAGATCAGATTGGG + Intergenic
997314238 5:132918803-132918825 TTGGATCTATAGATCAATTTGGG - Intronic
997857578 5:137386295-137386317 TTAAATCTCCAGATCAAGTTGGG - Intronic
998178823 5:139921170-139921192 TTGAATCGATAGATCAAGTTGGG - Intronic
998962135 5:147499630-147499652 TCGAATCTAAAGATCAAGTTGGG - Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999555502 5:152738115-152738137 CTGAACCTGCAGATCCAGTTGGG + Intergenic
1000054094 5:157588671-157588693 TTAATTCTACAGATCAAGTTAGG + Intergenic
1000238745 5:159389015-159389037 CTGAATCTATAGATCAAGTTGGG + Intergenic
1000405225 5:160880370-160880392 TTGAACCTATAGATCAAGTTTGG - Intergenic
1000839440 5:166198406-166198428 TTGAATTTACAGATCAATTTGGG + Intergenic
1000913824 5:167055474-167055496 TTGAATCTATAGATCAAGTTGGG + Intergenic
1001462630 5:171931098-171931120 TTGAATCTATAGATCCAGTTGGG - Intronic
1001870054 5:175145951-175145973 TTGAATCTATAGAACAAGTTGGG - Intergenic
1002769194 6:275656-275678 CTGAATCCATAGATCAACTTGGG + Intergenic
1002892211 6:1344914-1344936 TTGAACCTATAGATCAAGTTTGG - Intergenic
1003023571 6:2533040-2533062 CTGAATCTGCAGATCACATTGGG + Intergenic
1003167505 6:3693776-3693798 CTGCTTCTTAAGAACAAGTTTGG - Intergenic
1003262853 6:4537859-4537881 TTGAATCTGCAGATCAATTTGGG - Intergenic
1003637939 6:7851185-7851207 CTAAATCTAGAGATCAATTTGGG + Intronic
1004033418 6:11896287-11896309 TTGAATCTATAGATCAAGTTGGG + Intergenic
1004153467 6:13144523-13144545 CTGAATCTTGAGATCAATTTAGG - Intronic
1004435349 6:15587321-15587343 TTGCATGTATAGATCAATTTGGG - Intronic
1004678492 6:17868465-17868487 CTGCATGTATATATGAAGTTCGG + Intronic
1005007532 6:21303935-21303957 TTGAATCTATAGATCAACTTAGG - Intergenic
1005129148 6:22484498-22484520 CTCAATCTATAGATCAAGTTGGG - Intergenic
1005197356 6:23303261-23303283 CTGAATCTACAAATAAACTTGGG + Intergenic
1005216836 6:23538856-23538878 TTGAATCTATAGATTAAGTTGGG + Intergenic
1005424460 6:25687254-25687276 TTGAATCTGCAGATCAATTTGGG + Intronic
1005658100 6:27964728-27964750 TTGGATCTATAGATCAATTTGGG + Intergenic
1005708675 6:28482295-28482317 TTGTATCTATAGATCAAATTGGG - Intergenic
1006431123 6:33996557-33996579 TTGAATCTACAGATCATTTTGGG - Intergenic
1006460817 6:34156755-34156777 CTGCATCTACACATCCACATGGG + Intergenic
1006952993 6:37840644-37840666 TTGCATCTCCAGATGAATTTGGG + Intronic
1007920389 6:45604033-45604055 TTGAATCTACAGATAAATTTGGG - Intronic
1008013860 6:46495875-46495897 TTTAATCTACAGATCAAGGTGGG + Intergenic
1008258714 6:49337887-49337909 TTGAATCTACAGATCAGTTTGGG - Intergenic
1008297701 6:49797925-49797947 CTGCATCTACTGATCTAATTTGG - Intergenic
1008740931 6:54607161-54607183 TTGAATCTATAAATCAAGTTGGG + Intergenic
1008863115 6:56175704-56175726 TTGAATCTGTAGATCAAGTTAGG - Intronic
1008948071 6:57121441-57121463 TTGAATATATAGATCAAGTTAGG + Intronic
1009879627 6:69549951-69549973 TTCAATCTACAGATCAATTTGGG + Intergenic
1010035052 6:71315626-71315648 TTGAATCTAAAGATCAATTTGGG - Intergenic
1010040173 6:71372449-71372471 CTGAATCTACAGATCAACTTGGG + Intergenic
1010065577 6:71679201-71679223 CTGCATCAACATATCAAGAGTGG + Intergenic
1011017854 6:82778612-82778634 TTGAATCTACAGAGCAATTTGGG - Intergenic
1011505109 6:88033238-88033260 TTGAATCTACAGATCAAGTTGGG + Intergenic
1011707078 6:90012242-90012264 CTGAATCTACTGATGAATTTAGG + Intronic
1012054489 6:94388438-94388460 ATGCATTTAAAAATCAAGTTGGG + Intergenic
1012293417 6:97488563-97488585 TTGCATCTACAGATCACGTTGGG + Intergenic
1012332200 6:98006486-98006508 ATGAATCTGTAGATCAAGTTAGG + Intergenic
1012380994 6:98619475-98619497 CTACATCTACAGATGAAGAAAGG + Intergenic
1012466479 6:99521717-99521739 CTGCATCCACAGATAAAAGTTGG - Intronic
1012580136 6:100857935-100857957 CTGAATCTACAGATCAATTTGGG + Intronic
1012684540 6:102228831-102228853 CTGAATCCTCAGAGCAAGTTGGG + Intergenic
1012702036 6:102470858-102470880 CTGAATCTATATATCAACTTGGG + Intergenic
1012735630 6:102938009-102938031 CTGAATCTATAGATTAAGTTGGG + Intergenic
1013306956 6:108857135-108857157 TTGAATCTATAGATCAAGTTGGG + Intronic
1013440679 6:110163657-110163679 TTGAATCTACAGATCAAGTTGGG - Intronic
1013683802 6:112555039-112555061 TTGAATCTATAGATCAAGGTGGG + Intergenic
1014521013 6:122441954-122441976 TTGAATCTATAGATCAGGTTGGG - Intergenic
1014528853 6:122535143-122535165 CTACGTCTGCAGAACAAGTTTGG + Intronic
1014634905 6:123833493-123833515 TTGAAGCTATAGATCAAGTTGGG + Intronic
1014784645 6:125604461-125604483 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1014994732 6:128127358-128127380 TTGAATCTTAAGATCAAGTTAGG + Intronic
1015925506 6:138306386-138306408 CTGAATCTATACATCAATTTGGG - Intronic
1016169932 6:140999925-140999947 TTGAATCTATAGGTCAAGTTGGG + Intergenic
1016774389 6:147889013-147889035 CTACAACTACAAATCAAATTTGG + Intergenic
1017031227 6:150224414-150224436 TTGCGTCTGTAGATCAAGTTGGG + Intronic
1017081568 6:150674223-150674245 CTGCCTTTACCTATCAAGTTAGG + Intronic
1017397670 6:154021524-154021546 TTGGATCTATACATCAAGTTGGG + Intronic
1017624375 6:156333286-156333308 TTGAATCTATATATCAAGTTGGG + Intergenic
1018789246 6:167133671-167133693 TTGTATCTACAGATCGATTTGGG + Intronic
1018863282 6:167728134-167728156 TTAAATCTACAGATCAAGTTGGG - Intergenic
1020075732 7:5257508-5257530 TTGAATCTATAGATCAAGTAGGG - Intergenic
1020662716 7:11001461-11001483 TTGAATCTATAGATCAAGTTGGG + Intronic
1021381646 7:19974656-19974678 TTGTATCTATATATCAAGTTAGG + Intergenic
1022075117 7:26961099-26961121 TTGAATCTATAGATCAAGTTTGG - Intronic
1022135679 7:27446107-27446129 TTGAATCTGCAGATCAATTTGGG + Intergenic
1022296367 7:29058088-29058110 TTGAATCTATGGATCAAGTTGGG + Intronic
1022688955 7:32626686-32626708 CTGAATCTGTAGATCAAGTTGGG - Intergenic
1022937614 7:35195678-35195700 CTGAATATATAGATCAAGTTGGG + Intergenic
1023217582 7:37880706-37880728 TTTAATCTACAGACCAAGTTGGG + Intronic
1023597032 7:41840899-41840921 CTGAATCCACAGATCAAGTTGGG + Intergenic
1023649472 7:42353851-42353873 TTGAATCTACAGATCAATTTGGG - Intergenic
1023756305 7:43420866-43420888 CTGAAACCACAGATCAATTTGGG - Intronic
1023838756 7:44083722-44083744 TTGAATCTATAGATCAAGCTGGG + Intergenic
1024467380 7:49726473-49726495 TTGCATCTATAGATCAATTTAGG + Intergenic
1024482405 7:49877609-49877631 CAGCATTTACAGACCAAATTTGG - Intronic
1024690110 7:51791551-51791573 TTGAATCTATAGATCAAATTGGG - Intergenic
1024720511 7:52131914-52131936 TTGAATCTGCAGATAAAGTTGGG + Intergenic
1024905939 7:54379962-54379984 TTGCATCTGTAGACCAAGTTGGG + Intergenic
1025203346 7:56976049-56976071 TTGAATCTATAGATCAAGTAGGG + Intergenic
1025668598 7:63600878-63600900 TTGAATCTATAGATCAAGTAGGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027334740 7:77137671-77137693 TTGAATCTACAGATCAATTTGGG - Intronic
1027387976 7:77677297-77677319 TTGAATCTATAGATGAAGTTGGG + Intergenic
1027415623 7:77970913-77970935 CTGACTCTATAGATCAATTTGGG + Intergenic
1027582003 7:80009171-80009193 TTGAATCTACAGATTAAGTTTGG - Intergenic
1027749849 7:82129023-82129045 ATTCATCTACAGATAAATTTTGG - Intronic
1027928560 7:84500062-84500084 CTGAATCTATAGATCACATTGGG + Intergenic
1028004314 7:85542877-85542899 TTGAATCTATATATCAAGTTGGG + Intergenic
1028026957 7:85855274-85855296 TTGCATCTACAGATAATTTTGGG + Intergenic
1028294584 7:89112686-89112708 TTAAATCTATAGATCAAGTTGGG + Intronic
1028372516 7:90109918-90109940 TTGAATATATAGATCAAGTTGGG - Intergenic
1029038254 7:97545881-97545903 TTAAATCTACAGATCAATTTGGG - Intergenic
1029232538 7:99082796-99082818 CTGCATCTGCAGATCTGGTTAGG + Intronic
1029781061 7:102733431-102733453 TTGAATCTACAGATCAATTTGGG + Intergenic
1029833776 7:103288324-103288346 TTGAATATATAGATCAAGTTGGG + Intergenic
1029916709 7:104217508-104217530 TTGAATCTACACATCAATTTGGG - Intergenic
1030180159 7:106698858-106698880 TTGAATCTATAGATCAAGGTAGG + Intergenic
1030224608 7:107135794-107135816 TTGAATCTACAGATCAACTTGGG - Intronic
1030522538 7:110616155-110616177 CTGAATCTATAGATCACTTTTGG + Intergenic
1030542419 7:110847497-110847519 TTGAACCTACAGCTCAAGTTAGG - Intronic
1030545987 7:110895593-110895615 CTGAATCTATAGAGCAATTTAGG + Intronic
1030790424 7:113720403-113720425 TTGAATCTACAGATCAAGTTTGG - Intergenic
1031160678 7:118164096-118164118 CTGAATCTACAGATTAATTTAGG + Intergenic
1031295751 7:120001244-120001266 CTGAATCTACACATCAAGCTGGG + Intergenic
1031773403 7:125874884-125874906 TTGAATCTACAAATCAATTTTGG + Intergenic
1031924405 7:127625055-127625077 TTGAGTCTATAGATCAAGTTGGG + Intergenic
1032769906 7:135041194-135041216 TTAAATCTACAGATCAACTTGGG - Intronic
1033060494 7:138101847-138101869 TTGAATCTACAGATGAATTTGGG - Intronic
1034019238 7:147623676-147623698 CTGAATCTATAGATCACTTTGGG - Intronic
1034024969 7:147691492-147691514 TTGAATCTGTAGATCAAGTTAGG - Intronic
1034320421 7:150174922-150174944 TTGAATCTACTGATCAATTTGGG - Intergenic
1034524242 7:151646252-151646274 TTTGATCTACAGATCAATTTGGG + Intronic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1035409407 7:158626977-158626999 CTAAATTTACAGATCAAGCTGGG - Intergenic
1036580383 8:10068852-10068874 CTGAATCTCCAGATCAAGTTGGG + Intronic
1036734666 8:11301100-11301122 CTGACTCTACAGATCAATTAAGG - Intronic
1037105366 8:15100524-15100546 TTGAATCTACAGATAAAGTTGGG - Intronic
1037979829 8:23244704-23244726 CTGGATCTACAGATCAATTTGGG + Intronic
1038273009 8:26091785-26091807 TTGAATCTACAGATCAAGTTGGG - Intergenic
1038406454 8:27326006-27326028 CTGCCTCTAAAGCTCAGGTTAGG + Intronic
1038752513 8:30309154-30309176 TTGAATCTATGGATCAAGTTGGG + Intergenic
1039011125 8:33094100-33094122 CTGAATCCATAGATCAATTTGGG - Intergenic
1039533294 8:38284118-38284140 CTGCAGTTACAGATGAATTTTGG - Intronic
1039624428 8:39032995-39033017 TTGAATGTATAGATCAAGTTGGG + Intronic
1039666074 8:39529789-39529811 CTGAATCTACAGATCAATTTGGG - Intergenic
1039788044 8:40850693-40850715 GTGCATTTACAGATCACGTGGGG + Intronic
1039852945 8:41386970-41386992 CTGAATCTATTGGTCAAGTTGGG - Intergenic
1039924873 8:41920624-41920646 TTGAGTCTATAGATCAAGTTGGG - Intergenic
1040450017 8:47536217-47536239 CTGAATCTACAAATCAAGTTGGG - Intronic
1040525516 8:48220540-48220562 TTGAATCTACAGGTCAATTTCGG - Intergenic
1041093175 8:54323339-54323361 TTGAATCTATAGATTAAGTTGGG - Intergenic
1041537991 8:58949563-58949585 CTGCATTTATAGAACTAGTTGGG + Intronic
1041892306 8:62883127-62883149 TTGAATCTATAGATTAAGTTGGG + Intronic
1042152819 8:65807102-65807124 CTGAATCTGTAGATCAATTTGGG + Intronic
1042366657 8:67944941-67944963 TTGAATCTATAGATCAAATTGGG - Intergenic
1042371594 8:67997682-67997704 GTGAATCTATAGATCAATTTTGG + Intronic
1042474277 8:69228601-69228623 TTGAATCTATAGATCAATTTGGG - Intergenic
1042538486 8:69883441-69883463 TTGAATCTAAAGATCAATTTGGG - Intergenic
1042796494 8:72668786-72668808 ATGGATCTTCAGATCTAGTTGGG - Intronic
1043234759 8:77849348-77849370 TTGAATTTATAGATCAAGTTAGG + Intergenic
1043541941 8:81273864-81273886 TTGAATCTACAGATCACTTTGGG + Intergenic
1044312912 8:90715333-90715355 TTGAATCTACAGGTAAAGTTAGG + Intronic
1044783568 8:95770385-95770407 CTGGATCTGCAGATCAAATTGGG + Intergenic
1045400762 8:101815042-101815064 TTGAATCTATAGATCAAGTTAGG - Intronic
1046024112 8:108701828-108701850 TTGAATCTATAGATCAATTTGGG - Intronic
1046113611 8:109757647-109757669 TTGAATCTATAGATCAAATTGGG + Intergenic
1046388669 8:113538783-113538805 TTGAATCTACAGATCAAGTTAGG + Intergenic
1046416760 8:113926070-113926092 CTGAAACTACAGAACAATTTGGG - Intergenic
1046484238 8:114864712-114864734 TTGAATCTATAGATCAAGTTGGG - Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046884450 8:119348816-119348838 CAGGATCTACAGATCCTGTTAGG + Intergenic
1047128329 8:121988311-121988333 TTGAATCTATAGATCAAGCTGGG - Intergenic
1047867093 8:129037189-129037211 TTGAATCTACACATCAATTTGGG - Intergenic
1048025325 8:130581491-130581513 CTGACTCTATAGATCAACTTGGG + Intergenic
1048415258 8:134221072-134221094 CTGAATCTACAGATCACTTTGGG - Intergenic
1048682510 8:136859760-136859782 CTGAATCTATAGATTAAGTTGGG + Intergenic
1048695447 8:137023001-137023023 CTGCAGGTGCAGATCAAGTAAGG - Intergenic
1049486828 8:142869510-142869532 CTGCTTATACAGATCAAATAAGG + Intronic
1050695233 9:8271992-8272014 TTGAGTCTACAGATCAAGTTGGG + Intergenic
1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG + Intronic
1051116421 9:13699079-13699101 CTGAATCTATAGATCAAGTGGGG + Intergenic
1051279582 9:15428295-15428317 CTGTTTATACAGATCAACTTTGG + Intronic
1051607749 9:18932603-18932625 TTGAATCTACAGATCAATTTGGG + Intronic
1051807660 9:21013570-21013592 CTGAATCTACAGATCAATTTGGG + Intronic
1052615611 9:30836482-30836504 TTGACTCTATAGATCAAGTTGGG + Intergenic
1052665532 9:31490427-31490449 ATAAATCTATAGATCAAGTTTGG + Intergenic
1053861614 9:42392457-42392479 CTGGATCCACAAATCAAGTTAGG - Intergenic
1055015352 9:71611414-71611436 GTAAATCTATAGATCAAGTTGGG - Intergenic
1055067023 9:72129459-72129481 CTGTTTCTACAGTCCAAGTTAGG + Intronic
1055222186 9:73949589-73949611 TTTAATCTACAGATCAAGATGGG - Intergenic
1055906432 9:81299868-81299890 TTGAATCTATATATCAAGTTTGG - Intergenic
1056241348 9:84650021-84650043 CTGAATCTGTAGATCATGTTGGG + Intergenic
1056924801 9:90825295-90825317 TTGAATCTACAGATCAAGCTTGG - Intronic
1057223915 9:93276027-93276049 ATGCATCTACAGATCCATTTGGG - Intronic
1057823738 9:98355648-98355670 CTGAATGTATAGATCAAGTTGGG - Intronic
1057838094 9:98463318-98463340 CTGAATCTGTAGATCAATTTAGG - Intronic
1058205034 9:102094231-102094253 TTGAATCTATAGGTCAAGTTGGG - Intergenic
1058454018 9:105122574-105122596 ATAAATCTACAGATCAATTTGGG - Intergenic
1058515394 9:105767505-105767527 TTGCATCTATAGATTAATTTGGG + Intronic
1059667170 9:116458833-116458855 TTGAATCTACAGATAAATTTGGG - Intronic
1059881738 9:118697899-118697921 TTGAATCTATAGATCAAATTTGG - Intergenic
1060162514 9:121378617-121378639 TTGGATCTATACATCAAGTTGGG - Intergenic
1060433647 9:123573351-123573373 TTGAATCTATAGATCAATTTAGG + Intronic
1060871324 9:127043094-127043116 CTGGATCTATTGATCAAGTTGGG - Intronic
1061447118 9:130645746-130645768 ATGAATCTATAGATCAATTTGGG + Intergenic
1061815693 9:133193602-133193624 TTGCATCTATAGATCAATTTGGG - Intergenic
1062127920 9:134874771-134874793 TTGCATCTGCAGATCAATTTGGG + Intergenic
1185808830 X:3086053-3086075 TTGCATCTACAGAGCAAGTATGG - Intronic
1186668682 X:11746390-11746412 ATGAATCTATAGATCAATTTAGG + Intergenic
1187335803 X:18380463-18380485 TTGAATCTATAGATCAAATTGGG + Intergenic
1187979371 X:24738859-24738881 CTGCCACTACAGATCAAAGTTGG + Intronic
1189108194 X:38258088-38258110 CTTCATCTAAAGATAAAATTTGG - Intronic
1189179971 X:38994542-38994564 TTGCACCTACATATCAACTTGGG + Intergenic
1189424765 X:40888871-40888893 TTAAATCTATAGATCAAGTTGGG + Intergenic
1189527740 X:41842740-41842762 CTGAATCTATAGATCAATTTGGG + Intronic
1189548176 X:42065563-42065585 TTGAATCTATAGATTAAGTTAGG + Intergenic
1189648531 X:43161883-43161905 ATAAACCTACAGATCAAGTTGGG - Intergenic
1189671187 X:43410856-43410878 TTGCATCTGTGGATCAAGTTGGG + Intergenic
1190149530 X:47932573-47932595 TTGCATCTATAGATAAAATTAGG + Intronic
1190399491 X:50018041-50018063 CTGAACCTGTAGATCAAGTTGGG + Intronic
1190402456 X:50051582-50051604 TTGAATCTATAGATCAAGCTGGG + Intronic
1190492437 X:50995531-50995553 TTGAATATACAGATCAATTTTGG - Intergenic
1190547119 X:51539608-51539630 TTGAATCTATAGATCAAGTTGGG + Intergenic
1190551778 X:51589871-51589893 CTGAATCTATAGATCAAGTTGGG - Intergenic
1190605430 X:52137717-52137739 TTACATCTATAGATAAAGTTGGG - Intergenic
1190689924 X:52905132-52905154 TTCATTCTACAGATCAAGTTGGG + Intronic
1190696059 X:52950660-52950682 TTCATTCTACAGATCAAGTTGGG - Intronic
1191684520 X:63875976-63875998 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1192187871 X:68965530-68965552 TTTAATCTACAGATCAAGTTGGG + Intergenic
1192303408 X:69930958-69930980 TTGAATCTATAGATCAATTTTGG - Intronic
1192375864 X:70561078-70561100 TTGAATCTATAGATCAATTTGGG + Intronic
1192391706 X:70735648-70735670 TTGAATCTGCAGATCAATTTGGG - Intronic
1192540465 X:71965675-71965697 TTGAATCCATAGATCAAGTTGGG + Intergenic
1193393007 X:80951215-80951237 TTGAATCTAAAGATCAATTTGGG + Intergenic
1193399274 X:81022451-81022473 TTGAATCTATAGATCAAGTTGGG - Intergenic
1194060724 X:89193789-89193811 TTGAATCTACAGATTTAGTTGGG + Intergenic
1194234353 X:91363550-91363572 TTTAATCTACAGATCAATTTTGG + Intergenic
1194234801 X:91369623-91369645 TTGAATCTATAGATCAAGTTAGG + Intergenic
1194532363 X:95067371-95067393 TTGAATCTACAGATAAAATTTGG - Intergenic
1194769854 X:97888786-97888808 TTGAATCTACAGATTAATTTGGG + Intergenic
1195052045 X:101105983-101106005 CTGCATGTAAAGATCTAGTAGGG - Intronic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1195300133 X:103521536-103521558 CTGAATCTATAGATCAGTTTTGG - Intergenic
1195587339 X:106579931-106579953 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1196000539 X:110779749-110779771 TTGCATCTATTCATCAAGTTGGG + Intronic
1196852664 X:119952759-119952781 TTCAATCTACAGGTCAAGTTGGG + Intergenic
1197539440 X:127738579-127738601 TTGAATGTATAGATCAAGTTGGG - Intergenic
1197599042 X:128505531-128505553 TTAAATCTACAGATCAATTTGGG - Intergenic
1197730835 X:129808143-129808165 TTGAATCTATAGATCAATTTGGG - Intronic
1198318354 X:135493220-135493242 CTGAATATGCAGATCAATTTGGG - Intergenic
1198420667 X:136468458-136468480 CTGCATCAACATATGAATTTCGG - Intergenic
1198501152 X:137248347-137248369 CTGAATCTACAGATCATTTTGGG - Intergenic
1198842549 X:140874146-140874168 TTGAATCTATATATCAAGTTAGG - Intergenic
1199444443 X:147905717-147905739 TTGAATCTATAGATCAAGTAGGG - Intergenic
1199584498 X:149399539-149399561 TTGAATCTACAGATCAATTTGGG + Intergenic
1199674404 X:150174292-150174314 CTGAATCTACAAAACAATTTGGG + Intergenic
1199702614 X:150394510-150394532 CTGAATCTATAGATCAAATTGGG + Intronic
1199937830 X:152594008-152594030 CTGAATCTACAGATCAATCTGGG + Intergenic
1201899223 Y:19030475-19030497 CTTAATCTATAGATCAATTTAGG + Intergenic