ID: 950328862

View in Genome Browser
Species Human (GRCh38)
Location 3:12139759-12139781
Sequence CTTACCTAACAGGTAGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950328859_950328862 28 Left 950328859 3:12139708-12139730 CCAATGAAATATTACAGTTGGAA 0: 1
1: 0
2: 2
3: 21
4: 219
Right 950328862 3:12139759-12139781 CTTACCTAACAGGTAGAGTATGG 0: 1
1: 0
2: 0
3: 8
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950328862 Original CRISPR CTTACCTAACAGGTAGAGTA TGG Intronic
901785012 1:11618800-11618822 CTTCCCTAACACGTGGAGAAAGG + Intergenic
906284236 1:44576261-44576283 CTTAGCTACCAGGGAGAATAGGG + Intronic
906632998 1:47388045-47388067 CTTTCATAACAGGTAAAGGAAGG + Intergenic
908046368 1:60173834-60173856 CTTACCAAACACCAAGAGTAGGG - Intergenic
912562290 1:110559582-110559604 CTTACCTAACAGGCAGAAGAAGG - Intergenic
918803794 1:189011674-189011696 TTTACCAAGCAGTTAGAGTAGGG - Intergenic
920933591 1:210410944-210410966 CTTCCCTACCAGGTATAATAAGG - Intronic
1063754688 10:8994454-8994476 TTTCCCTATCAGGTAGAGTTAGG + Intergenic
1063758404 10:9042553-9042575 CTTAGCTAACAGGCAGAGCAGGG - Intergenic
1068895756 10:62198835-62198857 CTTACCTAGCAGTCAGAATAAGG - Intronic
1078157287 11:8809855-8809877 CTTTCCTAAGAGGTGGAGGAGGG - Intronic
1087784914 11:102343600-102343622 TATAACCAACAGGTAGAGTAAGG - Intergenic
1095649876 12:44594828-44594850 CATACCTTACAGTTAGTGTAAGG + Intronic
1098737237 12:74120779-74120801 GTTCCCTAACAGGTAGGGTTAGG - Intergenic
1102536960 12:113588820-113588842 CCTACAGAACAGGTAGAGTTTGG + Intergenic
1111878431 13:93924721-93924743 ATTACCCAAAAGGTAGAGTAAGG + Intronic
1113011736 13:105775271-105775293 CTTACAAAACAAGTAGAGCACGG - Intergenic
1135644825 16:24152637-24152659 CTTTCCTAAGATGTAGAGTCAGG - Intronic
1138159076 16:54736466-54736488 CTTTCCAAACAGGTAGACTATGG - Intergenic
1143930555 17:10419012-10419034 CTTCCCTGACAGTTAGAGTCTGG + Exonic
1153388555 18:4528351-4528373 CTTACCTCACAGATTGAGTTTGG + Intergenic
1154040261 18:10847702-10847724 CTTATCTGAAAGGTAGAGTTAGG - Intronic
1158416260 18:57251983-57252005 CTGCCCTAACAGCTAAAGTAGGG - Intergenic
1158913256 18:62090574-62090596 CATACCTAACAGGTGGGGAAAGG + Exonic
1165177325 19:33939677-33939699 CTTACCTCACAGGTAATGTGAGG - Intergenic
926664330 2:15503649-15503671 GTTACTTAGCAGGAAGAGTATGG - Intronic
926798435 2:16638104-16638126 TTTACCTAACAGGTAGGCTTCGG - Intronic
926917893 2:17910451-17910473 TTCACCTAAGAGTTAGAGTAGGG - Intronic
928886657 2:36156865-36156887 CTTATCTGACAGGCAGAATAGGG - Intergenic
930344423 2:50161254-50161276 CTTATAAAACAGGTAGAGCAGGG + Intronic
933423521 2:82082315-82082337 CTGACCTAACAGGTTTAATAAGG + Intergenic
936495654 2:113018541-113018563 CTGACGTAAGAGGTAGAGGAAGG + Intergenic
938869257 2:135456401-135456423 CTTTCCTTACAGGTAATGTAAGG - Intronic
939803283 2:146739840-146739862 CTTCCCTAACAGGTACAGTGTGG + Intergenic
945700947 2:213170286-213170308 CATACCTAACAGTAAGAGAAGGG + Intergenic
1169323432 20:4654848-4654870 CTTAGGTAAGAGGTAGTGTATGG - Intergenic
1181986927 22:26806445-26806467 CTTTTCTAACAGGTAAAGCAGGG + Intergenic
949356440 3:3185023-3185045 CTGACTTGACAGGTAAAGTAGGG + Intergenic
950328862 3:12139759-12139781 CTTACCTAACAGGTAGAGTATGG + Intronic
950867064 3:16197543-16197565 TTTTCCTCACAGGTAGAGTAGGG - Intronic
952155406 3:30638424-30638446 TTTAGCTAACAGGGAGACTATGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
958719660 3:97828131-97828153 CTTATCAAATAGGTAGAATATGG - Intronic
963861454 3:150314722-150314744 GTCACCCAACAGGTAGAGCAGGG - Intergenic
964386634 3:156154717-156154739 CTTGCCAAAGTGGTAGAGTAGGG - Intronic
966474977 3:180334165-180334187 CTAACCTAACATGGAGAGTTTGG + Intergenic
966893492 3:184425386-184425408 TTTACATAGCAGGTAGAGCAAGG + Intronic
967361154 3:188633395-188633417 CTTACATAACTGGTATTGTAAGG + Intronic
972005257 4:34094427-34094449 ATTACCTAACAGGTAGACAGTGG - Intergenic
974038245 4:56835964-56835986 CTTGCCTAGCAGATAGAGAAAGG + Intergenic
980550822 4:134332212-134332234 CTTCCCTAATAGGTAAAATATGG - Intergenic
981758258 4:148165042-148165064 CTTACCAAACAGATAGATGAGGG + Intronic
984549093 4:181139483-181139505 ATGACCTGACAGGTAGAGTAGGG - Intergenic
984644367 4:182203664-182203686 CTAACCTGAGAGGGAGAGTAGGG + Intronic
985211737 4:187603101-187603123 CTTAACTAACAAGAAGAATAAGG - Intergenic
991352922 5:65737744-65737766 CTTACCTAACATGTAGACATAGG - Intronic
995178176 5:109203148-109203170 CTTACCATAAAGCTAGAGTATGG + Intergenic
996545622 5:124675695-124675717 CTTAAATAACAGATAGATTAAGG - Intronic
1008229426 6:48966146-48966168 TTTACGTAACAGGTGGAGAAGGG + Intergenic
1010535275 6:77020185-77020207 CTTTCCAATCAGGTACAGTATGG - Intergenic
1011228166 6:85130546-85130568 CTTATCAAACAGGTAGATTAGGG - Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1028792052 7:94864651-94864673 ATTACCCAACAGGAAGAGCAAGG - Intergenic
1029023210 7:97387124-97387146 CATACCTATGAGGCAGAGTATGG + Intergenic
1029815460 7:103090069-103090091 GTTACCCTACAGGTAGAGTTGGG + Intronic
1030205412 7:106947921-106947943 CTGACCTCAGATGTAGAGTATGG + Intergenic
1040903390 8:52439937-52439959 CTGACCTGACAGTTATAGTAGGG - Intronic
1041121711 8:54592668-54592690 CTTATATAACAGGAAGAGTGAGG + Intergenic
1042013016 8:64270819-64270841 TTAACCTAACATGTAAAGTATGG + Intergenic
1043035601 8:75194176-75194198 ACTACATAACAGGTAGAGCAGGG + Intergenic
1050521429 9:6504708-6504730 CATACCTAACAGGGAAAGTGAGG - Intronic
1055243599 9:74215609-74215631 CTTAACAAAGAGGTAGAGAAGGG - Intergenic
1055940759 9:81647299-81647321 CTTACCTAACACAAAGAATAAGG - Intronic
1060077014 9:120600531-120600553 CTTAATAAACAGGTAGAATATGG + Intergenic
1189717079 X:43878003-43878025 ATTTCCAAAAAGGTAGAGTAAGG + Intronic