ID: 950325303

View in Genome Browser
Species Human (GRCh38)
Location 3:12103138-12103160
Sequence TAAGGTCCACAGTTAGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950325301_950325303 28 Left 950325301 3:12103087-12103109 CCTCATTTTATAGATGAAAAAAC 0: 8
1: 202
2: 1395
3: 4756
4: 10750
Right 950325303 3:12103138-12103160 TAAGGTCCACAGTTAGTACCTGG 0: 1
1: 0
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950325303 Original CRISPR TAAGGTCCACAGTTAGTACC TGG Intronic
903822616 1:26113956-26113978 TAAGGTCAACAGCTAGTAACTGG - Intronic
908983761 1:69991422-69991444 TAAGGTCCAAAGATAGTTCAAGG - Intronic
912250570 1:108008238-108008260 TCAGATCCACAGATAGTGCCAGG + Intergenic
920784051 1:209023401-209023423 CAAGGTCCATAATTAGAACCAGG + Intergenic
921727816 1:218543290-218543312 TAGGGTCCACTGGTAGTTCCGGG - Intergenic
921777717 1:219121815-219121837 TAAGATTCACAGTTGGTTCCTGG - Intergenic
1065228272 10:23569817-23569839 TAAGCTCCAAAGTTAGAATCAGG - Intergenic
1078091089 11:8265146-8265168 TAAGGTCCACTGTTGGTAATTGG - Intronic
1078634729 11:13038702-13038724 GAAGCTCCTCAGTGAGTACCTGG + Intergenic
1079397775 11:20080295-20080317 TATGTTCCACAGATAGTAGCTGG - Intronic
1087511346 11:99099215-99099237 TAATGTCCACTGTTAATACAGGG + Intronic
1094078020 12:26499429-26499451 TAAGATCCCCAGTTAGTATATGG - Intronic
1098037915 12:66325042-66325064 TAAAATCCACAGTTACTTCCAGG - Exonic
1103182226 12:118923480-118923502 TAAGATTCACAGCTAGTAACTGG + Intergenic
1105304440 13:19158947-19158969 TAAGGACCACAGCCAGTACTTGG + Intergenic
1109441055 13:62375162-62375184 TAAAATACACAGTTAGTACATGG + Intergenic
1115532062 14:34336703-34336725 CAAGGTCCACAGATAGCATCTGG + Intronic
1115682543 14:35757762-35757784 TAAGCTGAACAATTAGTACCTGG + Intronic
1118679705 14:68227393-68227415 TAAGGTCAACAGTTGGTATGTGG - Intronic
1120453650 14:84703362-84703384 TAAAGTCCACAGTTAGAACTTGG - Intergenic
1121507338 14:94486939-94486961 TATGGGCCACAGCAAGTACCTGG - Intergenic
1123475582 15:20591028-20591050 CAGGGGCCACAGTCAGTACCGGG + Intergenic
1123642429 15:22409335-22409357 CAGGGGCCACAGTCAGTACCGGG - Intergenic
1124839892 15:33231709-33231731 TGAGGTCAACAATTAGTACAAGG + Intergenic
1125839530 15:42785911-42785933 TAAGGGTCACAGTTAGATCCTGG + Intronic
1127378899 15:58411171-58411193 GAAAGTCCACAGCTAGTAGCTGG + Intronic
1132185365 15:99798472-99798494 AATGCTCCACAGTTAGTGCCTGG + Intergenic
1132431626 15:101766056-101766078 AATGCTCCACAGTTAGTGCCTGG - Intergenic
1136389190 16:29951620-29951642 CAAGGTCCACAGATACTACCTGG + Intronic
1139660731 16:68419103-68419125 TAGGGGCCACAGCTAGTATCTGG + Intronic
1143317128 17:6041168-6041190 TAAGGGCCACAGCTAATAACTGG - Intronic
1152443596 17:80326477-80326499 TAAAGTCCATAGTTCGTTCCTGG + Intronic
1157871768 18:51235996-51236018 TAAGGTACACAGCCAGTTCCTGG - Intergenic
925466010 2:4108004-4108026 TAAGGAACCCAGGTAGTACCTGG + Intergenic
927727868 2:25441536-25441558 TAATGTCCACATTCAGCACCAGG - Intronic
931248342 2:60509381-60509403 TCAGGTCCACGGTTAGCCCCTGG - Intronic
932287833 2:70552169-70552191 CAGGGTCCACAGTAAGTAACTGG - Intronic
934037667 2:88102022-88102044 TAATGACTACAGTTAGTATCTGG - Intronic
937224533 2:120360536-120360558 TAAGGCCCACAGCTAGGACAGGG - Intergenic
942812322 2:180013771-180013793 TATGGGGCACAGTTAGTCCCTGG - Intergenic
943286052 2:186001745-186001767 TAATGACCACATTTAGTAACTGG - Intergenic
1170403004 20:16007913-16007935 TAAGTTTCACAGTTGGAACCTGG + Intronic
1170500064 20:16966277-16966299 TAAGGCCCACAGATAGGAGCTGG + Intergenic
1172702096 20:36860001-36860023 TATGGTCCACATTTAGTCTCTGG + Intronic
1177830073 21:26128629-26128651 AAATGTCAACAGTTATTACCTGG + Intronic
1184960515 22:47925190-47925212 TAAGGACCTCAGTTGGTAACAGG - Intergenic
950269365 3:11601320-11601342 GAAGGTCCCAAGTTTGTACCAGG + Intronic
950325303 3:12103138-12103160 TAAGGTCCACAGTTAGTACCTGG + Intronic
953276193 3:41500968-41500990 TAAGGTCTACAGTTACTAATTGG + Intronic
955226389 3:57063761-57063783 CAAGGTCTACAGTGAGTGCCTGG - Intronic
965319685 3:167237508-167237530 TCAGTTCCATAGTTAGAACCAGG + Intergenic
972694147 4:41428245-41428267 CAAGGTCCACAGCTAGTAAGAGG - Intronic
977650149 4:99460156-99460178 CAAGGTACATAGTTAGTACCTGG - Intergenic
977921404 4:102647399-102647421 CAAGGTCCATAGTTAGGAACTGG - Intronic
979671389 4:123363554-123363576 TAAAGATCACAGTAAGTACCTGG - Intergenic
981990122 4:150908641-150908663 AAAAGATCACAGTTAGTACCTGG + Exonic
985258380 4:188091882-188091904 TCAGGTCCTCAGATAGTGCCAGG + Exonic
985546482 5:512335-512357 TAAGGTCCACAGTTTATATTAGG - Intronic
985546491 5:512435-512457 TAAGGTCCACAGTTTATATTAGG - Intronic
985546495 5:512485-512507 TAAGGTCCACAGTTTATATTAGG - Intronic
992573241 5:78082070-78082092 TAAGGTCCTCAGGAAGCACCAGG - Intronic
993439539 5:87938376-87938398 AAAGGAACACAGTTTGTACCTGG - Intergenic
995308853 5:110688575-110688597 TATGGGCCACAGTTAGGCCCAGG - Intronic
997973741 5:138426061-138426083 TAAGCTACACAGTTGGCACCAGG - Intronic
999436619 5:151568253-151568275 TGCGGTCCACAGCTAGCACCTGG + Exonic
1001163213 5:169339767-169339789 CAAGGTCCACAGTTGGTAAGTGG + Intergenic
1003284435 6:4722579-4722601 TAAAGTCCACAGTTCATGCCAGG + Intronic
1004379735 6:15122447-15122469 TAACTTCCACAGTTTGAACCGGG + Intergenic
1005681414 6:28212286-28212308 TAAGAGCCACAATTAGGACCAGG + Intergenic
1006035602 6:31209288-31209310 TATGGTCCAAAGTTTGTTCCAGG - Intergenic
1010111756 6:72244436-72244458 TAAATTCCAAAGTTTGTACCTGG + Intronic
1010716089 6:79232373-79232395 TAACGACCTCAGTTGGTACCTGG - Intronic
1012211604 6:96525293-96525315 TCAGGTCCACATTAATTACCTGG - Exonic
1013835063 6:114324973-114324995 AAATGTCTACAGTTAGTTCCAGG + Intronic
1013893719 6:115058628-115058650 TTAGGTCAACAGTTAGAAACAGG + Intergenic
1015716697 6:136200020-136200042 TCAGGTCCACAGTTGCTATCTGG + Intergenic
1017072890 6:150592061-150592083 TAAGGTCCACACATCTTACCAGG + Intergenic
1020633085 7:10664119-10664141 TTAAGTACTCAGTTAGTACCTGG - Intergenic
1022303788 7:29127491-29127513 TCAGGTTCACAGTTAGTAAGTGG + Intronic
1025004041 7:55341730-55341752 TAAGGTCCACTGTTTTTACTGGG + Intergenic
1030827188 7:114172487-114172509 TAAAGTCCAGAGTTTATACCAGG - Intronic
1030864903 7:114689013-114689035 GAAGGTTCACAGATAGCACCTGG - Intronic
1031001981 7:116426208-116426230 TATGATCAAGAGTTAGTACCTGG + Intronic
1033386868 7:140885663-140885685 TAATGTCTACACATAGTACCTGG + Intronic
1037617723 8:20534473-20534495 AAAGTTCCACAGTTAGTAGAAGG - Intergenic
1039790328 8:40870775-40870797 TAAGGTCCACAGTTATAAAATGG - Intronic
1040409680 8:47141546-47141568 TAACGTCTACAGTTAGTAATAGG - Intergenic
1052251013 9:26397418-26397440 TAAGTACCCCAGTTAGCACCAGG - Intergenic
1055581632 9:77712292-77712314 TAAGGTTCAAGATTAGTACCTGG - Intergenic
1056581692 9:87891197-87891219 CAGGGGCCACAGTCAGTACCGGG - Intergenic
1185704120 X:2253655-2253677 TAAGGTCCAGATTTAGTAGCAGG - Intronic
1187420069 X:19126283-19126305 TAAGGTCCACAGCTAGTAAGTGG + Intergenic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1195942852 X:110179693-110179715 TGATGGCCAGAGTTAGTACCAGG - Intronic
1195962385 X:110399317-110399339 TAAGGTCCACAGTGAGCAAGTGG + Intronic
1197917289 X:131550024-131550046 CAAGGTCAACAGTTAGTAACAGG + Intergenic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic