ID: 950339229

View in Genome Browser
Species Human (GRCh38)
Location 3:12227842-12227864
Sequence CTGATACCACAGATGAAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950339226_950339229 -9 Left 950339226 3:12227828-12227850 CCTGATCTAAGTCCCTGATACCA No data
Right 950339229 3:12227842-12227864 CTGATACCACAGATGAAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950339229 Original CRISPR CTGATACCACAGATGAAGCC CGG Intergenic
No off target data available for this crispr