ID: 950336103

View in Genome Browser
Species Human (GRCh38)
Location 3:12194735-12194757
Sequence GCTCAGAGAAGACCGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950336098_950336103 25 Left 950336098 3:12194687-12194709 CCACAAGCAGCATATGCTGTTGC No data
Right 950336103 3:12194735-12194757 GCTCAGAGAAGACCGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950336103 Original CRISPR GCTCAGAGAAGACCGCACCC TGG Intergenic
No off target data available for this crispr