ID: 950333521

View in Genome Browser
Species Human (GRCh38)
Location 3:12175943-12175965
Sequence CCTCACAGCAGCCCGCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950333521_950333528 28 Left 950333521 3:12175943-12175965 CCAGCTTGCGGGCTGCTGTGAGG 0: 1
1: 0
2: 0
3: 24
4: 214
Right 950333528 3:12175994-12176016 ATGGACTCTGAAATGCTTTAGGG 0: 1
1: 0
2: 3
3: 24
4: 239
950333521_950333527 27 Left 950333521 3:12175943-12175965 CCAGCTTGCGGGCTGCTGTGAGG 0: 1
1: 0
2: 0
3: 24
4: 214
Right 950333527 3:12175993-12176015 CATGGACTCTGAAATGCTTTAGG 0: 1
1: 0
2: 2
3: 21
4: 237
950333521_950333524 9 Left 950333521 3:12175943-12175965 CCAGCTTGCGGGCTGCTGTGAGG 0: 1
1: 0
2: 0
3: 24
4: 214
Right 950333524 3:12175975-12175997 AGCAACTGACCCTCTGTACATGG 0: 1
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950333521 Original CRISPR CCTCACAGCAGCCCGCAAGC TGG (reversed) Intronic
900105867 1:980769-980791 CCACACAGCAGCCGGTCAGCAGG - Exonic
900369108 1:2323648-2323670 CCCCACAGCAGCCCCCACGCTGG + Intronic
901158185 1:7154708-7154730 CCCCACACCAGCCCGGAGGCTGG + Intronic
901737342 1:11320681-11320703 ACTCACAGCAGGCCGGCAGCTGG + Intergenic
902282530 1:15384834-15384856 CCTCACATCAGCCTGCGAGGAGG + Intronic
902698762 1:18157490-18157512 CCACGCTGCAGCCCACAAGCTGG + Intronic
902921118 1:19666386-19666408 CCTGCTAGCTGCCCGCAAGCAGG + Exonic
905206308 1:36344544-36344566 CAGCACAGCAGCTCACAAGCAGG + Intronic
905882469 1:41473791-41473813 CCTGACAGCAGACCGGAAGGAGG - Intergenic
906574429 1:46875157-46875179 CCTCACAGCAGCTAAAAAGCAGG + Intergenic
907213587 1:52843287-52843309 GCTCACAGCAGCCCGCACTGGGG - Intronic
907515372 1:54990366-54990388 CCTCACAGCAGCCTGCTGGGAGG - Intronic
908931057 1:69316187-69316209 CCACACAGCAACCTGCATGCTGG - Intergenic
910538285 1:88324960-88324982 TCTTACAGCTGCCCGCAACCTGG - Intergenic
916995002 1:170287083-170287105 CCTCAAAGGAGCTCACAAGCTGG - Intergenic
917522521 1:175759963-175759985 CTTCACAGCATCTCCCAAGCTGG - Intergenic
920065967 1:203269922-203269944 CCTCACAGCAGCCGGTGGGCAGG + Intronic
922507138 1:226133130-226133152 GCTCACAGCAGCCTGCACACTGG - Intergenic
923021485 1:230167601-230167623 CTTCACCTCAGCCCACAAGCAGG - Intronic
1063191402 10:3697967-3697989 TCTCCCAGCAGCCCTCTAGCTGG - Intergenic
1065807745 10:29410112-29410134 CCCCACAGAAACCCTCAAGCGGG - Intergenic
1065814221 10:29470063-29470085 CCTCAGAGCGGCCCCCAAGTCGG + Intronic
1067565251 10:47331564-47331586 CCTTACAGCAGCCCTCAGGGAGG + Intergenic
1067809644 10:49417294-49417316 CGTCCCAGCAGCCAGCATGCAGG - Intergenic
1068780505 10:60914607-60914629 CCTGATAGCAGCCCCCAAGAAGG + Intronic
1070589349 10:77790373-77790395 CTACAAAGCAGCCCCCAAGCAGG + Intergenic
1070772814 10:79092188-79092210 CCTCACAGCAGCAGGCAGACAGG - Intronic
1073420774 10:103421923-103421945 CGTCACTGCAGCCCGCAGTCCGG + Intronic
1074130360 10:110568098-110568120 CCTCCCAGCGGCCCGCCCGCCGG - Intronic
1076589720 10:131574741-131574763 CATCACAGGGGCCCGCAGGCTGG - Intergenic
1077269239 11:1667322-1667344 CCTCAGTGCCGCCCACAAGCGGG - Intergenic
1077271306 11:1683383-1683405 CCTCAGTGCTGCCCACAAGCGGG + Intergenic
1077338663 11:2016503-2016525 CCCCACACCAGCACGCATGCAGG - Intergenic
1078662330 11:13297523-13297545 CCCACCAGCAGCCCTCAAGCTGG - Intronic
1083813689 11:65119821-65119843 CCTCACAGCAGCCCTGGAGATGG + Intergenic
1088935734 11:114398473-114398495 TCTCACAGCAGCCCATAAGAGGG - Intronic
1089811812 11:121138328-121138350 TCACACAGCAGCCACCAAGCAGG - Intronic
1091108203 11:132942775-132942797 CGGCACGGCAGCACGCAAGCGGG + Intronic
1091339910 11:134802264-134802286 CCGCACAGCAGCAAGCAGGCTGG - Intergenic
1202821647 11_KI270721v1_random:71685-71707 CCCCACACCAGCACGCATGCAGG - Intergenic
1091654521 12:2335743-2335765 CCTCACAACAGCCTGCAGGGAGG - Intronic
1091801721 12:3328742-3328764 CCTCACAGCAGCCCTCGGCCCGG + Intergenic
1093407052 12:18817415-18817437 CCTCACACCAACCTGCAAGTTGG + Intergenic
1094000030 12:25684979-25685001 TCTCACTGCAGCCACCAAGCTGG + Intergenic
1094476729 12:30846209-30846231 CCTCACAGCAGCTGAAAAGCAGG + Intergenic
1101002983 12:100374882-100374904 CCTCACAGCAGCTCTCCAGTTGG - Intronic
1102206669 12:111095652-111095674 TCTCACTGCAGCCCTCAAGGAGG - Intronic
1102961967 12:117099046-117099068 CCTCGCCGCAGCCCGCGAGGTGG + Intronic
1105006671 12:132725223-132725245 CCTCACAGCTGCCACCACGCTGG + Intergenic
1105482248 13:20789226-20789248 TCACACAGCAGCCAGCCAGCAGG - Intronic
1106215705 13:27697071-27697093 CCTCACACCAGCCCCTAAACTGG + Intergenic
1107560036 13:41550390-41550412 CCTCAGAGCTGCCCTGAAGCAGG + Intergenic
1109262793 13:60163803-60163825 CCACTCAGCAAGCCGCAAGCTGG + Exonic
1110344939 13:74435034-74435056 CCTCACAGCAACCAGGAAGCAGG - Intergenic
1110540532 13:76702002-76702024 CCTCAGAGAAGCCCCCAAACTGG + Intergenic
1112993132 13:105538531-105538553 CCTCACAGCAACCCCCCTGCCGG + Intergenic
1113853894 13:113433566-113433588 CCTCACAGCAGGCAGCCGGCAGG + Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1116616887 14:47150980-47151002 CCTCACTGCAGCCAGCTAGTTGG + Intronic
1118729405 14:68655923-68655945 CCTCACAGCAGACAGGAACCAGG + Intronic
1119489157 14:75015489-75015511 CCTCCATGCAGCCCTCAAGCAGG + Exonic
1121121292 14:91377300-91377322 CTTCACAGCAGGCCTCAGGCTGG - Intronic
1121629036 14:95409211-95409233 CCTCAGAGCAGCCAGCTAGGCGG - Intronic
1121735395 14:96214424-96214446 CCTCACAACAGCCCTCCTGCCGG + Intronic
1122364349 14:101185623-101185645 CCACACAGCAGCCTGCAAGGTGG + Intergenic
1122402315 14:101474787-101474809 CCTCACAACAGCCAGGAAGTAGG - Intergenic
1122548711 14:102538811-102538833 CCTCACCACAGCCCTCAAGGGGG + Intergenic
1123114782 14:105889777-105889799 CCTCCCTGCAGCCCACACGCTGG - Intergenic
1124035845 15:26053024-26053046 CATCATAGCAGTCTGCAAGCAGG - Intergenic
1124145914 15:27124979-27125001 CCACACAGCAGTAAGCAAGCAGG - Intronic
1124202019 15:27686831-27686853 CCTCACAGCACCCTCCACGCTGG - Intergenic
1125507831 15:40277248-40277270 TCTCACAGCAGCCCTGAAGTGGG - Exonic
1125509682 15:40286276-40286298 CCTCCCAGCAGGCCCCAGGCTGG + Intronic
1127397179 15:58552252-58552274 CCTCACAGCAACCCCCAGACAGG + Intronic
1128242898 15:66113492-66113514 CCTCACTGCAGCGGGCAAGGAGG - Intronic
1128334862 15:66779358-66779380 CCTCACACCAGCCCGCAGCTTGG - Intronic
1129318161 15:74758743-74758765 CCTCCCGGCAAGCCGCAAGCAGG + Intergenic
1129697677 15:77749840-77749862 CCTCTTACCAGCCCTCAAGCTGG - Intronic
1132522247 16:397195-397217 GCTCACAGCGGCCCGCGGGCCGG + Exonic
1132907447 16:2290138-2290160 CCTCACGGCAGCCTGCACACAGG - Intronic
1134752013 16:16632682-16632704 CCTCACAGCAACCCTCAAAGAGG - Intergenic
1136088580 16:27902793-27902815 CCTCACTGCAGCCCTTAAGGCGG - Intronic
1136112130 16:28070311-28070333 GGACACAGCAGCCCGCAAACTGG + Intergenic
1137725077 16:50651469-50651491 CCCCACTGCAGTCCGCAATCCGG - Intergenic
1139443196 16:66979365-66979387 CCTCCCTGCTGCCCCCAAGCTGG + Intergenic
1139531375 16:67544300-67544322 CCTCCAAGCAGCCCGGAGGCTGG + Exonic
1140027517 16:71304086-71304108 CCACACTGCAGCCCGAAGGCAGG + Intergenic
1141805302 16:86337763-86337785 CCACACGGCAGCCAGCGAGCTGG - Intergenic
1141827571 16:86491880-86491902 CGTCACAGCAGCCAGCTCGCCGG + Intergenic
1141860542 16:86713338-86713360 CCTCCCAGCACCTCGCAAGCAGG - Intergenic
1142021386 16:87785027-87785049 CCTCACAGCAGCCGGAATGTGGG + Intergenic
1142614242 17:1125563-1125585 CCTCCCAGCAGCCCCGGAGCGGG - Intronic
1144682044 17:17202726-17202748 ACGCACAGCAGCCCGCAGGGAGG + Exonic
1144737223 17:17561898-17561920 GCACACAGCAGCCGGGAAGCTGG + Intronic
1144961467 17:19046619-19046641 CCTCACAACAGCCCCAAAGGAGG + Intronic
1144973693 17:19127905-19127927 CCTCACAACAGCCCCAAAGGAGG - Intronic
1145250662 17:21295353-21295375 CCTCATAGCAGCCCCCAGGCAGG - Intronic
1146926453 17:36749229-36749251 CCTCCCAGCGCCCCACAAGCTGG + Intergenic
1147568980 17:41555779-41555801 CATCACAGAAGCCTGTAAGCTGG + Intergenic
1148682786 17:49484265-49484287 CCTCACAGCCCCCTGCAGGCAGG - Intergenic
1149415325 17:56453669-56453691 CCTCACAGCATCCTGAAAGGGGG + Intronic
1149451488 17:56753377-56753399 CCTCACAGCAGCGTGCAGGATGG - Intergenic
1150647481 17:66988352-66988374 CCAAACAGCCGCCGGCAAGCAGG + Intronic
1151529548 17:74695696-74695718 CCTCACAGCAGCCCCCATGGAGG + Intronic
1151893271 17:76963702-76963724 CCTCTCAGGAGCCCCCAAGGTGG + Intergenic
1151975887 17:77483369-77483391 GCTCACAGCTGCCTGGAAGCTGG + Intronic
1152302123 17:79501242-79501264 CTTCCCCGCAGCCTGCAAGCAGG - Intronic
1152932706 17:83118314-83118336 CCTCACAGCAGACCCCAAACAGG + Intergenic
1153543783 18:6185468-6185490 CCTCACTGCAGGCTGCAGGCTGG + Intronic
1156871961 18:41955466-41955488 CCTCACAGCCGCCCCCAATCTGG - Intronic
1160683734 19:423923-423945 CCTCACAGCAGCCCTCAGATGGG - Intronic
1160711017 19:550949-550971 CATCCCAGCAGCCCGAAAACAGG + Intergenic
1160732911 19:649276-649298 CCTCACAGTAGCCCACCAGCCGG - Intronic
1160901634 19:1431800-1431822 CCTCACAGCACGCAGCCAGCAGG + Intronic
1160980351 19:1813843-1813865 CCTCACAGCTGCACCCAACCAGG - Intergenic
1161167791 19:2797596-2797618 ACTCACAGCAGCCCACATTCTGG - Intronic
1161830726 19:6602296-6602318 ACAAACAGCAGCCTGCAAGCTGG + Intronic
1163624809 19:18383052-18383074 CCTCTCCGCAGCCAGGAAGCTGG + Intronic
1165390358 19:35535039-35535061 CCTCACAGCAGCCCCTAGGTGGG + Intronic
1167260035 19:48453124-48453146 CATCACGGCAGCCCACAGGCCGG - Exonic
925885613 2:8391769-8391791 CCTCCCAGCAGCCGGCCTGCTGG - Intergenic
926625163 2:15085044-15085066 CGTCACAGCAGCCCCCAGGGCGG - Intergenic
928158164 2:28895083-28895105 CCTCGCGGCAGGCCGCACGCGGG - Intronic
929576980 2:43058062-43058084 CCTCACAGGAGACAGAAAGCAGG - Intergenic
932197405 2:69796461-69796483 CCTCACTGCAGCCAAAAAGCAGG - Intronic
932764523 2:74461524-74461546 CCACACAGCACCCCGCCAGTAGG + Exonic
932845284 2:75128735-75128757 CTTGACAGGAGCCCTCAAGCTGG - Intronic
933698755 2:85239289-85239311 CCTCACAGCAGCAGAGAAGCAGG - Intronic
933714891 2:85352668-85352690 CAACACACCAGCCCACAAGCCGG + Intronic
935684745 2:105673347-105673369 CTTCACTGCAGCCAGCAATCAGG - Intergenic
935720766 2:105976998-105977020 CCCCACAGCAGGCCCCCAGCAGG - Intergenic
937944698 2:127322191-127322213 ACTCACAGGAGACCGTAAGCTGG + Exonic
938654844 2:133420734-133420756 CCTCACAGCAAACCGCCAGGAGG + Intronic
940902164 2:159135615-159135637 GGGCACAGCAGCCAGCAAGCGGG - Intronic
946194200 2:218023372-218023394 GCTCACAGCAGCCCTGAAGGGGG - Intergenic
947620257 2:231585519-231585541 CCGCACTCCAGCCCGCAACCTGG + Intergenic
1170234270 20:14084676-14084698 ACACACAACAGCCAGCAAGCAGG - Intronic
1172003629 20:31801659-31801681 CCTCACAGCAGCCACGCAGCAGG + Exonic
1172106795 20:32521918-32521940 CCTCGCCGCAGCCCGCAGCCGGG + Intronic
1172629166 20:36366766-36366788 CCCCACAGCAGTCGGGAAGCTGG - Intronic
1172891635 20:38270096-38270118 CCTCACAGCAGACGGGAAACAGG - Intronic
1173688898 20:44943509-44943531 CTGCACAGAAGCCCTCAAGCTGG - Exonic
1176110376 20:63408147-63408169 CCTCTCAGCAGCCCCCACCCAGG + Intronic
1178412006 21:32372151-32372173 CCTCACAGCAGTCCTGACGCAGG - Intronic
1180184531 21:46132856-46132878 GCGCACAGAAGCTCGCAAGCAGG - Intergenic
1181935599 22:26436256-26436278 CCTCAAAACAGCCAGCAAGTGGG - Intronic
1182583403 22:31328676-31328698 CCTCAAGGCAGCCAGAAAGCCGG + Intronic
1182713050 22:32334523-32334545 GCTCACAGCAGCCAACCAGCAGG - Intergenic
1183978142 22:41524985-41525007 CCACACAGCAACCAGCAAGCAGG - Intronic
1184857721 22:47155636-47155658 CATCACAGCAGCCTGCAAAGGGG + Intronic
1185207690 22:49549492-49549514 CTTCACAGCAGCGGGCAAGTGGG + Intronic
950215837 3:11158125-11158147 CCTCACAGCAACCTGTAAGGTGG - Intronic
950333521 3:12175943-12175965 CCTCACAGCAGCCCGCAAGCTGG - Intronic
950442174 3:13016427-13016449 CCTCACAGCAGCCCGGGTGACGG + Intronic
961866761 3:129959058-129959080 CCTCACAGCAGCCCACATGGTGG + Intergenic
962414010 3:135166433-135166455 GCTCTCAGCAGCCAGCAAGAGGG + Intronic
962707502 3:138059530-138059552 CCTCACAGCAGCCCTTGAGATGG - Intergenic
963082214 3:141404440-141404462 CCTCACAGAGGCCCTGAAGCTGG - Intronic
965557542 3:170033619-170033641 CCTCACAGCAACCTCAAAGCAGG + Intergenic
966744551 3:183263328-183263350 CCTCAAACCAGCCCCCAAGTGGG + Intronic
966974118 3:185070073-185070095 CCTCACTGCAGCCCGCAGCGGGG - Intergenic
968728936 4:2260879-2260901 CCTCACAGCAGCCAGGAGGGTGG + Intronic
969251586 4:5971920-5971942 CCCCACAGCAGCCAGCCAGCCGG + Intronic
969271376 4:6105604-6105626 GCTCAAGGCAGCGCGCAAGCAGG - Exonic
978655990 4:111066151-111066173 CCTCCCAGCAGGCTGCAACCAGG - Intergenic
979851209 4:125573253-125573275 CCCCACAGCAGCCTGTAAGCGGG - Intergenic
982542829 4:156695883-156695905 CCTCTAAGCAGCCAGCAACCTGG + Intergenic
985542898 5:495033-495055 CCTCAAAGCAGCCCACGTGCCGG - Intronic
985712424 5:1436924-1436946 CCTCACAGGAGGCATCAAGCAGG + Intronic
985714097 5:1445983-1446005 CGTCTCCGCAGCCCGCACGCCGG - Intergenic
986687396 5:10286704-10286726 CCTGACAGCTGCAGGCAAGCTGG + Intronic
988297877 5:29390253-29390275 CCCCACAGCAGCCTGTAAGCGGG + Intergenic
988820457 5:34879483-34879505 CCTCCCAGCACCCCCCAAACAGG + Intronic
992269287 5:75049980-75050002 CCTTACAACAGCCCACAAGGAGG + Intergenic
997338882 5:133127013-133127035 TCTCACAGCAGCCAACAGGCAGG - Intergenic
998152359 5:139764657-139764679 CGGCCCAGCAGCCAGCAAGCTGG + Intergenic
998203108 5:140141008-140141030 CCTCAGAGGAGCCTGGAAGCAGG - Intergenic
999474230 5:151883720-151883742 ACTCACAGCAGGCCACAAGGTGG + Intronic
999695824 5:154188379-154188401 CCTCAGAGCATCCCTCAGGCAGG - Intronic
1000422488 5:161054617-161054639 TCTCACAGCAGGCTGCAAGCTGG + Intergenic
1000834419 5:166135944-166135966 CCCCACAGCAGCCTGTAAGTGGG - Intergenic
1001554076 5:172624477-172624499 CCTCTCAACAGCCTGCAAGGTGG - Intergenic
1001914392 5:175547544-175547566 CCTCCCAGCAGCTCACAAGGTGG - Intergenic
1002916895 6:1536699-1536721 CCTCACAGCAGCCGACAGCCGGG + Intergenic
1006601475 6:35229436-35229458 CCGCACAGCAGCCTTCAAGTGGG - Intronic
1006808448 6:36804578-36804600 CCTCACAGCATCCCTCTAGCAGG + Intronic
1007829356 6:44626804-44626826 CCTCACCTCAGCAGGCAAGCAGG + Intergenic
1009039568 6:58159844-58159866 ACAAACAGCAGCCTGCAAGCTGG - Intergenic
1009215462 6:60914684-60914706 ACAAACAGCAGCCTGCAAGCTGG - Intergenic
1011630145 6:89315255-89315277 CCTCAGAGCAGCCCGTCAGGAGG - Exonic
1011650784 6:89504274-89504296 CCTCACAGCATCCCATCAGCTGG - Intronic
1015594170 6:134850443-134850465 CCTCACAGCAGCCCCTGAGGTGG - Intergenic
1017900587 6:158715687-158715709 ACTCCCAGCAGCCAGAAAGCTGG - Intronic
1018812062 6:167305486-167305508 CCTCAGAGCAGCCCAGCAGCCGG - Intronic
1019179756 6:170178836-170178858 CCTCCAAGCAGCCCGGAAGCCGG + Intergenic
1019437164 7:1028215-1028237 CCTCCCTGCAGCCCGAATGCGGG + Intronic
1019455313 7:1123748-1123770 CCTCCCAGTAGCCCGGAAACTGG + Intronic
1019478451 7:1255237-1255259 CCTCAGAGCAGGCCCCAGGCCGG - Intergenic
1022410298 7:30134894-30134916 CCCCACGGCGGCCCGCAAGGGGG + Exonic
1023622601 7:42088317-42088339 CCCCACAGCTGCCTGCAGGCTGG + Intronic
1023861185 7:44218487-44218509 CTTCTCTGCAGCCCGCAAGGGGG - Exonic
1025129822 7:56369450-56369472 CCTCCCGGCAGCCCGCGTGCGGG - Intergenic
1026342560 7:69447051-69447073 CATCACAACAGCCCACAAGGTGG + Intergenic
1032441382 7:131945403-131945425 CCTCAGAGCACCCCGGAAGCGGG + Intergenic
1034502562 7:151460302-151460324 CCTCGCAGGAGCCTGCCAGCTGG + Intergenic
1034996026 7:155577787-155577809 CCTCACTGCAGCCCGGGAGCAGG - Intergenic
1034996038 7:155577839-155577861 CCTCACTGCAGCCCGGGAGCAGG - Intergenic
1034996050 7:155577890-155577912 CCTCACTGCAGCCCGGGAGCAGG - Intergenic
1034996062 7:155577941-155577963 CCTCACTGCAGCCCGGGAGCAGG - Intergenic
1036739694 8:11348780-11348802 CCTCACAGCAACCCTGAAGCTGG - Intergenic
1041171770 8:55149693-55149715 CCGGACAGCAGCCAGCAGGCTGG + Intronic
1042639767 8:70920984-70921006 GCTCACAGCAACCCACAATCTGG - Intergenic
1044325489 8:90853158-90853180 CCTCACAGGAGGCAGCATGCAGG - Intronic
1047543793 8:125796578-125796600 CACCACAGCAGCCAGCATGCTGG - Intergenic
1048234776 8:132679048-132679070 TCTCACAGTAACCCTCAAGCAGG + Intergenic
1049315288 8:141962957-141962979 CCTCACTGCAGCCTCCAAACTGG + Intergenic
1049543087 8:143217378-143217400 CCTCACTGTAGCCCACAAGGAGG - Intergenic
1049717613 8:144100367-144100389 CCTCACAGCAGAACCAAAGCAGG + Intronic
1051846296 9:21455053-21455075 CCGCACAGCAGGAGGCAAGCAGG + Intergenic
1057172248 9:92969828-92969850 CATCACAGCAGCCAGTGAGCAGG - Intronic
1057198427 9:93127747-93127769 TCTCACAGCTGCCTCCAAGCAGG - Intronic
1057880279 9:98787954-98787976 CCCCACAGCAGCCCTGAGGCGGG + Intronic
1058153409 9:101486495-101486517 CCTAATGGCCGCCCGCAAGCAGG - Intronic
1058670741 9:107358792-107358814 CCTCACAGCAGTCCGGGAGGAGG - Intergenic
1059331793 9:113540203-113540225 CCTCGCAGCAGTCCCCATGCAGG - Intronic
1059588402 9:115630995-115631017 ACTCACAGCAACCTGCAAGAGGG + Intergenic
1059903135 9:118951521-118951543 TCTCACAGCTGCCCTCAAACAGG - Intergenic
1060485705 9:124045260-124045282 CCTCACCGCCGCCCGTGAGCAGG + Intergenic
1060528644 9:124334677-124334699 CCTTAAAGGAGCCCGCAAGGTGG + Intronic
1061056398 9:128225023-128225045 CCTCACAGAAGCACGCAGGGAGG + Intronic
1061587687 9:131579271-131579293 CCTCAGGGCAGCCAGCAGGCAGG - Exonic
1061838074 9:133342263-133342285 CCTCACGGCAGCCAGGATGCAGG + Intronic
1061847248 9:133394654-133394676 CCTCGCAGCAGCCCTCCAGGTGG + Intronic
1189004795 X:36984449-36984471 CCTCACACTGGCCCGCCAGCAGG - Intergenic
1189043996 X:37571921-37571943 CCTCACACTGGCCCGCCAGCAGG - Exonic
1189279782 X:39813024-39813046 CCTGACAGCAGCCTCCAATCAGG - Intergenic
1191779599 X:64850971-64850993 CCCCACAGCAGCCTGTAAGCGGG + Intergenic
1193525989 X:82590164-82590186 CCACACATCAGCCTGAAAGCAGG + Intergenic
1198892985 X:141420257-141420279 CCTCACTGCATCACCCAAGCTGG - Intergenic