ID: 950345524

View in Genome Browser
Species Human (GRCh38)
Location 3:12288466-12288488
Sequence GACCTCCGCGTCCCCGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950345517_950345524 6 Left 950345517 3:12288437-12288459 CCGGGTGGGCGCGGAGCCGGGGA 0: 1
1: 0
2: 2
3: 33
4: 268
Right 950345524 3:12288466-12288488 GACCTCCGCGTCCCCGGCGGAGG 0: 1
1: 0
2: 1
3: 12
4: 110
950345507_950345524 22 Left 950345507 3:12288421-12288443 CCCCCTCGGGAGAGCGCCGGGTG 0: 1
1: 0
2: 0
3: 11
4: 76
Right 950345524 3:12288466-12288488 GACCTCCGCGTCCCCGGCGGAGG 0: 1
1: 0
2: 1
3: 12
4: 110
950345512_950345524 19 Left 950345512 3:12288424-12288446 CCTCGGGAGAGCGCCGGGTGGGC 0: 1
1: 0
2: 3
3: 18
4: 133
Right 950345524 3:12288466-12288488 GACCTCCGCGTCCCCGGCGGAGG 0: 1
1: 0
2: 1
3: 12
4: 110
950345508_950345524 21 Left 950345508 3:12288422-12288444 CCCCTCGGGAGAGCGCCGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 950345524 3:12288466-12288488 GACCTCCGCGTCCCCGGCGGAGG 0: 1
1: 0
2: 1
3: 12
4: 110
950345510_950345524 20 Left 950345510 3:12288423-12288445 CCCTCGGGAGAGCGCCGGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 950345524 3:12288466-12288488 GACCTCCGCGTCCCCGGCGGAGG 0: 1
1: 0
2: 1
3: 12
4: 110
950345521_950345524 -10 Left 950345521 3:12288453-12288475 CCGGGGACACGGGGACCTCCGCG 0: 1
1: 0
2: 0
3: 10
4: 97
Right 950345524 3:12288466-12288488 GACCTCCGCGTCCCCGGCGGAGG 0: 1
1: 0
2: 1
3: 12
4: 110
950345506_950345524 23 Left 950345506 3:12288420-12288442 CCCCCCTCGGGAGAGCGCCGGGT 0: 1
1: 0
2: 1
3: 11
4: 59
Right 950345524 3:12288466-12288488 GACCTCCGCGTCCCCGGCGGAGG 0: 1
1: 0
2: 1
3: 12
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950345524 Original CRISPR GACCTCCGCGTCCCCGGCGG AGG Intronic