ID: 950322462

View in Genome Browser
Species Human (GRCh38)
Location 3:12069761-12069783
Sequence GGTACCAAATCACACCCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 445}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950322462_950322466 6 Left 950322462 3:12069761-12069783 CCTACTGGGTGTGATTTGGTACC 0: 1
1: 0
2: 2
3: 57
4: 445
Right 950322466 3:12069790-12069812 TTGTTTATTTGTTTTGTTTTGGG 0: 1
1: 44
2: 227
3: 1910
4: 21778
950322462_950322465 5 Left 950322462 3:12069761-12069783 CCTACTGGGTGTGATTTGGTACC 0: 1
1: 0
2: 2
3: 57
4: 445
Right 950322465 3:12069789-12069811 TTTGTTTATTTGTTTTGTTTTGG 0: 1
1: 62
2: 307
3: 2387
4: 24648

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950322462 Original CRISPR GGTACCAAATCACACCCAGT AGG (reversed) Intronic
901128506 1:6946518-6946540 GATACCACCTCATACCCAGTAGG - Intronic
901613241 1:10516384-10516406 GGTCCCACAGCAAACCCAGTGGG - Intronic
901901969 1:12372403-12372425 GATACCACATCATACCCAGTAGG - Intronic
902944974 1:19828974-19828996 GATACCACCTCACACCCATTAGG - Intergenic
904217765 1:28937105-28937127 GGTACCATTTCACACCCTTTAGG - Intronic
905077234 1:35283304-35283326 GATACCACTTCACACCCACTAGG - Intronic
905160803 1:36032249-36032271 GATACCACTTCACACCCATTAGG - Intronic
905712231 1:40116074-40116096 GGTACCACCTGACACCCATTAGG + Intergenic
906350966 1:45058950-45058972 GATACCACTTCACACCCACTAGG + Intronic
906997653 1:50814813-50814835 GATACCACCTCACACCCATTAGG + Intronic
907057603 1:51385362-51385384 GATACCACTTCACACCCATTAGG + Intronic
907251650 1:53143522-53143544 GGTACAAAATTCCACCCAGAGGG + Intergenic
909607851 1:77524489-77524511 GATACCACCTCACACCCATTAGG - Intronic
910946909 1:92603145-92603167 GATACCACTTCACACCCATTAGG + Intronic
911073690 1:93852329-93852351 GATACCACTTCACACCCAGTAGG + Intergenic
911160898 1:94682394-94682416 GATACCACATCACACCCATTAGG + Intergenic
911671320 1:100611828-100611850 TGCAGCAAATCACACTCAGTTGG - Intergenic
912461935 1:109840327-109840349 AGTACCACATCACACCCATTAGG + Intergenic
912586281 1:110769433-110769455 GATACCACATCACAACCATTGGG - Intergenic
914439963 1:147696372-147696394 GATACCACATCATACCCATTAGG - Intergenic
914794471 1:150908451-150908473 GATACCACTTCACACCCACTAGG - Intergenic
915144360 1:153786605-153786627 GATACCACATCGCACCCAGTAGG - Intergenic
915394829 1:155575300-155575322 GATACCACTTCACACCCACTAGG - Intergenic
916356173 1:163910825-163910847 GATACCATTTCACACCCAGTAGG + Intergenic
917394373 1:174576482-174576504 GGAAGCAAATCACACGCTGTTGG + Intronic
917422288 1:174877287-174877309 GCTAGCAATTCACCCCCAGTAGG - Intronic
917434216 1:175002323-175002345 GATGCCACTTCACACCCAGTAGG - Intronic
917834018 1:178926414-178926436 GATACCACATCCCACCCAATGGG + Intergenic
917865925 1:179195317-179195339 GATACCACATCACAGCCATTAGG + Intronic
917879379 1:179319135-179319157 GGTATCATTTCACACCCACTAGG - Intronic
918121362 1:181543787-181543809 GATACCACCTCACACCCATTAGG + Intronic
918312093 1:183292290-183292312 CACACCAAATCACACCCACTGGG - Intronic
918312294 1:183293407-183293429 CATACCAAGCCACACCCAGTGGG + Intronic
918484344 1:185013313-185013335 GATACCACTTCACACCCATTAGG - Intergenic
918744191 1:188178844-188178866 AGTACCACATCACACTCACTAGG - Intergenic
919800008 1:201348269-201348291 GCTCCCAAACCACACCCAGGGGG + Intergenic
919936805 1:202256904-202256926 GATACCACTTCACACCCACTAGG - Intronic
921914989 1:220597427-220597449 GGTACCACCTCACACCTATTAGG - Intronic
922111813 1:222566275-222566297 GATACCACTTCACACCCACTAGG + Intronic
922163926 1:223099304-223099326 GCTACCACTTCACACCCAATAGG + Intergenic
922527260 1:226314270-226314292 GATACCAATTCACACCCACTGGG + Intergenic
923177566 1:231481832-231481854 GATACCACTTCACACCCATTAGG - Intergenic
923625375 1:235609435-235609457 GGTACCACTTCACACCCACGAGG - Intronic
923886615 1:238164568-238164590 GGTACCAACTCAGCCACAGTGGG - Intergenic
924101127 1:240603617-240603639 GGTAAAAAATCCCACACAGTAGG - Intronic
924171176 1:241342812-241342834 GATACCACTTCACACCCATTAGG + Intronic
924545563 1:245023600-245023622 GATACCATTTCACACCCAGTAGG - Intronic
924635181 1:245779972-245779994 AGTACCACCTCACACCCACTAGG + Intronic
1062790288 10:299960-299982 GATACCATCTCACACCCATTAGG + Intronic
1062926344 10:1318271-1318293 GGTACCAAATCATACCATGATGG - Intronic
1063165916 10:3462205-3462227 TGTACCACATCACAACCTGTAGG + Intergenic
1063165928 10:3462274-3462296 TGTACCACATCACAACCTGTAGG + Intergenic
1064181437 10:13119747-13119769 GATACCAATTCACATCCACTAGG - Intronic
1064219621 10:13429567-13429589 GGTACCACTTCACACTCACTAGG + Intergenic
1065071211 10:22025406-22025428 GATACCACTTCACACCCACTAGG - Intergenic
1065106691 10:22395420-22395442 GATACCAATTCAAACCCACTAGG - Intronic
1065336633 10:24658985-24659007 GATACCACTTCACACCCACTGGG + Intronic
1067063745 10:43091788-43091810 GATACCATCTCACACCCATTTGG + Intronic
1067413552 10:46086024-46086046 GATACCACTTCACACCCATTAGG - Intergenic
1067684921 10:48460428-48460450 GATACCACCTCACACCCACTAGG + Intronic
1067760007 10:49037902-49037924 GATACCACCTCACACCCATTAGG + Intronic
1067856836 10:49801345-49801367 GGTGCCACTTCACACCCACTAGG - Intergenic
1068387124 10:56345179-56345201 GGTATCACTTCACACCCATTAGG + Intergenic
1069851990 10:71412701-71412723 GATACCACTTCACACCCATTAGG - Intronic
1070639366 10:78155938-78155960 GGTACCACTTCACACCCACTAGG - Intergenic
1070960144 10:80493203-80493225 GATACCACTTCACACCCATTGGG + Intronic
1071506631 10:86236083-86236105 GATACCACTTCACACCCACTAGG - Intronic
1071542209 10:86496244-86496266 GATACCACTTCACACCCATTAGG + Intronic
1072150838 10:92681643-92681665 GATACCACTTCACACCCACTAGG - Intergenic
1072501981 10:96026604-96026626 GTTGTCAAATCACACCCAGTAGG + Intronic
1072616331 10:97051220-97051242 GATACCACTTCACACCCACTAGG + Intronic
1072643393 10:97232011-97232033 GATACCACTTCACACCCACTAGG - Intronic
1072755097 10:98014745-98014767 GATACCATTTCACACCCATTAGG + Intronic
1073223456 10:101895937-101895959 GATACCACTTCACACCCATTAGG + Intronic
1074014890 10:109524533-109524555 GGTATCACTTCACACCCACTAGG + Intergenic
1074037582 10:109756418-109756440 GGTACCAAATCATACTGACTGGG + Intergenic
1074055440 10:109919427-109919449 GATACCACTTCACACCCACTAGG + Intronic
1074444367 10:113506865-113506887 GATACCACTTCACACCCACTAGG - Intergenic
1074772687 10:116743536-116743558 GTTACAATATCACACCCAGCAGG + Intergenic
1076103369 10:127800646-127800668 GATACCAATCCACACCCAATAGG + Intergenic
1076392691 10:130115283-130115305 GATACCACTTCACACCCATTAGG + Intergenic
1078092457 11:8274645-8274667 GATACCAATTCACACCCACTAGG + Intergenic
1078637721 11:13067433-13067455 GATACCACTTCACACCCACTAGG + Intergenic
1079105178 11:17567027-17567049 TGTACCCAATCCTACCCAGTTGG - Intronic
1080512570 11:32989595-32989617 GGTATCACCTCACACCCATTAGG + Intronic
1080557223 11:33428946-33428968 GATACCACCTCACACCCACTAGG - Intergenic
1081397854 11:42608845-42608867 GATACCAGTTCACACCCACTAGG + Intergenic
1081483597 11:43510542-43510564 GATACCACTTCACACCCATTAGG + Intergenic
1081717539 11:45261165-45261187 GATACCACCTCACACCCATTAGG + Intronic
1083824893 11:65195061-65195083 GATACCACTTCACACCCACTAGG - Intronic
1083905989 11:65670933-65670955 GATACCACTTCACACCCATTAGG + Intergenic
1084567088 11:69936599-69936621 GATACCACTTCACACCCACTAGG + Intergenic
1084578639 11:70007952-70007974 GATACCACCTCACACCCACTGGG - Intergenic
1084984274 11:72854018-72854040 GATACCATTTCACACCCATTAGG + Intronic
1086033903 11:82393800-82393822 GATACCACATCACACCCATTGGG + Intergenic
1087109895 11:94453510-94453532 GATACCACTTCACACCCATTAGG - Intronic
1088520656 11:110695628-110695650 GATACCACATCACACACATTAGG + Intronic
1089030524 11:115323127-115323149 AGTACCACTTCAGACCCAGTAGG - Intronic
1090900129 11:131023163-131023185 GATACCACTTCACACCCATTAGG + Intergenic
1090940687 11:131385408-131385430 GGTACAACTTCACACCCATTAGG + Intronic
1092841647 12:12548309-12548331 GGTATCACGTCACACCCATTAGG + Intronic
1094154821 12:27328431-27328453 GGAACCTAATCACAGCTAGTCGG - Intergenic
1095805635 12:46317009-46317031 AGTGCCAACTCACACCCATTAGG + Intergenic
1096132332 12:49169568-49169590 GATACCACTTCACACCCACTAGG + Intergenic
1096442552 12:51656789-51656811 GGTACCACTTTACACCCATTAGG + Intronic
1097093728 12:56528600-56528622 GATACCACTTCACACCCAGTAGG + Intronic
1097651281 12:62299857-62299879 GATACCACTTCACACCCACTTGG - Intronic
1097814901 12:64062218-64062240 GATACCACTTCACACCCACTAGG - Intronic
1099308397 12:80987298-80987320 GATACCAAATCACATACACTGGG + Intronic
1099764156 12:86960819-86960841 GGTACCAACTCAGTCGCAGTGGG - Intergenic
1100102286 12:91123389-91123411 GGTACTAAAAAACACACAGTAGG - Intergenic
1100500293 12:95167417-95167439 GGTACCACTGCACACCCACTAGG - Intronic
1100672355 12:96830402-96830424 GATACCACTTCACACCCACTAGG - Intronic
1101275821 12:103199766-103199788 GGTACCAACTCACACCTGTTAGG + Intergenic
1101927814 12:108987636-108987658 GATACCATCTCACACCCATTAGG - Intronic
1102890295 12:116553323-116553345 GGTACCACATCACACGCACTAGG + Intergenic
1104403815 12:128500642-128500664 GATACCACTTCACACCCATTAGG + Intronic
1105327083 13:19380460-19380482 GATCCCATTTCACACCCAGTGGG - Intergenic
1105449836 13:20489606-20489628 GATACCACCTCACACCCATTAGG + Intronic
1105647287 13:22335400-22335422 GATACCACTTCACACCCAGTAGG - Intergenic
1105864564 13:24447876-24447898 GATCCCATTTCACACCCAGTGGG + Intronic
1105985501 13:25562320-25562342 GGTACCACTTCATACCCATTAGG - Intronic
1106317130 13:28604394-28604416 GATACCATCTCACACCCACTAGG + Intergenic
1106353870 13:28960179-28960201 AATACCACATCACACCCACTAGG + Intronic
1107008037 13:35637243-35637265 GATACCACCTCACACCCATTAGG + Intronic
1107132010 13:36906698-36906720 GGTACCACTTCATACCCACTAGG + Intronic
1107364218 13:39652952-39652974 GGTATCATATCACACTGAGTAGG + Intergenic
1107742564 13:43467384-43467406 GGTACCACTTCATACCCACTTGG - Intronic
1107844442 13:44496864-44496886 GATACCACTTCACACCCACTAGG + Intronic
1108098979 13:46935054-46935076 GGTACCAGCTCAGACACAGTAGG + Intergenic
1108109941 13:47058904-47058926 GGTAACACATCACACTCATTAGG - Intergenic
1108452482 13:50581179-50581201 GATACCACTTCACACCCACTAGG - Intronic
1108680332 13:52774679-52774701 GATACCACTTCACACCCATTTGG - Intergenic
1109264320 13:60179291-60179313 GGTGGCAAATCAAACCCAGTGGG - Intergenic
1111168485 13:84493973-84493995 GGTACCAACTTTCACCAAGTAGG + Intergenic
1111206964 13:85023044-85023066 GGTACCACTTCACATCCATTAGG - Intergenic
1112008325 13:95273365-95273387 GGTCCCAAATAACACCCTCTAGG + Intronic
1112059316 13:95721606-95721628 GATACCAATTCACACCCATTAGG - Intronic
1112740110 13:102463344-102463366 GATACCACTTCACACCCACTGGG + Intergenic
1114382569 14:22223428-22223450 GCTGCCACATCACACCCACTAGG + Intergenic
1115583141 14:34782261-34782283 GATACCACTTCACACCCAGTAGG - Intronic
1115976881 14:39006388-39006410 GGTACTATCTCACACCCAATAGG + Intergenic
1116145207 14:41058266-41058288 GATACCAATTCACACCCATTAGG - Intergenic
1116906637 14:50410141-50410163 GATACCAATTCACAACCACTAGG - Intronic
1118147306 14:63153641-63153663 GGTACCAATTGACACCTATTGGG + Intergenic
1118298553 14:64593419-64593441 GATACCACTTCACACCTAGTAGG + Intergenic
1118946851 14:70396673-70396695 GTTACCACTTCACACCCATTAGG - Intronic
1119523795 14:75305931-75305953 GATACCACCTCACACCCATTAGG - Intergenic
1121028130 14:90631808-90631830 GATACCACTTCATACCCAGTAGG - Intronic
1122095535 14:99368094-99368116 GGTACCACTTCACACCTACTAGG - Intergenic
1122185625 14:99992144-99992166 GATACCACTTCACACCCATTAGG - Intronic
1122343586 14:101044547-101044569 GGTACCAAGTCATACACAGAAGG + Intergenic
1122554941 14:102573335-102573357 GATACCACTTCACACCCACTAGG - Intergenic
1123672217 15:22670500-22670522 GATACCACTTCACACCCACTAGG - Intergenic
1123702208 15:22923415-22923437 GATACCACCTCACACCCACTAGG + Intronic
1123907990 15:24939273-24939295 GATACCACTTCACACCCATTTGG - Intronic
1123996831 15:25724565-25724587 GAGACCACATCACACCCACTTGG + Intronic
1124324265 15:28743798-28743820 GATACCACTTCACACCCACTAGG - Intergenic
1124528148 15:30476835-30476857 GATACCACTTCACACCCACTAGG - Intergenic
1124770509 15:32530869-32530891 GATACCACTTCACACCCACTAGG + Intergenic
1124931870 15:34127964-34127986 GATACCACTTCACACCCACTAGG - Intergenic
1127092889 15:55484039-55484061 GATACCACTTCACACCCATTAGG + Intronic
1127171568 15:56308265-56308287 GATACCATTTCACACCCAGTAGG - Intronic
1128102124 15:65010908-65010930 GATACCACTTCACACCCATTAGG - Intronic
1128604965 15:69030007-69030029 GTTACCACTTCACACCCATTAGG - Intronic
1129182233 15:73884730-73884752 GGCACCAGATCACATCCAGCAGG - Intronic
1129558862 15:76544127-76544149 GATACCATTTCACACCCACTAGG + Intronic
1130318291 15:82815756-82815778 GATACCACTTCACACCCACTAGG - Intronic
1130361664 15:83193379-83193401 GATACCACCTCACACCCATTAGG + Intronic
1130431932 15:83857017-83857039 GGTACCACTTCACACCTATTAGG - Intronic
1131630545 15:94172466-94172488 GATACCATCTCACACCCATTAGG + Intergenic
1132730496 16:1358770-1358792 GGTACCGCTTCACACCCACTAGG - Intronic
1133159444 16:3900419-3900441 GATACCACTTCACACCCACTAGG + Intergenic
1133884722 16:9815575-9815597 GATACCACCTCATACCCAGTGGG + Intronic
1134411679 16:14007759-14007781 GATACCACTTCACACCCACTAGG - Intergenic
1135098566 16:19585734-19585756 GGTACCACTTCAAACCCACTAGG - Intronic
1137689468 16:50411845-50411867 GATACCACTTCACACCCACTAGG - Intergenic
1139370289 16:66463336-66463358 GATACCATTTCACACCCAGTAGG - Intronic
1140100612 16:71913302-71913324 GATACCACCTCACACCCATTAGG - Intronic
1141257497 16:82416171-82416193 GGTACAAAATCACCCCCGCTTGG + Intergenic
1142633180 17:1239423-1239445 GATACCACATCACACGCACTAGG - Intergenic
1143085019 17:4409497-4409519 GATACCAATTCACACCCACTAGG + Intergenic
1143626636 17:8114177-8114199 GGGCCCAATTAACACCCAGTGGG + Intronic
1143763190 17:9119821-9119843 AGCACCACATCACACTCAGTAGG - Intronic
1143835902 17:9692386-9692408 GGTACCACTTCACACCCACTGGG - Intronic
1143910167 17:10242065-10242087 GATACCACTTCACACCCACTAGG - Intergenic
1146988927 17:37249547-37249569 GATACCACCTCACACCCATTAGG - Intronic
1148193198 17:45694493-45694515 CATACCAATTCACACCCAATAGG - Intergenic
1148361077 17:47012675-47012697 GATACCAGTTCACACCCACTAGG + Intronic
1149502948 17:57168849-57168871 GATACCACTTCACACCCACTAGG - Intergenic
1149689623 17:58563952-58563974 GGCACCACCTCACACCCATTAGG + Intronic
1150017230 17:61570360-61570382 GGTACCACTTCACACCCACTGGG - Intergenic
1150639002 17:66937124-66937146 GATACCATCTCACACCCATTAGG - Intergenic
1150712453 17:67543507-67543529 GATACCACTTCACACCCACTAGG - Intronic
1151779494 17:76234561-76234583 GATACCACTTCACACCCACTAGG - Intronic
1152464867 17:80460355-80460377 AGTACCAGTTCACACCCATTAGG + Intergenic
1155650949 18:28140972-28140994 GGTACCATTTCACACCTACTAGG + Intronic
1155985471 18:32226424-32226446 GATACCACTTCACACCCACTAGG - Intronic
1157694003 18:49706265-49706287 GGTACCACCTCACATCCATTAGG - Intergenic
1157944685 18:51965821-51965843 GATACCATTTCACACCCACTAGG - Intergenic
1159579547 18:70219584-70219606 GATACCACCTCACACCCATTAGG + Intergenic
1159617816 18:70601502-70601524 AATACCACATCACACCCATTAGG - Intergenic
1160166316 18:76515747-76515769 GATACCACTTCACACCCACTGGG + Intergenic
1160470082 18:79123958-79123980 GATACTACTTCACACCCAGTAGG + Intronic
1161146480 19:2681814-2681836 GATACCACTTCACACCCAGTAGG - Intronic
1161773615 19:6244885-6244907 GGTACCACTTCACACCCACTAGG + Intronic
1162933315 19:13967942-13967964 GATTTCAAATCCCACCCAGTTGG - Intronic
1163537693 19:17886734-17886756 GGTATCACTTCACACCCACTAGG - Intronic
1164968166 19:32505459-32505481 GATACCACCTCACACCCATTAGG + Intergenic
1165108731 19:33489043-33489065 GGGACCCAAGCACATCCAGTGGG + Intronic
1167881296 19:52460343-52460365 GGTATCACCTCACACCCATTAGG - Intronic
925757221 2:7145078-7145100 GGTGCTAAACCACACACAGTAGG + Intergenic
925983741 2:9198083-9198105 GATACCATGTCACACCCACTAGG - Intergenic
927066040 2:19472012-19472034 TGTAGCAAATCATACCCAATAGG + Intergenic
927120351 2:19954619-19954641 GATACCACCTCACACCCACTAGG + Intronic
927610161 2:24531037-24531059 GGTACCACCCCACACCCATTAGG + Intronic
927727281 2:25435870-25435892 GATACCACTTCACACCCATTAGG - Intronic
928698438 2:33873987-33874009 GATACCACTTCACACCCACTAGG - Intergenic
929290479 2:40185057-40185079 GATACCATGTCACACCCACTAGG + Intronic
929750032 2:44701326-44701348 GATACCACTTCACACCCACTAGG - Intronic
929939418 2:46321584-46321606 GATACCACTTCACACCCACTAGG - Intronic
930674893 2:54189895-54189917 GATACCATCTCACACCCATTAGG - Intronic
931445434 2:62323427-62323449 GATACCACATCATACCCACTAGG - Intergenic
931506325 2:62931321-62931343 GATACCATCTCACACCCATTAGG + Intronic
932375348 2:71230619-71230641 GGTACCATTTCACACTCATTAGG - Intergenic
933204901 2:79495418-79495440 GATACCAAATCACACCTATTAGG + Intronic
933640399 2:84753091-84753113 GGTACCATCTCACACCCACTAGG - Intronic
934522527 2:95028382-95028404 GATACCACTTCACACCCATTAGG + Intronic
935044843 2:99471855-99471877 GATACCACCTCACACCCAGCAGG + Intronic
935480172 2:103577314-103577336 GATACCACTTCACACCCACTAGG - Intergenic
935484191 2:103632498-103632520 GATACCATTTCACACCCATTAGG - Intergenic
935629935 2:105205456-105205478 GGTATCACCTCACACCCATTTGG - Intergenic
936386726 2:112036926-112036948 GATACCACTTCACACCCACTAGG + Intergenic
937096415 2:119238335-119238357 GATACCACTTCACACCCACTAGG - Intronic
937611104 2:123862687-123862709 GATACCACTACACACCCAGTAGG + Intergenic
937778004 2:125804130-125804152 GATACCACTTCACACCCATTAGG + Intergenic
937791472 2:125967197-125967219 GCTAAAAAATCACACCCAGAGGG - Intergenic
937899609 2:127008536-127008558 GATACCAACTCACACCCAGTAGG - Intergenic
938372292 2:130778794-130778816 GGTACCACTTCACACCCAGTAGG + Intergenic
938375748 2:130805135-130805157 GATACCATTTCACACCCATTAGG + Intergenic
938590146 2:132728208-132728230 GGTACCACATAACCCCCACTAGG + Intronic
938694500 2:133823143-133823165 GGTACCAAATCATACCCATGGGG + Intergenic
939655879 2:144824510-144824532 AATACCACTTCACACCCAGTAGG + Intergenic
941727181 2:168874179-168874201 GATACCATTTCATACCCAGTAGG + Intronic
942239885 2:173952381-173952403 GATACCACTTCACACCCACTAGG + Intronic
942804068 2:179909204-179909226 GGTACCATTTCACACCCACTAGG + Intergenic
943396475 2:187341778-187341800 GGTACCATTTCACATCCATTAGG + Intergenic
943593879 2:189831988-189832010 GGTAACAAATAACATCCACTGGG - Intronic
944162685 2:196681657-196681679 GGTACCACTTCACACCCATTAGG - Intronic
944697658 2:202217430-202217452 GATACCACTTCACACCCACTAGG + Intronic
944855138 2:203760057-203760079 GATACCAACTCACCCACAGTAGG - Intergenic
945050974 2:205824137-205824159 GATACCATTTCACACCCACTAGG + Intergenic
946282102 2:218672934-218672956 GGTACCAAATCCCACCCAAAAGG - Intronic
946316041 2:218913340-218913362 GATACCACTTCACACCCAGTGGG - Intergenic
946390645 2:219414530-219414552 GGTACCACCTCACATCCATTAGG + Intergenic
947379484 2:229531460-229531482 GATACCAATTCACACTCAGAGGG + Intronic
947469857 2:230391411-230391433 GATACCACATCACACTCACTAGG - Intronic
947952176 2:234157942-234157964 GGCCTCAAATCACACCCTGTAGG - Intergenic
948106241 2:235416255-235416277 GATACCAAGTTACACCCATTAGG - Intergenic
948331782 2:237173441-237173463 GTTACCACCTCACACCCATTAGG - Intergenic
948351204 2:237342586-237342608 GTAACAAAATCACTCCCAGTGGG + Intronic
1169809952 20:9599551-9599573 GATACTAAGTCACACCCATTAGG - Intronic
1170015484 20:11776693-11776715 GATACCACAGCACACCCAGTAGG + Intergenic
1170225528 20:13987678-13987700 GTTATCACATCACACCCACTAGG - Intronic
1170778953 20:19406257-19406279 GGTACCAAATCATACCCCATTGG + Intronic
1171176762 20:23056984-23057006 GATACCAATACACACCCACTAGG + Intergenic
1171457662 20:25281038-25281060 GGGACCCAATCACACACAGGTGG - Exonic
1172812961 20:37663322-37663344 GATACCACTTCACACCCACTAGG - Intergenic
1172988858 20:39016711-39016733 GATACCATTTCACACCCACTAGG - Intronic
1173533485 20:43789033-43789055 GATACCACCTCACACCCATTAGG - Intergenic
1175477033 20:59283599-59283621 GATACCACTTCACACCCATTAGG - Intergenic
1175632170 20:60550409-60550431 GGTACCAACTCAGCCACAGTAGG - Intergenic
1175880863 20:62258060-62258082 AGTACCACATCACACACAGCTGG - Intronic
1176083014 20:63283394-63283416 GGTTCAGAATCACACCCAGGAGG + Intronic
1178296017 21:31411050-31411072 GGTTCTAAATCATCCCCAGTGGG - Intronic
1178627334 21:34229118-34229140 GATACCACCTCACACCCATTAGG + Intergenic
1179191838 21:39129294-39129316 GATACCACCTCACACCCATTAGG - Intergenic
1179882458 21:44299141-44299163 GGTACCACCTCATACCCATTAGG - Intergenic
1179899002 21:44379298-44379320 GGCACCCACTCAGACCCAGTGGG - Intronic
1180178260 21:46101101-46101123 GATACCACCTCACACCCATTAGG - Intronic
1180909480 22:19438998-19439020 GATACCACCTCACACCCATTAGG - Intronic
1181380606 22:22500050-22500072 GATACCACCTCACACCTAGTAGG + Intronic
1181723466 22:24794379-24794401 GGTATCACTTCACACCCACTAGG + Intergenic
1181740448 22:24917388-24917410 GATACCAATTCACACGCACTAGG - Intronic
1181827963 22:25534964-25534986 GATACCACCTCACACCCATTAGG - Intergenic
1182400509 22:30073023-30073045 GATATCATTTCACACCCAGTAGG + Intergenic
1183766835 22:39885294-39885316 GATACCAATTCACAACCAGTAGG + Intronic
1183830080 22:40413877-40413899 GATACCACTTCACACCCATTAGG + Intronic
1184540111 22:45116656-45116678 GATACCACCTCACACCCATTAGG + Intergenic
950213132 3:11138439-11138461 GGTACCACTTCACACTCACTAGG + Intronic
950261825 3:11547712-11547734 GCTACCACTTCACACCCACTAGG - Intronic
950290292 3:11778689-11778711 GATACCACCTCACACCCACTAGG - Intergenic
950322462 3:12069761-12069783 GGTACCAAATCACACCCAGTAGG - Intronic
951758242 3:26116672-26116694 GATACCACCTCACACCCATTAGG - Intergenic
952016516 3:28962965-28962987 GATACCACATCACAGCCACTAGG - Intergenic
952915375 3:38234543-38234565 GATACCACTTCACACCCACTAGG + Intronic
953318674 3:41952518-41952540 GATACCACCTCACACCCATTAGG + Intronic
953423897 3:42776988-42777010 GATACCATTTCACACCCATTAGG + Intronic
953803112 3:46043952-46043974 GGTACCACTTCATACCCACTAGG - Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
954302919 3:49710160-49710182 GGTACCATATCCTACCCATTAGG - Intronic
954339787 3:49943960-49943982 GATACCACTTCACACCCATTAGG - Intronic
954789650 3:53122538-53122560 AGGACCAAAACACACCCAGGGGG + Exonic
955304065 3:57811776-57811798 GATACCACTTCACACCCATTAGG - Intronic
956176706 3:66479743-66479765 GATACCACAACACACCCACTAGG + Intronic
961366061 3:126400322-126400344 GATACCACCTCACACCCATTAGG + Intronic
961411302 3:126722493-126722515 GGTACCACATCACACCCACGAGG - Intronic
961418289 3:126778456-126778478 GATACCACATCACATCCACTAGG - Intronic
961833635 3:129638922-129638944 GGTACCACTTTACACCCATTAGG + Intergenic
961855051 3:129861670-129861692 GGTACCATTTCACACCCACTAGG + Intronic
962182299 3:133220833-133220855 GGTCCCAATTTACAGCCAGTTGG - Intronic
962499236 3:135972649-135972671 GGCACCACTTCACACCCACTAGG - Intronic
962659980 3:137591963-137591985 GGTACCACGTCATACCCACTAGG + Intergenic
962674128 3:137740877-137740899 GATACCAACTCACACCTATTAGG - Intergenic
962843726 3:139257543-139257565 GATACCACTTCACACCCATTAGG - Intronic
963209556 3:142673947-142673969 GATACCACATCACAACCACTAGG - Intronic
963865905 3:150361165-150361187 GATACCACATCACACTCACTAGG + Intergenic
963895516 3:150681738-150681760 GATACCACTTCACACCCATTAGG - Intronic
967150767 3:186647530-186647552 GGTACCAATTCATGCCCAGTAGG - Intronic
967737792 3:192971736-192971758 GATACCACTTCACACCCAGGAGG - Intergenic
967818819 3:193821624-193821646 GCTACCACCTCACACCCATTAGG - Intergenic
971133714 4:23842293-23842315 AAGAGCAAATCACACCCAGTAGG - Intronic
972617024 4:40709111-40709133 GATACCATTTCACACCCACTGGG + Intergenic
972618937 4:40727296-40727318 GATACCACTTCACACCCACTGGG - Intergenic
972668577 4:41192086-41192108 GGTACCACCTCACACCCATTAGG + Intronic
972744308 4:41918388-41918410 GATACCACTTCACACCCATTAGG + Intergenic
974851993 4:67414847-67414869 GGTACAACTTCACACCCACTAGG - Intergenic
974861009 4:67521482-67521504 GATACTACATCACACCCATTAGG + Intronic
975608190 4:76177308-76177330 GATACCACTTCACACCCACTAGG + Intronic
977464709 4:97369392-97369414 GCTACCACTTCACACCGAGTAGG - Intronic
978265575 4:106820442-106820464 GATACCATTTCACACCCACTGGG - Intergenic
978661930 4:111137396-111137418 GGTACCAACACAGACACAGTGGG - Intergenic
979073523 4:116241360-116241382 GATTCCAGATCACACACAGTAGG - Intergenic
981267952 4:142809522-142809544 GGTACCACATGGCACCCATTTGG + Intronic
981484689 4:145272818-145272840 GGTATCACTTCACACCCATTAGG - Intergenic
982024735 4:151240583-151240605 GATACCACTTCACACCCACTAGG + Intronic
982986131 4:162209170-162209192 GGTACCACTTCACACACACTAGG + Intergenic
983924241 4:173380468-173380490 GATACCACTTCACACCCAGTAGG - Intergenic
984823153 4:183901626-183901648 GATACCAACTCACACCCATTAGG - Intronic
985172400 4:187165882-187165904 GATACCACGTCACACCCATTAGG + Intergenic
988789951 5:34598572-34598594 GGTAGTAATTGACACCCAGTAGG + Intergenic
990087050 5:51991984-51992006 GGTACCACATCACACCTACCCGG + Intergenic
990338469 5:54799019-54799041 GATACCACTTCACACCCACTAGG + Intergenic
990443802 5:55873595-55873617 GGTATCACTTCACACCCACTAGG - Intronic
991373784 5:65944353-65944375 GATACCACCTCACACCCATTAGG - Intronic
991664686 5:68987116-68987138 GATACCACTTCACACTCAGTAGG + Intergenic
992147047 5:73860907-73860929 GGCAGGAAATCACACGCAGTGGG - Intronic
992421469 5:76610382-76610404 GATACCACTTCACACCCACTAGG + Intronic
992557079 5:77914460-77914482 GATACCAGTTCACACCCACTAGG + Intergenic
993227573 5:85186656-85186678 GGTGCCACATCATACCCACTAGG + Intergenic
993527608 5:88985649-88985671 GCTAGCAAAACACACCCTGTTGG + Intergenic
994015796 5:94963500-94963522 GGTATCAAATCACACCTGTTAGG - Intronic
994125159 5:96160799-96160821 GACACCACTTCACACCCAGTAGG - Intergenic
995121442 5:108540215-108540237 GATACCATCTCACACCCATTTGG + Intergenic
996826279 5:127684921-127684943 GGTATCAAATGACTCCAAGTGGG + Intergenic
997308562 5:132859678-132859700 GATACCATTTCACACCCACTTGG + Intergenic
999861442 5:155651474-155651496 AATACCACTTCACACCCAGTAGG + Intergenic
999931745 5:156440651-156440673 AGTACCACTTCACACCCACTAGG - Intronic
999975273 5:156906084-156906106 GATACCACTTCACACCCACTAGG - Intergenic
1000015837 5:157274761-157274783 GATACCACTTCACACCCACTAGG - Intronic
1001161334 5:169318323-169318345 GGTACCACCTGACACCCATTAGG + Intergenic
1001550564 5:172599325-172599347 GTCACCACATCACACCCACTGGG + Intergenic
1001917348 5:175572920-175572942 GATACCACTTCACACCCACTAGG + Intergenic
1001974060 5:175982352-175982374 GGTACCACCTTACACCCATTAGG + Intronic
1002117653 5:176976462-176976484 GGTATCACTTCACACCCACTAGG + Intronic
1002243373 5:177861427-177861449 GGTACCACCTTACACCCATTAGG - Intergenic
1002503100 5:179659890-179659912 GGTACCACCTCACACCCATCAGG + Intergenic
1002798056 6:492213-492235 GGTATCACTTCACACCCACTAGG + Intronic
1003598006 6:7492027-7492049 GATACCACTTCACACCCATTGGG - Intergenic
1003724054 6:8739132-8739154 GATACCATATCACACCCACTAGG + Intergenic
1004958214 6:20754308-20754330 GATACTACTTCACACCCAGTAGG - Intronic
1005601875 6:27434366-27434388 GGTACCACTTTACACCCATTAGG - Intergenic
1007979398 6:46135360-46135382 GGTACCATTTCACACCCCGAAGG - Intronic
1011425785 6:87228132-87228154 GATATCACCTCACACCCAGTAGG - Intronic
1011571854 6:88746402-88746424 TGTACCAAATCATCCCCAGAAGG + Intronic
1012404965 6:98885805-98885827 GGTTCCAAATCAGAACCAATAGG - Intronic
1014047286 6:116905235-116905257 GATACCACATCACACCCACTGGG - Intronic
1014325877 6:119992675-119992697 GGTACCATTTCATACCCACTAGG + Intergenic
1015770993 6:136768493-136768515 GGTACCACTTCACATCCACTAGG + Intronic
1016256311 6:142109645-142109667 GTTACCACATCACACTCATTAGG + Intergenic
1016612055 6:146000774-146000796 GATACCACTTCACACCCAGGAGG - Intergenic
1017897834 6:158696552-158696574 GATACCACTTCACACCCATTAGG - Intronic
1017991596 6:159493777-159493799 TCTCCCAAATCACACCCTGTTGG - Intergenic
1020213919 7:6174507-6174529 GATACCATTTCACACCCATTAGG - Intronic
1020667544 7:11067256-11067278 GATACCACCTCACACCCATTGGG + Intronic
1021436332 7:20620690-20620712 GATACCACATCACACCCACTAGG + Intronic
1021677266 7:23093744-23093766 GATACCACTTCACACCCACTAGG - Intergenic
1021707615 7:23383432-23383454 GATACCACTTTACACCCAGTAGG + Intronic
1023001871 7:35816764-35816786 GATACCAGCTCACACCCAGTAGG - Intronic
1023071275 7:36436655-36436677 GGAACCACTTCACACCCACTAGG - Intronic
1023589790 7:41769423-41769445 GCTACCATTTCACACACAGTAGG - Intergenic
1024357834 7:48434204-48434226 GATACCACTTCACACCCATTAGG - Intronic
1027372765 7:77523677-77523699 GGTACCACTTCGTACCCAGTAGG + Intergenic
1027375480 7:77544201-77544223 GATACCACTTCACACCCAGTAGG - Intronic
1027595627 7:80170331-80170353 GGTACTACTTCACACCCACTAGG - Intronic
1027656752 7:80940191-80940213 GGAACAAAATCACCCCCAGTTGG + Intergenic
1028503517 7:91546238-91546260 GATACCACTTCACACCCACTAGG + Intergenic
1028835611 7:95371488-95371510 GATACCATTTCACACCCACTAGG - Intronic
1028955539 7:96685042-96685064 GGTAACACATCCCACCCACTTGG - Intronic
1029338776 7:99925830-99925852 GATACCACTTCACACCCACTAGG + Intronic
1029726828 7:102411847-102411869 GATACCACTTCACACCCATTAGG - Intronic
1030068881 7:105681352-105681374 GGTATCATTTCACACCCACTGGG + Intronic
1030081298 7:105780988-105781010 GGTGCAAAATCGCCCCCAGTTGG - Intronic
1030098003 7:105918402-105918424 GATACCACTTCACACCCACTAGG - Intronic
1030261394 7:107568386-107568408 GATACCACTTCACACCCATTAGG - Intronic
1030622345 7:111803895-111803917 GATACCACCTCACACCCATTAGG + Intronic
1030749418 7:113212498-113212520 GATACCACTTCACACCCATTAGG + Intergenic
1031911826 7:127525218-127525240 GATACCACTTCACATCCAGTAGG + Intergenic
1032446528 7:131988858-131988880 GATACCACATCACACCCATTAGG + Intergenic
1032596794 7:133249259-133249281 GATACCACTTCACACCCACTAGG - Intergenic
1033381449 7:140823853-140823875 GATACCACCTCACACCCATTAGG - Intronic
1033569423 7:142613199-142613221 GATACCACTTCACACCCAGTAGG + Intergenic
1034508324 7:151514467-151514489 GATACCACTTCACACCCAATAGG + Intronic
1035969829 8:4235454-4235476 GTTTCCAAATCACACTCAGCAGG - Intronic
1036155400 8:6337586-6337608 GATACCACTTCACACCCATTAGG + Intergenic
1036692705 8:10954354-10954376 GATACCACGTCACACCCACTTGG - Intronic
1037327501 8:17708396-17708418 GGTATCACTTCATACCCAGTAGG + Intronic
1037629820 8:20644678-20644700 GATACCACCTCACACCCATTAGG - Intergenic
1038582445 8:28760709-28760731 GGTACCACTTCACACCTACTAGG - Intergenic
1038724873 8:30072138-30072160 GATACCACTTCACACTCAGTAGG - Intronic
1039076488 8:33694522-33694544 AGTACCACTTCACACCCATTAGG - Intergenic
1039654281 8:39382544-39382566 GATACCACTTCACACCCATTAGG - Intergenic
1039739487 8:40369055-40369077 GATACCACTTCACACCCACTAGG + Intergenic
1040457512 8:47613677-47613699 GATACCACTTCACACCCATTAGG - Intronic
1040632261 8:49229299-49229321 GGTACTACGTCACACCCACTAGG + Intergenic
1040777632 8:51065667-51065689 GGTACCACTTTACACTCAGTAGG + Intergenic
1040991859 8:53360546-53360568 GACACTACATCACACCCAGTTGG - Intergenic
1041101876 8:54404344-54404366 GATACCAACTCACATCCATTAGG + Intergenic
1041282129 8:56220933-56220955 GATACCAGTTCACACCCACTAGG - Intergenic
1042251968 8:66765250-66765272 GATACCAATTCACACTCACTAGG - Intronic
1042521496 8:69716512-69716534 GGTACCACCTCACACTCAGATGG - Intronic
1043683520 8:83061260-83061282 GATACCAACTCATACCCATTAGG - Intergenic
1044074600 8:87804033-87804055 GGTACCATCTCACACCTATTAGG + Intergenic
1044124270 8:88438150-88438172 GGTACCAGATCAGCCACAGTGGG + Intergenic
1044783262 8:95765873-95765895 GATACCACTTCACACCCACTAGG + Intergenic
1045162308 8:99562135-99562157 TGTACCACCTCACACCCAGTAGG - Intronic
1045451999 8:102336063-102336085 GATACCATCTCACACCCATTAGG - Intronic
1045871517 8:106932693-106932715 GGGACAAAACCACTCCCAGTCGG + Intergenic
1048402361 8:134083726-134083748 GGTAGCAAATCCCATCCAGACGG - Intergenic
1049633815 8:143674816-143674838 GATACCACCTCACACCCATTAGG + Intergenic
1050297835 9:4224094-4224116 GCTTGCAAATCACACACAGTGGG + Intronic
1050450128 9:5771705-5771727 GGCACCATCTCACACCCATTAGG - Intronic
1051716098 9:19986223-19986245 GATACCACTTCACACCCACTAGG + Intergenic
1052508791 9:29387999-29388021 GATACCACTTCACACCCAGTAGG - Intergenic
1052804988 9:33004969-33004991 GATACCATTTCACACCCATTAGG - Intronic
1053110218 9:35453431-35453453 GGTACCAACTCAGCCACAGTGGG + Intergenic
1053171311 9:35887365-35887387 GATACCACTTCACACCCATTAGG - Intergenic
1055377099 9:75660376-75660398 GGTACCACTTCAGACCCACTAGG + Intergenic
1055385571 9:75758472-75758494 GTTACCACCTCACACCCATTAGG - Intergenic
1055820961 9:80263285-80263307 GATACCATCTCACACCCAATAGG + Intergenic
1055886472 9:81069411-81069433 GGTACCAACTCAGCCACAGTGGG - Intergenic
1056432226 9:86539471-86539493 GATACCACTTCACACCCACTAGG + Intergenic
1056479783 9:86989710-86989732 GGTACCCCTTCACACCCACTAGG - Intergenic
1057242611 9:93424874-93424896 GATACCACTTCACACCCATTAGG - Intergenic
1057385067 9:94599570-94599592 GATACCACCTCACACCCATTGGG - Intergenic
1057438988 9:95068356-95068378 GGTACCAAGTCACATCCAACAGG - Intronic
1057636166 9:96769863-96769885 GATACCACTTCACACCCACTAGG + Intronic
1057756372 9:97840714-97840736 GTTACCACCTCACACCCACTTGG + Intergenic
1058677942 9:107417022-107417044 AATACCACATCACACCCACTAGG + Intergenic
1058865537 9:109159007-109159029 GATACCATTTCACACCCACTAGG - Intronic
1059213651 9:112538994-112539016 AGTACCACTTCACACCCACTGGG + Intronic
1059526738 9:114998822-114998844 GATACCACTTCACACCCATTAGG + Intergenic
1060855506 9:126912017-126912039 GATACCACTTCACACCCATTAGG - Intergenic
1185895008 X:3850315-3850337 TGTACCACTTCACACCCACTAGG + Intergenic
1185900126 X:3888740-3888762 TGTACCACTTCACACCCACTAGG + Intergenic
1185905242 X:3927168-3927190 TGTACCACTTCACACCCACTAGG + Intergenic
1186180405 X:6967899-6967921 GGTCCCACCTCACACCCAGAAGG + Intergenic
1186195169 X:7103844-7103866 GATATCAACTCACACCCATTAGG + Intronic
1186691713 X:11984985-11985007 GGTACTATTTCACACCCACTAGG + Intergenic
1186764426 X:12756294-12756316 GATACCACTTCACACCCATTAGG + Intergenic
1186891607 X:13964511-13964533 GATACCACTTCACACCCACTAGG - Intergenic
1186995138 X:15113371-15113393 GATACCACTTCACACCCACTAGG - Intergenic
1187422590 X:19149027-19149049 GATACCACCTCACACCCACTAGG + Intergenic
1187482068 X:19666638-19666660 GATACCACTTCACACCCATTAGG + Intronic
1187546173 X:20254788-20254810 GATACCATTTCACACCCAGTAGG + Intronic
1188290855 X:28386989-28387011 GATACCACCTCACACCCATTAGG + Intergenic
1188712178 X:33414637-33414659 GATACCATTTCACACCCATTAGG + Intergenic
1188910149 X:35837292-35837314 GATACCACTTCACACCCAGCAGG - Intergenic
1189251974 X:39607737-39607759 GATACCACTTCACACCCACTAGG + Intergenic
1190559777 X:51675604-51675626 GCTACCACTTCACACTCAGTAGG - Intergenic
1190564514 X:51717717-51717739 GCTACCACTTCACACTCAGTAGG + Intergenic
1190854796 X:54283440-54283462 GATACCACATCACACCCACTAGG + Intronic
1191129920 X:56996513-56996535 GGTACCACTTCATACCCACTAGG - Intergenic
1192187366 X:68959041-68959063 GATACCAATTCACACCCACTAGG + Intergenic
1192597341 X:72425240-72425262 GATACCACTTCACACCCATTAGG - Intronic
1193024063 X:76825159-76825181 GATACCACATCACACCCATTAGG - Intergenic
1193305796 X:79949776-79949798 GGTACCAACTCAACCACAGTGGG + Intergenic
1193894859 X:87100620-87100642 GGTACCAATTCATCCACAGTGGG + Intergenic
1194748698 X:97659410-97659432 GATATCACCTCACACCCAGTAGG - Intergenic
1194754099 X:97716731-97716753 GATACCACTTCACACCCACTAGG - Intergenic
1195205146 X:102591958-102591980 GATACCACTTCACACCCACTAGG - Intergenic
1195309119 X:103613550-103613572 GATACCACTTCACACACAGTAGG + Intronic
1195737337 X:108026977-108026999 GATACTACTTCACACCCAGTAGG + Intergenic
1196059627 X:111393797-111393819 GATACCACTTCACACCCACTAGG + Intronic
1196324510 X:114387545-114387567 GGTACCACTTCACACCCACTAGG - Intergenic
1197068693 X:122267023-122267045 GGTACCACATCAAACGCATTGGG - Intergenic
1197725349 X:129772796-129772818 GGTCCCAACTCACACACAGCTGG - Intergenic
1198078404 X:133215776-133215798 GATACCACTTCACACCCATTAGG - Intergenic
1198725181 X:139669330-139669352 GATACCACATCACACCCAAGAGG + Intronic
1199677756 X:150201875-150201897 GATACCACCTCACACCCACTAGG + Intergenic
1199719916 X:150535823-150535845 GATACCATTTCACACCCATTTGG + Intergenic
1199964534 X:152808660-152808682 GATACCACCTCACACTCAGTGGG - Intergenic
1200128087 X:153827222-153827244 GATACCACTTCACACCCAGCAGG + Intronic
1200271817 X:154692457-154692479 GATACCAATTCACACCCGTTAGG + Intronic
1202604727 Y:26629136-26629158 GATCCCATTTCACACCCAGTGGG + Intergenic