ID: 950330387

View in Genome Browser
Species Human (GRCh38)
Location 3:12151823-12151845
Sequence GCCAGGGGAATGGGAGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 1, 3: 83, 4: 428}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950330387_950330395 3 Left 950330387 3:12151823-12151845 CCTGACTCTCCCATTCCCCTGGC 0: 1
1: 0
2: 1
3: 83
4: 428
Right 950330395 3:12151849-12151871 TCCACAACTGTGATAAGGCTGGG 0: 1
1: 0
2: 2
3: 4
4: 132
950330387_950330397 26 Left 950330387 3:12151823-12151845 CCTGACTCTCCCATTCCCCTGGC 0: 1
1: 0
2: 1
3: 83
4: 428
Right 950330397 3:12151872-12151894 TTAACACTGTGCCTTCTCTGAGG 0: 1
1: 0
2: 4
3: 22
4: 218
950330387_950330393 -2 Left 950330387 3:12151823-12151845 CCTGACTCTCCCATTCCCCTGGC 0: 1
1: 0
2: 1
3: 83
4: 428
Right 950330393 3:12151844-12151866 GCGCTTCCACAACTGTGATAAGG 0: 1
1: 0
2: 0
3: 1
4: 67
950330387_950330394 2 Left 950330387 3:12151823-12151845 CCTGACTCTCCCATTCCCCTGGC 0: 1
1: 0
2: 1
3: 83
4: 428
Right 950330394 3:12151848-12151870 TTCCACAACTGTGATAAGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950330387 Original CRISPR GCCAGGGGAATGGGAGAGTC AGG (reversed) Intronic
900139893 1:1135191-1135213 GGGAGGGGCCTGGGAGAGTCTGG + Intergenic
900721604 1:4179658-4179680 GTCAGTGGACTGGGAGAGGCAGG - Intergenic
900785997 1:4650901-4650923 GCCAGGAAGATAGGAGAGTCAGG + Intergenic
900807961 1:4780297-4780319 GCCAGGGGATGGGGGGAGACGGG - Intronic
901135423 1:6989921-6989943 GCAAGGAGAATGGGGGAGTGGGG + Intronic
901514548 1:9736240-9736262 GCCTGGAGAAAGGGAGAGTTGGG + Intronic
901652318 1:10750082-10750104 GCCCGGGGGCAGGGAGAGTCAGG + Intronic
901737603 1:11322303-11322325 GGCATGGGAATGGGAGGGCCAGG - Intergenic
901971335 1:12911500-12911522 GCCAGGGGCAAGGGTGACTCAGG - Intronic
902013832 1:13290240-13290262 GCCAGGGGCAAGGGTGACTCAGG + Intergenic
902225980 1:14996717-14996739 TCCTGGGGACTGGGAGAGGCCGG - Intronic
902316830 1:15626908-15626930 GGCAGGGAAAAGGCAGAGTCAGG - Intronic
902404226 1:16174268-16174290 GCCCAGGGGATGGGAGAGTGCGG - Intergenic
902437548 1:16408235-16408257 GCCAGGGTGATGGGGGAGTGGGG + Intronic
903051579 1:20605035-20605057 GCCAGGTGAGTGGGAAAGCCAGG + Exonic
903360183 1:22772149-22772171 GCCAGGGCTTTGGGAGAGTTTGG - Intronic
904027567 1:27514100-27514122 GGCCGGGGAGTGGGAGAGGCGGG + Intergenic
904038421 1:27570977-27570999 GCTGGGGGGATGGGAGAGTGGGG - Intronic
904285525 1:29451142-29451164 GCCGGAGGAATGGGAGTGTGTGG + Intergenic
905654367 1:39676625-39676647 GACAGGGGAATGGGTGACCCAGG + Intergenic
906663115 1:47596550-47596572 GCCTGGGGTATGGGATGGTCAGG + Intergenic
906803451 1:48757462-48757484 GCCAAGGCAATGGTAGAGTTGGG + Intronic
907467250 1:54646791-54646813 GCCAGGGGAAGGGGAAAGCAGGG - Intronic
909736782 1:78971367-78971389 GAGAGGGGAATGAGAGAGCCAGG + Intronic
910598539 1:89005615-89005637 GTCAGGGGAGTGGGAGAAGCTGG + Intergenic
911307376 1:96247418-96247440 GTCAGTGGACTGGGAGAGGCAGG + Intergenic
912149105 1:106834498-106834520 GCCAGGGGTTTTGAAGAGTCAGG + Intergenic
912541085 1:110416122-110416144 CCAAGGGGAATGTGGGAGTCCGG - Intergenic
912969692 1:114269124-114269146 GGCAGGGGAAGAGGAGAGTTTGG + Intergenic
913958559 1:143322984-143323006 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
914052876 1:144148364-144148386 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
914126321 1:144818177-144818199 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
914257820 1:145975013-145975035 GCCAGGGGCACATGAGAGTCTGG - Intronic
914876044 1:151513245-151513267 GCAAGGGGAAGGGGAGGGCCGGG - Intronic
915279090 1:154810213-154810235 GCCAGTGGCCTGGGTGAGTCAGG - Intronic
915444717 1:155968050-155968072 GCCAGGGGAACAGGGGAGGCGGG - Intronic
915526049 1:156476961-156476983 GGCTGGGGAATGGAAGAGTAGGG - Intronic
916725835 1:167522734-167522756 GCCAGGGGATGGGGAGAGTGGGG + Intergenic
917496353 1:175543769-175543791 GCAAGGGGAATGGGCAAGTTTGG + Intronic
918461548 1:184782051-184782073 GCCAGGGGAATTAGTGAGTTTGG - Intergenic
919021699 1:192114410-192114432 GACAGTGGGATGGAAGAGTCTGG - Intergenic
919726607 1:200888565-200888587 GTCGGGGGAAAGGGAGAGTGGGG + Intergenic
921151297 1:212405112-212405134 GCCAAAGAAATGGTAGAGTCAGG - Intronic
922721255 1:227901346-227901368 GCCAAGGGCTTGGGAGAGGCTGG - Intergenic
922793805 1:228327554-228327576 GCTGGGGGAATGGGAGAATGGGG - Intronic
923664999 1:235991870-235991892 GCCACAGGGATGGGAGAGCCTGG + Intronic
1064863985 10:19858648-19858670 GCAAGGTGCAGGGGAGAGTCTGG + Intronic
1065602966 10:27388566-27388588 GCCAGGGGTTTGGGAGAGGGAGG - Intergenic
1066122547 10:32303629-32303651 GTCAGGGGATGGGGAGAGGCAGG + Intronic
1066759105 10:38737592-38737614 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1066962523 10:42235178-42235200 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
1067228549 10:44390957-44390979 GCAAGGGGAATAGGAGAGAGGGG - Intergenic
1068833763 10:61528545-61528567 GCCAGGGGCATTGGAGAGGGTGG + Intergenic
1070714604 10:78710175-78710197 GCCAGGGATATGGGGGAGGCTGG + Intergenic
1070768934 10:79071082-79071104 GCCCAGGGCATGGGAGAGTAGGG + Intronic
1071211303 10:83344604-83344626 GCCAGGGAAATGGGTTAATCAGG - Intergenic
1071511613 10:86265914-86265936 GCCAGGGCAGTGGATGAGTCAGG - Intronic
1073692472 10:105825522-105825544 GACTTGGGAATAGGAGAGTCTGG - Intergenic
1074679762 10:115893253-115893275 GCCAGGTGAAGTGGAGAGGCGGG + Intronic
1074783329 10:116818075-116818097 GCCAGGGAAAGGTGAGAGGCAGG - Intergenic
1074983222 10:118636015-118636037 TCCAGGGGGAGGGGAGAGCCAGG - Intergenic
1075336961 10:121615668-121615690 GCAGGGGGAATGGAAGAGACAGG + Intergenic
1075612589 10:123865616-123865638 GCCAGGGGACCAGGTGAGTCAGG - Intronic
1076475203 10:130746770-130746792 GCATGGGGAAGGGGAGGGTCTGG - Intergenic
1077298034 11:1835118-1835140 GCCGGGGCACTGGGAGAGACTGG - Exonic
1077376903 11:2209438-2209460 GCCAAGGGTAAGGCAGAGTCAGG + Intergenic
1080658921 11:34280266-34280288 GCAAAGGGAGTGGGTGAGTCTGG + Intronic
1080850605 11:36065992-36066014 GCCAAGGGGATGGGAGAGGGTGG + Intronic
1081809231 11:45905948-45905970 GCCTGGGGATTGGGAGGGACAGG + Exonic
1083426618 11:62591240-62591262 CCGAGGGGATTTGGAGAGTCGGG - Intronic
1083614559 11:64019781-64019803 GCGAGGGGAATGGGGGCGTGTGG + Intronic
1083954792 11:65977361-65977383 GCCAGGGAAATGGCAGAGCTGGG - Intronic
1084032509 11:66489218-66489240 GCCAGGGGACAAGGAGAGGCTGG - Intronic
1084375317 11:68773022-68773044 GACACGGGAGAGGGAGAGTCTGG - Intronic
1084658550 11:70533783-70533805 GGCTGGGGAAGGGGAGAGTGAGG - Intronic
1085126863 11:74007867-74007889 GCTAGGGGTCTAGGAGAGTCTGG - Intronic
1085282949 11:75342633-75342655 GGCAGTGGCATGGGAGAGTAGGG - Intronic
1085490473 11:76911851-76911873 GCAAGGGGAATGAGGGAGTGGGG + Intronic
1086864166 11:91959787-91959809 GCCAGGGAAGTGGAAGAGACAGG - Intergenic
1088837518 11:113590433-113590455 GCAAGGGGAACTGGAGAGTTTGG + Intergenic
1089242835 11:117097443-117097465 GCCCAGGGAATGGGGGAGTGAGG - Intronic
1089296526 11:117472236-117472258 GCCAGTGGCAGAGGAGAGTCAGG - Intronic
1089476881 11:118771063-118771085 GACAGGGTAATGGGAGCCTCTGG - Intronic
1089619326 11:119713506-119713528 GGCAGGGGAAGGGGGGAGACGGG - Intronic
1090434939 11:126678746-126678768 GCCACGGCAATGGGTGAGACTGG - Intronic
1090470829 11:126979503-126979525 GTCTGGGGAAGGTGAGAGTCTGG + Intronic
1090799011 11:130159456-130159478 GCAAGGTGAAGGGGAGAGACCGG + Intergenic
1090836201 11:130455871-130455893 GCCTGGGGAGAGGGAGAGGCAGG - Intronic
1091022621 11:132114550-132114572 GCCAGGGGTATGGGAAAGGAAGG - Intronic
1091694398 12:2618158-2618180 GCCAGGGGAATGTCAGAATCTGG - Intronic
1091726257 12:2848601-2848623 TGCTGGAGAATGGGAGAGTCAGG - Intronic
1094480542 12:30877765-30877787 GGCAGGGGAGTGGGAGAGAGGGG + Intergenic
1097158752 12:57030745-57030767 GCTAGGGGAATGGGAGAATAGGG + Intronic
1097159890 12:57038720-57038742 ACCCGGGGAAGGTGAGAGTCTGG - Intronic
1097371131 12:58782820-58782842 GTCAGTGGACTGGGAGAGACAGG + Intronic
1098302404 12:69067750-69067772 TCCAGGGGCATGGGTGTGTCAGG - Intergenic
1098691597 12:73496091-73496113 GCTGGGGGAATGGGAGAGATGGG + Intergenic
1099203312 12:79700403-79700425 GTCAGTGGACTGGGAGAGGCAGG - Intergenic
1100454607 12:94740288-94740310 CTCAGGTGAATGGGAGTGTCAGG + Intergenic
1101014651 12:100487497-100487519 GGGTGGGGAATGGGGGAGTCAGG + Intronic
1101965012 12:109276597-109276619 GCCATGGGCAAGGGGGAGTCAGG - Intergenic
1102459623 12:113092480-113092502 GCCAGAGGAAGAGGAGAGTCAGG + Intronic
1103247524 12:119470790-119470812 CACAGGGTAATGGGAGAGGCAGG - Intronic
1103340098 12:120216547-120216569 CTCAGGGGAATGGGAGAGCCAGG + Intronic
1103360458 12:120350569-120350591 GCCAGGTTGAGGGGAGAGTCTGG + Intronic
1103468405 12:121160504-121160526 GACAGGGGAAGGGGAGAATGGGG - Intronic
1103567784 12:121825493-121825515 GCAAGTGGAAGGGGAGAGGCGGG + Intronic
1103740292 12:123086530-123086552 GACAGGGGAAGGGGCCAGTCGGG + Intronic
1103901857 12:124307526-124307548 TCCAGGGGAATGGGAGAGAGGGG - Intronic
1105829315 13:24149998-24150020 GTGTGGGGCATGGGAGAGTCGGG + Intronic
1105844243 13:24281098-24281120 GCCAGGGGCATGGCAGGGCCTGG - Intronic
1106073928 13:26441191-26441213 GGCATGGGACTGGGAGAGTGAGG + Intergenic
1106837782 13:33654457-33654479 GCCTGGGGAAGGGGAGAATGGGG + Intergenic
1108735400 13:53278598-53278620 GTCAGTGGACTGGGAGAGGCAGG - Intergenic
1113950667 13:114069599-114069621 ACTGGGGGAATGGGAGATTCGGG + Intronic
1114319122 14:21532305-21532327 GCTAAGGGAATGGGAGAATGGGG + Intronic
1117490132 14:56238756-56238778 GCCAGGTGAGTGGCAGATTCCGG + Intronic
1119141450 14:72271085-72271107 GCCAGAGGAAGGAGAGAGTGAGG + Intronic
1119208488 14:72812248-72812270 GCCTGTGGGATGGGAGAGGCTGG - Intronic
1120097497 14:80404717-80404739 TCCAGGGGAAAGGGAGGGCCAGG - Intergenic
1120164938 14:81187522-81187544 GCCAGGGGACAGGGAGAATGGGG - Intronic
1120840763 14:89083073-89083095 TCCAGGTGAAGGGCAGAGTCAGG - Intergenic
1122019816 14:98828368-98828390 GCCAGGCAGATGGGAGAGTAAGG + Intergenic
1122576791 14:102747929-102747951 GCCATGTGAATGGGTGAGGCAGG - Intergenic
1122837389 14:104436866-104436888 GCCAGGGCCAGGGGAGAGGCAGG + Intergenic
1122858401 14:104571143-104571165 GCCGGGGAACTGGGAGAGTGGGG + Intronic
1122881978 14:104694274-104694296 GCCAGGGGCCTGGGACAGCCAGG - Intronic
1122985080 14:105208244-105208266 GCCAGGGGAAAGGGAGGCCCGGG - Intergenic
1202929848 14_KI270725v1_random:27196-27218 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1123422455 15:20144037-20144059 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
1123442550 15:20302305-20302327 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1123449633 15:20351697-20351719 GCCAGGGGAAAGAGAGAGCATGG + Intergenic
1123531683 15:21150577-21150599 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
1124637320 15:31373524-31373546 TCCAGGGGAAACGGAGAGGCTGG - Exonic
1124787994 15:32699705-32699727 GCCAGGGGGACAGGAGAGCCAGG + Intergenic
1126476201 15:49067934-49067956 GCCAGGGGCTTGGGAGAGACAGG - Intergenic
1127950204 15:63797895-63797917 GCAAGGTGAATGGCAGAGTCAGG + Intronic
1128338248 15:66802341-66802363 GCCAGGGGTAGGAGAAAGTCAGG - Intergenic
1129249439 15:74300780-74300802 GCCATGGGGATGGGACAGGCAGG - Intronic
1129288066 15:74541427-74541449 GAGAGGGGAATGCGCGAGTCGGG + Intronic
1129889599 15:79063058-79063080 TGCAGGGAAATGGGAGAATCTGG - Intronic
1130220875 15:82018482-82018504 GCCAGGGGAAGGGGCCAGGCAGG - Intergenic
1131260013 15:90883276-90883298 GGCAGGGGGATGGGAGAGGAGGG - Exonic
1132626929 16:895622-895644 GGCGGGGGAGTGGGAGAGCCAGG + Intronic
1132813406 16:1813231-1813253 GCCAGAGGAAGGAGAGAGTGGGG - Intronic
1133386805 16:5376508-5376530 GACAGGGCAGTGGGAGAGTCGGG + Intergenic
1133665745 16:7966166-7966188 GTCAGTGGACTGGGAGAGGCAGG + Intergenic
1134530113 16:14975943-14975965 GCCACTGGAATGGGGGAGCCAGG - Intronic
1134600117 16:15527229-15527251 GCCAGGGGAAAGGGAAAATGGGG - Intronic
1134777556 16:16866268-16866290 GCCAGGGGGATGGCAGATGCTGG + Intergenic
1135221847 16:20621065-20621087 GGCAGGGGAGTGGGAGGCTCAGG + Intronic
1135561184 16:23478332-23478354 GCAAGGGGAGTGGGAGAGTGTGG - Intronic
1135750547 16:25055289-25055311 CCCTGGAGAATGGGAGAGTCAGG - Intergenic
1135759600 16:25126435-25126457 CCCTGGAGAATGGGAGAGTCAGG - Intronic
1136043438 16:27598299-27598321 AGGAGGGGATTGGGAGAGTCTGG - Intronic
1136064197 16:27747738-27747760 GGCAGGGGCTTGGGAGAGGCTGG + Intronic
1136718661 16:32303231-32303253 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
1136723689 16:32341595-32341617 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
1136773250 16:32858728-32858750 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1136837032 16:33509495-33509517 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
1136842020 16:33547639-33547661 GCCAGGGCCATGACAGAGTCAGG + Intergenic
1136862296 16:33711312-33711334 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1136897365 16:34002791-34002813 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
1137063289 16:35811417-35811439 GGCAGGGAAGTGGGAGAGTGGGG + Intergenic
1137248668 16:46727380-46727402 GCCAGAGCAAAGGGAGAGGCAGG + Intronic
1137594937 16:49717208-49717230 GCCAGGGCAGTGGGGGAGTGGGG - Intronic
1138478424 16:57285230-57285252 GCGCGGGGAAGGGGAGGGTCTGG + Intergenic
1138481368 16:57305493-57305515 CCCAGGGGAATGGGGGAATCTGG + Intergenic
1138874202 16:60928977-60928999 GGCAGGAGTATGGGATAGTCGGG + Intergenic
1139250268 16:65488769-65488791 CCCTGGGAAATGGGAGACTCTGG - Intergenic
1139275505 16:65723971-65723993 ACCAGGGGAAGGTGGGAGTCTGG + Intergenic
1139408794 16:66741704-66741726 GCCAGGGAAATGGGAGGGGCAGG - Intronic
1141015420 16:80444507-80444529 GGCTGGGGAAGGGGAGTGTCAGG - Intergenic
1141689720 16:85589217-85589239 GCCTGGGGCATGGGAGACCCAGG + Intergenic
1142218528 16:88841628-88841650 GCCTGGGGAGTGGGAGCTTCTGG + Intronic
1142398353 16:89845788-89845810 GGCAGGTGAATGGGAGAGGAAGG - Intronic
1203002742 16_KI270728v1_random:176170-176192 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1203007770 16_KI270728v1_random:214540-214562 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1203075672 16_KI270728v1_random:1120838-1120860 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1203123789 16_KI270728v1_random:1559495-1559517 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1203134348 16_KI270728v1_random:1712576-1712598 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1203147210 16_KI270728v1_random:1809774-1809796 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
1203152185 16_KI270728v1_random:1847936-1847958 GCCAGGGCCATGACAGAGTCAGG + Intergenic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1143136711 17:4716356-4716378 GCCAGGGGACTGGGGAAGTGGGG + Intronic
1143591449 17:7887785-7887807 GCCGGGGATGTGGGAGAGTCTGG + Intronic
1143767787 17:9149041-9149063 TCCAGGGCAGTGGGAGAGGCTGG - Intronic
1143837506 17:9703749-9703771 GCCAGTTAAATGGCAGAGTCTGG + Intronic
1144228582 17:13175949-13175971 ACCAGGGGCTTGGGAGAGTAGGG + Intergenic
1144600386 17:16607647-16607669 GCCTGGGGAATTGGAGCATCAGG + Intergenic
1144799939 17:17919337-17919359 GACACGGGAATGGGAGAGGAGGG - Intronic
1145285839 17:21505580-21505602 GCCAGGGGGCTGGGAGCGCCTGG - Intergenic
1145391762 17:22460720-22460742 GCCAGGGGGCTGGGAGGGCCTGG + Intergenic
1146655203 17:34630899-34630921 GCCAGGGGAAGGAGGGAATCTGG - Intronic
1147766701 17:42841592-42841614 GCCAGGGGACTCTGTGAGTCTGG + Exonic
1147867600 17:43563462-43563484 GCAAGGGGGAGGGGAGAGTGGGG + Intronic
1147897966 17:43763932-43763954 GCCAGGGGTTGGGGAAAGTCGGG - Intergenic
1148081280 17:44968630-44968652 TCCAAGGGAAGGGGAGAGTAGGG + Intergenic
1148180315 17:45600620-45600642 GCCTGGGGATTGGGAGGGACAGG - Intergenic
1148268585 17:46245274-46245296 GCCTGGGGATTGGGAGGGACAGG + Intergenic
1148294218 17:46486158-46486180 GCCAGGGGATAGGGAGAGGAAGG - Intergenic
1148316401 17:46703872-46703894 GCCAGGGGATAGGGAGAGGAAGG - Intronic
1148715296 17:49711382-49711404 GCCGGGGGAAGGGGAGATCCCGG + Exonic
1151386633 17:73759116-73759138 GGCAGAGGCATGGCAGAGTCTGG - Intergenic
1152210446 17:79000451-79000473 GCGGGGGGTATGGGAGTGTCAGG - Intronic
1152417168 17:80170160-80170182 CCCAGGGGAGTGGGAGGGGCCGG + Intronic
1152624044 17:81380137-81380159 GCGGGGGGGATGGGAGAGTGGGG - Intergenic
1152678463 17:81653541-81653563 GCAAGGGGAATGGGAGCGTGCGG - Intronic
1153857116 18:9160545-9160567 GCCAGGGGACTGGGAAAATATGG - Intronic
1154175901 18:12087157-12087179 GCCAGAGCCATGGCAGAGTCAGG - Intergenic
1154176364 18:12088860-12088882 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1154414882 18:14171343-14171365 GCCAGGGCAAGGGGAGGGCCAGG + Intergenic
1155046590 18:22108732-22108754 CACAGGGGAATGGTAGAGGCAGG - Intergenic
1155142042 18:23052539-23052561 GCCAGGGGGATGTGAGAGGGAGG + Intergenic
1156602929 18:38631316-38631338 GCCAGGGTAAAGGGAGAGAAAGG + Intergenic
1157033846 18:43946809-43946831 GCCAGAGGAATGGGAGACAGGGG + Intergenic
1157269831 18:46264499-46264521 ACCAGGGGATTTGGAGAGACAGG - Exonic
1158350941 18:56563837-56563859 GTCAGGGGTGTGGGACAGTCTGG - Intergenic
1158757789 18:60347574-60347596 GATAGGGGAATGGGAGGATCTGG + Intergenic
1158789071 18:60753197-60753219 ACCAGGGGATAGGGAGTGTCGGG + Intergenic
1159102423 18:63970950-63970972 GCCAGAGGACTGAGAGTGTCTGG - Intronic
1160948520 19:1654614-1654636 GACAGTGGAAGGGGGGAGTCTGG + Intergenic
1161004880 19:1930120-1930142 GGCAGGGGGCTGGGAGAGTGAGG + Intergenic
1161203357 19:3028279-3028301 GCCAGGGTGAGGGGAGAGGCGGG - Intronic
1162110581 19:8397693-8397715 GCCAGGGGAAGGGCAGAGGAGGG + Intronic
1163185985 19:15640181-15640203 GGCAGGGGAAGGGCAGAGCCAGG - Intronic
1163207744 19:15815830-15815852 GCGGGGGGAATGGGAAAGTGAGG - Intergenic
1163448317 19:17360685-17360707 CCCAGGGGAGTGGGAAAGTGGGG + Intronic
1164704689 19:30311642-30311664 GGCTGGGGAATGAGAGAGTGGGG - Intronic
1165535534 19:36441318-36441340 GGCAGGGGAAGGGGATAGTAGGG - Intergenic
1165779923 19:38426247-38426269 GCCAGGGGGAAGGAAGAGGCTGG + Exonic
1166090085 19:40503125-40503147 TCCAGGGTAATGGGAGAGTGAGG + Intronic
1166120718 19:40684751-40684773 GCCAGGGGAGTGCGAAAGTTGGG + Intronic
1166148225 19:40851548-40851570 GCCAGTGGAAAGGGAGTGTTTGG + Intronic
1166152367 19:40883333-40883355 GCCAGTGGAAAGGGAGTGTTTGG + Intronic
1166177814 19:41087312-41087334 GCCAGTGGAAAGGGAGTGTTTGG - Intergenic
1166290453 19:41860246-41860268 GCCAGGGGAAAGGGAACGACGGG - Exonic
1166701659 19:44885829-44885851 GGCAGGGGAAAGGGAGACCCAGG + Intronic
1166823836 19:45597431-45597453 TCCTGGGGCAGGGGAGAGTCGGG - Intronic
1166985078 19:46654853-46654875 TCTAGGGGGATGGGAGAGGCTGG - Intronic
1167290951 19:48624903-48624925 GCCTGGGGAATGTGAGGGGCAGG + Intronic
1167356864 19:49009910-49009932 GCCAGGGGGATGGGCGAGCTTGG + Intronic
1167600833 19:50453941-50453963 AGCAGGGGAATGGCAGAGGCAGG + Intronic
1168242040 19:55093236-55093258 GGCAGGGAAAGGGGACAGTCAGG + Intronic
1168310634 19:55458427-55458449 ACCAGGGAAATGGGAGACCCTGG + Intronic
1168336633 19:55600677-55600699 GCGAGGGGACGGGGAGGGTCGGG + Intronic
1202692272 1_KI270712v1_random:100788-100810 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
925149718 2:1606715-1606737 GCCTGGGGAGGGGCAGAGTCCGG + Intergenic
925178335 2:1800346-1800368 GCCAGGCCAATGCGAGACTCTGG + Intronic
925538189 2:4938474-4938496 GGCAGGGGATGGGGAGAGTGGGG + Intergenic
926084842 2:10013805-10013827 GGCATGCGTATGGGAGAGTCAGG + Intergenic
926084884 2:10014095-10014117 GGCATGCGTATGGGAGAGTCAGG + Intergenic
927244660 2:20947767-20947789 GCCAGGGGAATGGGGGTGAGAGG - Intergenic
927368353 2:22325809-22325831 ACCTGGGGACTGGTAGAGTCAGG - Intergenic
927847658 2:26479740-26479762 GAAAGGGGAGAGGGAGAGTCAGG + Intronic
928354102 2:30593059-30593081 GGCAAGGGAAGGGGAAAGTCGGG - Intronic
928914841 2:36459687-36459709 ACCAGGGGCAAGGGAGAGGCAGG + Intronic
929709963 2:44256746-44256768 GCCAGGGGAAGAGGGGAGTGGGG + Intergenic
929788944 2:45010063-45010085 GCCAGTGGGATGGGAGAGTTTGG + Intergenic
931664229 2:64598843-64598865 GCCAGGGGCATGGTGGGGTCGGG - Intergenic
932056598 2:68449337-68449359 CCGAGGGGAATGGGAAAGTGTGG - Intergenic
932622990 2:73277107-73277129 AGCAGGGGAAGGGGAAAGTCTGG + Intronic
932704237 2:74010710-74010732 CCCAGGGACATGGGAGAGGCAGG - Intronic
933954126 2:87353184-87353206 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
934158859 2:89229418-89229440 GCCAGGGGAGAAGGAGAGGCTGG - Intergenic
934208415 2:89953010-89953032 GCCAGGGGAGAAGGAGAGGCTGG + Intergenic
934238321 2:90249404-90249426 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
934274868 2:91567306-91567328 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
934322438 2:91981941-91981963 GCTAGGGCCATGGCAGAGTCAGG - Intergenic
934460746 2:94212764-94212786 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
934777023 2:96945993-96946015 GCTAGGGGAAGGAGAGAGTGGGG - Intronic
935025195 2:99269925-99269947 GCCAGGGGAAGGGGCAAGTTTGG + Intronic
936471147 2:112799591-112799613 GCCAGGGGCATGTCAGAGTTTGG + Intergenic
937225619 2:120367183-120367205 ACCAGGGGAATGGGATGGGCAGG + Intergenic
937932297 2:127216539-127216561 GCAGGGGGAATAGGAGAGTTGGG + Intronic
939680424 2:145124260-145124282 GTCAGTGGATTGGGAGAGGCAGG + Intergenic
941819997 2:169835008-169835030 GCCAAGGGAAGGGGAGATTGGGG + Intronic
942013893 2:171791739-171791761 GCAAGGGAAATGGGGGAGGCGGG + Intronic
942132645 2:172895918-172895940 GCCAGGGCAATGGGAATGTAAGG - Intronic
943922669 2:193729468-193729490 GTCAGTGGACTGGGAGAGGCAGG + Intergenic
944859684 2:203803403-203803425 GGCAGGGGAAGGGGAGATTAGGG + Intergenic
945934312 2:215887404-215887426 GACAAGGGTTTGGGAGAGTCAGG + Intergenic
946145141 2:217725017-217725039 GCAAAGGGAAGGGGAAAGTCTGG + Intronic
946464621 2:219900814-219900836 CCGAGGAGAATGGGAGAGACAGG + Intergenic
947834130 2:233163226-233163248 GCCAGAGAAACGGGAGAGTGTGG - Intronic
947878273 2:233482246-233482268 GGCTGGGGAATGGGAGACTGAGG + Intronic
948825998 2:240573695-240573717 CCCAGGGCAGTGGGAGAGCCTGG + Intronic
948944284 2:241211568-241211590 GCCAGGGGAAGGTGGGTGTCAGG + Intronic
1169115066 20:3059277-3059299 GCCAGTGGAGTGGGAGAGAATGG - Intergenic
1170503860 20:17003740-17003762 GTCAGTGGACTGGGAGAGCCAGG - Intergenic
1170636127 20:18106148-18106170 GGCAGGGGAATATGAGAGTCTGG + Intergenic
1170673405 20:18455883-18455905 GGCAGGGGATTGGGGTAGTCAGG - Intronic
1170678549 20:18504589-18504611 GCCAGGGGAAAGGGAGCAACGGG - Intergenic
1172838381 20:37887390-37887412 CCCAGGAGAATGAGAGAGTTGGG - Intergenic
1172897436 20:38310315-38310337 AGCAGCCGAATGGGAGAGTCAGG - Intronic
1173124945 20:40328062-40328084 CGAAGGGGAATGGGAGAGTGGGG - Intergenic
1173145264 20:40519409-40519431 GCCAGAGGACAGGGAGAGGCAGG + Intergenic
1173849504 20:46209109-46209131 GACAGGGGATAGGAAGAGTCAGG + Intronic
1175107490 20:56625659-56625681 GGCAGGGCAGGGGGAGAGTCAGG + Intergenic
1175110521 20:56644841-56644863 GACAGGGGAAGTGGAGAGTAGGG + Intergenic
1175678188 20:60965190-60965212 GGCAAGGGAATGAGGGAGTCAGG + Intergenic
1175740332 20:61415532-61415554 GCCAGGGGCGGGGGAGAGTGCGG - Intronic
1176291845 21:5049958-5049980 CCCAGGGGGATGGGATGGTCTGG + Intergenic
1176591874 21:8655806-8655828 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1176857785 21:13985599-13985621 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1176858142 21:13986928-13986950 GCCAGGGCAAGGGGAGGGCCAGG - Intergenic
1178824669 21:36005038-36005060 GGCAGGGGGAGGGGGGAGTCGGG + Intergenic
1179061883 21:37986760-37986782 GGCAGGCAGATGGGAGAGTCTGG + Intronic
1179865411 21:44213683-44213705 CCCAGGGGGATGGGATGGTCTGG - Intergenic
1180065687 21:45411099-45411121 GGGAGGGGCATGGGAGAGACAGG + Intronic
1180081634 21:45490080-45490102 GTCAGGGGGAGGGGGGAGTCGGG - Intronic
1180221567 21:46362256-46362278 GCCAGAGGAACTGGAGAGTGAGG - Intronic
1180274715 22:10632907-10632929 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1180549191 22:16527845-16527867 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1180858411 22:19062635-19062657 GCCAGGGCAATGGGACAGGAAGG + Intronic
1180954897 22:19737161-19737183 GGCAGGGCCATGGGAGACTCAGG - Intergenic
1180970411 22:19812062-19812084 CCCAGGGCAGTGGGAGAATCAGG - Intronic
1181331175 22:22092547-22092569 ACAATGGGAAAGGGAGAGTCTGG + Intergenic
1181355499 22:22293990-22294012 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
1181630358 22:24147948-24147970 GCCTGGGCAAAGGCAGAGTCTGG + Intronic
1182236475 22:28881004-28881026 GCCAGGGGATAGGGGGAGGCAGG - Intergenic
1182280222 22:29214157-29214179 GACATGGGAATGGGTGAGACAGG + Intronic
1183122277 22:35739199-35739221 GCCATGGCAATGGGAGGGGCTGG + Intronic
1183138519 22:35914119-35914141 CCTAGTGGAATGGAAGAGTCTGG + Intronic
1184120480 22:42446522-42446544 GTCACAGGAATGGAAGAGTCGGG - Intergenic
1184444447 22:44539252-44539274 CCCAGGGGCATGGTAGATTCAGG - Intergenic
1184706502 22:46217205-46217227 TGCAGGGGAATGTGAGAGGCAGG - Intronic
1184848397 22:47103117-47103139 GCCTGGGGAAAGGGACAGGCTGG - Intronic
1185337964 22:50279172-50279194 GGCAGGGGAAGGGCAGAGTGTGG - Intronic
949541548 3:5036244-5036266 GCCAGGGGACTGAGAGGGCCAGG - Intergenic
950004376 3:9682246-9682268 TCCAGGGGCGTGGGAGGGTCAGG + Intronic
950330387 3:12151823-12151845 GCCAGGGGAATGGGAGAGTCAGG - Intronic
951482203 3:23173051-23173073 GACAGGGGAATAGGAGAGTTAGG - Intergenic
951924299 3:27890417-27890439 GCGAAGGGAATGGGAGAGTTGGG - Intergenic
953073115 3:39543471-39543493 TCCAGGGGAAGGGGCTAGTCAGG + Intergenic
954411553 3:50373462-50373484 GGCAGAGGAGTGGGAGAGGCAGG + Intronic
954699859 3:52445530-52445552 CCCAGGGGAGCTGGAGAGTCTGG - Intergenic
955377551 3:58410851-58410873 GCCACGGGAATGGGAGATTTTGG + Intronic
956145527 3:66187538-66187560 GCCAGGGTAAGGGTAGAGTCAGG - Intronic
957219775 3:77366898-77366920 TCCAGGGGACTGTGAGTGTCGGG - Intronic
957752099 3:84434275-84434297 GCTAGGGGAGTGGTAGAGTTAGG - Intergenic
958434162 3:94077188-94077210 GCCAGGGGAATACTGGAGTCGGG + Intronic
959079719 3:101787195-101787217 GCCAGGGGCAGGGGATAGGCAGG - Intronic
960550790 3:118973956-118973978 GCCGGGGGAAGGAGAGCGTCAGG + Intronic
960955591 3:123028191-123028213 GGCTGGGGAATGTGGGAGTCCGG - Intronic
960985777 3:123279716-123279738 GCCAGTGGAGGGAGAGAGTCTGG + Intergenic
961025262 3:123550182-123550204 GCCTGGGGCATGGGAGAATGGGG - Intronic
961798012 3:129423799-129423821 GCCAGAGAAATCGGAGAGGCTGG - Intronic
962252051 3:133841452-133841474 TCCGGGGGACTGGGAGAGCCGGG + Intronic
962255192 3:133865688-133865710 GCCTGGGAAATGGGAGGGTGAGG - Intronic
962329388 3:134464180-134464202 GGCAGAGGAATGGGAAAGTTCGG - Intergenic
962713929 3:138111058-138111080 GCCAGGGGAGTGGGGGAGGAAGG - Intronic
965606004 3:170498099-170498121 GCCAGGGAAAGGGGACAGTAGGG - Intronic
965881984 3:173397604-173397626 GACGGGGGAACGGGAGAGTGAGG - Intronic
966601758 3:181782355-181782377 GACAGGGGTGTGGGAGAGGCAGG - Intergenic
967346807 3:188466190-188466212 GGCAGTGAGATGGGAGAGTCAGG + Intronic
967835763 3:193960943-193960965 GCCAGGGGAAGGAGAGAAACGGG + Intergenic
968982523 4:3858085-3858107 ACCAGGGGGCTGAGAGAGTCAGG - Intergenic
969230617 4:5827804-5827826 GCCATGGGGATGGGAGGGCCTGG + Intronic
970695688 4:18674214-18674236 GCCAGGGGAATGAGAGACAAAGG + Intergenic
970826595 4:20283889-20283911 GGAAGGGGAATGGGAGGGTTTGG - Intronic
973380208 4:49315600-49315622 GACAGGGAAATGGGAGCTTCTGG - Intergenic
974632770 4:64515985-64516007 GCCAGGGGAAGGGGAAAATGAGG - Intergenic
974765900 4:66345473-66345495 GTCAGTGGACTGGGAGAGGCAGG - Intergenic
975724386 4:77277916-77277938 GCCAGGGGAGTTGGACAGACAGG - Intronic
977039896 4:92002526-92002548 CCCAGGGGAATAGGAGAATAGGG + Intergenic
977872190 4:102105566-102105588 GCCAGGGGGATTGGAGAGAGGGG - Intergenic
977898100 4:102386531-102386553 GTCAGGAGAATAGGAGAGTCAGG - Intronic
980300280 4:130982327-130982349 AACAGGGAAATGGTAGAGTCCGG - Intergenic
980457616 4:133066031-133066053 GTCAGTGGACTGGGAGAGGCAGG + Intergenic
981428722 4:144635343-144635365 CCCAGGGTAATGGCAGAGTAGGG + Intergenic
981842423 4:149127975-149127997 GCCAGTGAAATGGGAGAAGCTGG + Intergenic
983116733 4:163827285-163827307 TCCATGGGATTAGGAGAGTCAGG + Intronic
984883946 4:184433353-184433375 GGCAGGAGCATGGGAGAGCCAGG - Intronic
985079404 4:186248328-186248350 GCCAGGGGATTGGAGGAGTAGGG - Intronic
986547330 5:8912576-8912598 GTCAGTGGACTGGGAGAGGCTGG - Intergenic
987450633 5:18079487-18079509 GCCAGGGGCTTGGGAGAGGGAGG - Intergenic
989754820 5:44939800-44939822 GGCAGGAGAATGGGTGAATCCGG + Intergenic
989983259 5:50667353-50667375 GGGAGGGGAAGGGGAGAGGCTGG - Intronic
990597892 5:57329607-57329629 GGCAGGGGCAGGGGAGAATCAGG + Intergenic
991435300 5:66592063-66592085 ACCAGGGGAGTGGGAGATGCTGG - Intergenic
992222097 5:74583264-74583286 GCCAGTGAAGTGGGAGAGGCTGG + Intergenic
992412029 5:76514540-76514562 CCCAGGGGAATGATAGACTCAGG - Intronic
992623454 5:78616066-78616088 GCCAAGGGAATGGGAGGATGGGG - Intronic
992641877 5:78774781-78774803 GTCAGTGGACTGGGAGAGGCAGG + Intergenic
992739054 5:79754827-79754849 GCCAGGAGAAGGGGAGAATATGG - Intronic
993572933 5:89565489-89565511 GCCAGGGGAATGTGACTGCCTGG - Intergenic
997730510 5:136169343-136169365 GTCAGTGGACTGGGAGAGGCAGG - Intronic
998642481 5:144026944-144026966 GGAATGGGAATGGGAGAGGCAGG + Intergenic
1000067969 5:157712871-157712893 GCCAGGTCAATGAGACAGTCTGG - Intergenic
1001317047 5:170651043-170651065 GCCAGGAGAAGGGGTGAGTAGGG + Intronic
1001934193 5:175693038-175693060 GGCAGGGGAATGAGAAAGTCTGG - Intergenic
1002261988 5:177999708-177999730 GGCAGGGGTATTGGAGAGACAGG - Intergenic
1002416202 5:179122102-179122124 GCCAGGGGAATGAGAGATCCTGG + Intronic
1002865049 6:1114536-1114558 GCCAGGTGAAAGGGAGAGTTTGG - Intergenic
1003485868 6:6579332-6579354 GGCAGGGGAACTGGAGAGACAGG - Intergenic
1003985215 6:11428278-11428300 GCCAGGAGATTGGGAGACCCAGG - Intergenic
1004205585 6:13589086-13589108 GCCAGTGGGATGGGAGAGCACGG - Intronic
1004872645 6:19922759-19922781 AGCAGGGTGATGGGAGAGTCTGG + Intergenic
1006803186 6:36772202-36772224 GGTAGGGGGATGGGAGAGTATGG - Intronic
1007009713 6:38404063-38404085 GCCAGGGGATGGGGAGAGAAGGG + Intronic
1007115633 6:39341205-39341227 GCCAGGGGACTGGGAGTGGCTGG - Intronic
1007239767 6:40416645-40416667 GCCAAGGGCTTGGGAGAGTCAGG - Intronic
1007341491 6:41193937-41193959 GGCAGGGGACTATGAGAGTCGGG - Intronic
1007586046 6:42990061-42990083 GGCAGGGGATTGGGAGGGGCTGG + Intronic
1007764752 6:44153939-44153961 GCAAGGGGCCTGGGAGAGGCTGG + Intronic
1008544567 6:52574035-52574057 GCAAGGGGAATGGGAGAAAGGGG - Intronic
1009868748 6:69430552-69430574 GCCAGGGAAATGGGTTACTCTGG + Intergenic
1010612108 6:77965186-77965208 GTCAGGTGAATGTGAAAGTCAGG + Intergenic
1011548895 6:88511039-88511061 GATTGGGGAAGGGGAGAGTCAGG - Intergenic
1013013912 6:106144126-106144148 GCCAGGGGGATGGGAGGGTGGGG - Intergenic
1013366364 6:109440945-109440967 GCCGGGGGAACGCGGGAGTCGGG + Exonic
1013614458 6:111828743-111828765 GCTAGGGGAATGGCAGAATCCGG + Intronic
1014389295 6:120841213-120841235 GTCAGTGGACTGGGAGAGACAGG + Intergenic
1014544997 6:122724231-122724253 GCCAGGAGAAAGGGAAAGTCAGG + Intronic
1014559279 6:122871443-122871465 GTCAGTGGAATGGGAAAGGCAGG - Intergenic
1015256217 6:131182301-131182323 GCCAGGGGAAGGAGGGAGTGAGG - Intronic
1016153912 6:140780432-140780454 GCCAGGGGACTGGGTGAGTAGGG + Intergenic
1016749944 6:147621395-147621417 AGCAGGAGAAAGGGAGAGTCAGG + Intronic
1017074810 6:150607787-150607809 GCCAGGGTAATGAGATGGTCAGG + Intronic
1017166772 6:151415890-151415912 GCCAGGGGTTAGGGACAGTCCGG + Intronic
1018303956 6:162434540-162434562 TAAATGGGAATGGGAGAGTCTGG - Intronic
1019912436 7:4108832-4108854 GCCAGGGGATGGGGAGAGGAGGG - Intronic
1021306715 7:19040601-19040623 GAGAGGGAAATGGAAGAGTCAGG + Intronic
1022863135 7:34388840-34388862 TCCAGTGGTATGGGAGAGTATGG - Intergenic
1023984899 7:45088725-45088747 GCCAGGGGGATGGGGGAGAGGGG + Intronic
1024173405 7:46812936-46812958 GACAAGGGAATGGGAGGGTCAGG + Intergenic
1024331535 7:48160235-48160257 TCTAGGGGAATGGCTGAGTCAGG - Intergenic
1026598510 7:71754002-71754024 GCCAGGGAAATGTGAGAGCCTGG - Intergenic
1026880275 7:73903340-73903362 CCCAGGGGAATGGGGGACACAGG - Intergenic
1027229295 7:76262960-76262982 CCCAGAGGAAGGGCAGAGTCTGG + Intronic
1027954105 7:84857657-84857679 GCCAGCTGAATGGGAGACTGGGG - Intergenic
1028404075 7:90457227-90457249 GCCAAGGGAATTGGAGATGCTGG + Intronic
1028443697 7:90893925-90893947 GGCATGGGAATGGGAATGTCTGG + Intronic
1029409029 7:100397306-100397328 GCCACGGGGATGGGAGGGGCAGG + Intronic
1029844500 7:103398843-103398865 ACCAGGGGCATGGGTGATTCTGG + Intronic
1030056710 7:105589599-105589621 TCCAGGGCAATGGGAGATGCAGG - Intronic
1031249266 7:119358374-119358396 GCCAGGGGTTTGGGAGAGGGAGG + Intergenic
1031994808 7:128222963-128222985 GCAAGGAGGATGGGAGAATCAGG - Intergenic
1032800801 7:135316116-135316138 GCCAGGTGAACGGGAGTGTTAGG - Intergenic
1033371632 7:140714258-140714280 GCCAGAGGAATGGGTGAAGCAGG + Intronic
1034090344 7:148358175-148358197 GCCAGGGGGCTGGGAGAAGCAGG + Intronic
1034691414 7:153017349-153017371 GCCTGGGGGCTGGGAGAGACTGG + Intergenic
1035020282 7:155796834-155796856 GGCAGGGGCGTGGGAGAGTGAGG - Intergenic
1035047688 7:155980056-155980078 TGCAGGGGAAGGGGAGACTCAGG + Intergenic
1035076574 7:156181601-156181623 CCCAGGAGGATGAGAGAGTCCGG + Intergenic
1035300954 7:157896909-157896931 GGACGGGGAATGGGAGACTCTGG - Intronic
1035409999 7:158632167-158632189 GGCAGGGGAGTGGGAAAGTGAGG - Intronic
1038162541 8:25053745-25053767 ACCAGGGGCATTGGAGAGACCGG - Intergenic
1038259417 8:25980100-25980122 CCCAAGGGAATGAGAGAGTCAGG - Intronic
1039464686 8:37776155-37776177 GCATGGGGAATGGGAGATGCTGG - Intronic
1042566013 8:70112783-70112805 GAGAGGGGAAGGGAAGAGTCAGG + Exonic
1043268989 8:78305069-78305091 GTGAGGGGAATGAGAGAGTCTGG - Intergenic
1045063016 8:98424820-98424842 GCCAAGGGAATGGGAGCGGCTGG + Intronic
1045895377 8:107209865-107209887 GTCAAGGGAAAGAGAGAGTCAGG - Intergenic
1046412119 8:113859239-113859261 GCCTGGGCACTGGGAGAGTAGGG + Intergenic
1047602783 8:126443146-126443168 GCTGGGGGAATATGAGAGTCTGG + Intergenic
1047933159 8:129750306-129750328 GCCAGGGGAATGAGAAAGACTGG - Intronic
1049733043 8:144188833-144188855 ACCTGGGGAGTGGGAGAGCCAGG + Intronic
1049931586 9:462512-462534 GCCAGGGCAAAGGGAGATTCTGG - Intronic
1049961552 9:742432-742454 GCCAGGGGTCTGGGGGACTCTGG + Intronic
1050484872 9:6123478-6123500 GCCAGGAGGTGGGGAGAGTCAGG - Intergenic
1051009785 9:12397226-12397248 GGCAGGGGAATGGGGAAGTCAGG - Intergenic
1051157441 9:14165837-14165859 GCCAGGGGCTGGGGAGAGTAGGG + Intronic
1051668613 9:19488570-19488592 GGGAGGGGAAGGGCAGAGTCAGG + Intergenic
1051792719 9:20826198-20826220 GTCAGTGGACTGGGAGAGGCAGG + Intronic
1053462371 9:38280783-38280805 GCCTGGGGAGTGGGAAAGTCTGG + Intergenic
1053691244 9:40588462-40588484 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1054273557 9:63049023-63049045 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
1054302504 9:63389433-63389455 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1054401277 9:64715933-64715955 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1054434885 9:65200253-65200275 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1054495504 9:65821428-65821450 GCCAGGGCCATGGCAGAGTCAGG + Intergenic
1055397879 9:75892563-75892585 GCCAGGGGGAAGGGAGAGGGAGG + Intronic
1055397887 9:75892597-75892619 GCCGGCGGAGTGGGAGAGTACGG + Intronic
1057941866 9:99292098-99292120 GGCAGGGGAATGGCTGAGCCTGG + Intergenic
1058161458 9:101574540-101574562 GCCAGGAGAAGGGGACAATCTGG + Intronic
1058674525 9:107389137-107389159 GCCAGGGGGATGGAAGAGGAAGG - Intergenic
1058737235 9:107904913-107904935 GGCAGTGGAGTGGCAGAGTCTGG + Intergenic
1058799808 9:108534588-108534610 GCCAGGGGAATCTAAGAGCCAGG + Intergenic
1059212199 9:112523868-112523890 GTCAGGGGAATGGGAAACTATGG - Intronic
1060723631 9:125994018-125994040 GCCAGCGACATGGGAGATTCTGG + Intergenic
1061552926 9:131348548-131348570 GGGAGGGGAATGGCAGAGGCTGG - Intergenic
1061618823 9:131797537-131797559 GCCAGGGCAATTGGAGAGTCGGG + Intergenic
1062354171 9:136154080-136154102 ACTGGGGGAATGGGAGAGACTGG - Intergenic
1062354193 9:136154151-136154173 GACTGGGGGATGGGAGAGACTGG - Intergenic
1062354229 9:136154252-136154274 GACTGGGGAATGGGAGAGACTGG - Intergenic
1062354306 9:136154480-136154502 GACTGGGGGATGGGAGAGACTGG - Intergenic
1062354319 9:136154532-136154554 GACTGGGGGATGGGAGAGACTGG - Intergenic
1062354347 9:136154636-136154658 GACTGGGGGATGGGAGAGACTGG - Intergenic
1062354361 9:136154688-136154710 GACTGGGGGATGGGAGAGACTGG - Intergenic
1203568637 Un_KI270744v1:111691-111713 GACAGGGAAATGGGAGATTGTGG + Intergenic
1203621914 Un_KI270749v1:134625-134647 GCCAGGGCCATGGCAGAGTCAGG - Intergenic
1187610738 X:20940075-20940097 TCCAGGAGAAAGGGAGAGTAAGG - Intergenic
1187826976 X:23341417-23341439 GCCAGGGAAATGTGAGATGCTGG + Intronic
1190406986 X:50098074-50098096 GCCAGGAAAATGGGAGAGAAAGG - Exonic
1191162053 X:57340312-57340334 GTCAGTGGACTGGGAGAGGCAGG - Intronic
1191226740 X:58052095-58052117 GTCAGTGGACTGGGAGAGGCAGG + Intergenic
1192338214 X:70239484-70239506 GCCAGGGGGCGGGGAGCGTCAGG - Intronic
1192358926 X:70426264-70426286 GTCAGGGGAAGGGAAGGGTCGGG + Intronic
1193472640 X:81925816-81925838 GGCAGGGGCATGGTAGAGGCTGG - Intergenic
1195577483 X:106467734-106467756 GCCAGGGGAGTGGGAGGATCCGG - Intergenic
1195717143 X:107827748-107827770 GACAGGGGGATGTGAGGGTCGGG - Intronic
1196478076 X:116112220-116112242 CCCAGGGGAAGGGGTGAATCAGG - Intergenic
1196918168 X:120560795-120560817 ACCGGGGGAATGGGAGGGTTTGG + Intronic
1197572325 X:128164195-128164217 CCCTGGGGTATGGGACAGTCAGG - Intergenic
1197957681 X:131970261-131970283 GCCAGGGAAATAATAGAGTCTGG + Intergenic
1198466539 X:136909293-136909315 GCCACGGGAAAGGGCGAGGCGGG + Intergenic
1199169360 X:144717937-144717959 GCCAGGGGAGGTGGAGACTCTGG - Intergenic
1200057328 X:153468510-153468532 GCCCTGGGAATGGGACACTCTGG + Intronic
1200164135 X:154024443-154024465 GGAAGGGGACTGGGGGAGTCAGG + Intronic
1201189927 Y:11437117-11437139 GCCAGGGCCATGGCACAGTCAGG - Intergenic
1202583703 Y:26404821-26404843 GCCAGGGCCATGGCAGAGTCAGG + Intergenic