ID: 950335381

View in Genome Browser
Species Human (GRCh38)
Location 3:12188876-12188898
Sequence TCCAAGGATCTGCCCTCACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950335381_950335383 -7 Left 950335381 3:12188876-12188898 CCGCGTGAGGGCAGATCCTTGGA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 950335383 3:12188892-12188914 CCTTGGATTGTCACTGCCTCTGG 0: 1
1: 0
2: 0
3: 15
4: 145
950335381_950335384 -6 Left 950335381 3:12188876-12188898 CCGCGTGAGGGCAGATCCTTGGA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 950335384 3:12188893-12188915 CTTGGATTGTCACTGCCTCTGGG 0: 1
1: 0
2: 4
3: 30
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950335381 Original CRISPR TCCAAGGATCTGCCCTCACG CGG (reversed) Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
902798559 1:18815261-18815283 TCCAGGGTTCTCCCCTCACTGGG - Intergenic
902819958 1:18937767-18937789 CCCAAGGCTCTGCCCTCCAGTGG - Intronic
903803097 1:25984487-25984509 TGCATGGAGCTGGCCTCACGTGG - Exonic
904370580 1:30045335-30045357 TACAAGGATCTGCCCCTACCTGG + Intergenic
905442043 1:38001732-38001754 TCCAACAATCTCCCCTCACAAGG + Intronic
908172882 1:61525047-61525069 TACAAGGTTCTGCACTCAAGAGG + Intergenic
915196642 1:154194594-154194616 TCCAAGGGTCTTCCCTCACAGGG + Intronic
918439410 1:184551551-184551573 TCTGAGGATCTTCCCTCACTGGG + Intronic
919743523 1:200994631-200994653 TACAAGGATCTTCCCTCATGAGG + Intronic
1062942614 10:1435434-1435456 GCAAAGGCTCTGCCCTCAAGCGG - Intronic
1067749611 10:48962109-48962131 GCCTATGATCTGCCCTCACCTGG + Intronic
1074357169 10:112796629-112796651 TCCAAGGACTTGCCCACACCAGG - Intronic
1076886793 10:133266786-133266808 GCCAATGAGCTGCCCCCACGGGG + Intronic
1077204132 11:1333601-1333623 ACCAAGGAGCTGCCCTGTCGAGG + Intergenic
1083363457 11:62127531-62127553 TCCAGAGATATGCCCTCAAGGGG - Intronic
1092751390 12:11722750-11722772 TCCCCGGATCTGGCCTCACCTGG - Intronic
1093423298 12:18999442-18999464 ACAAAGGATCTGTCCGCACGTGG + Intergenic
1094055461 12:26265025-26265047 ACCAAGTCTCTGCCCTCATGGGG + Intronic
1104134327 12:125923154-125923176 TTCAAGGAGATGCCCTCAGGAGG + Intergenic
1104500039 12:129276163-129276185 GCCAAGGATTTGCCCACTCGGGG + Intronic
1104547267 12:129723596-129723618 TCCATGGCTCTGTCCTCACTGGG + Intronic
1104670364 12:130676026-130676048 TTCAAGGCTGTGTCCTCACGCGG - Intronic
1113580143 13:111422774-111422796 CCCAAGGCTCTGTCATCACGAGG + Intergenic
1115332938 14:32217609-32217631 TCCAACGACCCTCCCTCACGTGG + Intergenic
1119415346 14:74465961-74465983 TCCAAGGATCTCTCCACAAGAGG + Intergenic
1119600260 14:75971188-75971210 GGCAAGAATCTGCCCACACGGGG - Exonic
1119704241 14:76774128-76774150 TCCCAGGACCTGCCCTCAGATGG - Intronic
1119898083 14:78237845-78237867 TCCTATGACCTGCCCTCACCAGG - Intergenic
1121525634 14:94617129-94617151 TCCATGGCACTGCCCTCACATGG + Intronic
1121563628 14:94892894-94892916 TCCAGAGATCTGCTCTCAAGGGG + Intergenic
1122770791 14:104096787-104096809 TCCCTGGCTCAGCCCTCACGTGG - Intronic
1130047491 15:80456988-80457010 TCCAAGGAGCTCCACTCACGTGG + Intronic
1135392141 16:22102818-22102840 TCCACAGACCTGCCCTCACCGGG + Intronic
1136276264 16:29180973-29180995 TGCAAACATGTGCCCTCACGTGG + Intergenic
1136392062 16:29971639-29971661 TCCAAGGATCTGCTCTACCCCGG - Intronic
1141961661 16:87413135-87413157 TCCGAGGAACTGCCTTCCCGGGG + Exonic
1142080645 16:88147032-88147054 TGCAAACATGTGCCCTCACGTGG + Intergenic
1144836455 17:18158953-18158975 TCCAAGGTTCTGGACTCCCGAGG - Exonic
1147367816 17:39970851-39970873 CGCAGGGATCTGCCCTCACTGGG - Intronic
1148543756 17:48501285-48501307 TCCAACTATCTGTCCTCAAGGGG + Intergenic
1151235222 17:72715077-72715099 TCCCAGGGTCTGCACTCAGGAGG + Intronic
1152717481 17:81906938-81906960 TCCCAGGTGCTGCCCTCACCAGG + Intronic
1156349943 18:36295492-36295514 TTCAAGGCTCTGCCCCCACCTGG - Intergenic
1157421019 18:47547560-47547582 CCCAAGGAGCTGCCCTTAGGAGG - Intergenic
1160936365 19:1597648-1597670 TCCAAGCCAGTGCCCTCACGTGG - Exonic
1162894713 19:13758197-13758219 TCCAAGGCTCCTCCCTCACCCGG + Intronic
925273296 2:2630686-2630708 GCCAAGGAGATGCCCTCACCAGG + Intergenic
926059644 2:9797227-9797249 TCCCAGGGTCTGCCCTCCTGAGG + Intergenic
926707034 2:15844222-15844244 TCCAGGTCTCTGCCCTCAGGTGG + Intergenic
930036132 2:47086288-47086310 GCTAAGGGGCTGCCCTCACGTGG - Intronic
931226599 2:60337197-60337219 TCCAGGAAGCTGCCCTCTCGTGG - Intergenic
933747293 2:85580440-85580462 TCCCAGGGTCTGCCCTCCCAAGG + Intronic
933902828 2:86861777-86861799 CCCAAGGGTCTGCGCTCCCGGGG - Intronic
935147097 2:100403216-100403238 TCACAGGCTCTGCCCTCAAGCGG + Intronic
937896007 2:126977165-126977187 TCCCAGGCTCTGCAGTCACGTGG + Intergenic
947823666 2:233089884-233089906 TGCAAGGAGCTCCCCTCAAGTGG + Intronic
948331521 2:237170608-237170630 TCCAACCATCTGCCCACAGGTGG + Intergenic
948540822 2:238690454-238690476 TCCCAGGCTCTGCCCTCAGTGGG - Intergenic
948591084 2:239050606-239050628 TCCAAGAATCTGCACTCATTTGG + Exonic
1174222680 20:48969803-48969825 GCCAAGGAACTGCTCTCAAGTGG - Intronic
1174560797 20:51429300-51429322 TCCAAGGCTCTGCCCACCCCAGG - Intronic
1176026216 20:62986822-62986844 TCCAAGGCTCTGAACTCACAGGG - Intergenic
1176117793 20:63440558-63440580 TCTAAGACTCTGCCCTCACAGGG - Intronic
1182048197 22:27292909-27292931 TCCAATCTTCTGCCCTCAGGAGG - Intergenic
1184535254 22:45082329-45082351 TCCCAGGCTCTGCCCTCCTGGGG - Intergenic
950335381 3:12188876-12188898 TCCAAGGATCTGCCCTCACGCGG - Intronic
954783040 3:53074375-53074397 TCCCAGGATCTGGCCACAGGAGG - Intronic
955879240 3:63526124-63526146 TTGAAGGATCTGCCCCCACAAGG + Intronic
961619684 3:128213665-128213687 TCCACTGGTCTTCCCTCACGTGG - Intronic
967980240 3:195061186-195061208 CCCAAGGCTATGCCCTCACCCGG + Intergenic
971802659 4:31312733-31312755 TCCATGGATCTGGCCTGACCAGG + Intergenic
974081233 4:57215349-57215371 TTCAAGGACCTGCCTTCAAGTGG - Intergenic
985614788 5:913165-913187 TCGCAGGATCTGCTATCACGTGG - Intronic
987388274 5:17351109-17351131 GCCAAGGATCTGCCAACAGGAGG - Intergenic
989618660 5:43363347-43363369 GACATGGCTCTGCCCTCACGGGG + Intergenic
992994363 5:82317999-82318021 TCCAAGGTTTTGCCATCAAGGGG + Exonic
1007515967 6:42411671-42411693 GCCAAGGAGCTGCCCTCACCAGG + Intronic
1010125140 6:72422503-72422525 TCCCAGGATCAGCTCTCACTGGG + Intergenic
1017241160 6:152170667-152170689 TCCTAGCAGCTGCCCTCAGGAGG - Intronic
1032089967 7:128906600-128906622 TCCTAGGATCTCCCCTCTCTGGG - Intronic
1035285191 7:157801451-157801473 TCCATGCAGCTGCTCTCACGGGG - Intronic
1042922555 8:73934026-73934048 TCCAAAGCTCTGCCCTCAATGGG + Intergenic
1049288199 8:141787961-141787983 TCCAAGGAGCTGGGCTCTCGAGG - Intergenic
1056752831 9:89364341-89364363 CCCAAGGCTCTGCCATCACCAGG + Intronic
1186553087 X:10527680-10527702 TCCTAGGAGCAGCCCTCAAGTGG + Intronic
1189543974 X:42022757-42022779 CACAAGGATCTGCCCTGACTTGG + Intergenic
1190427402 X:50346005-50346027 TCCAGGGCTCTGCCCTCTGGAGG - Intronic