ID: 950346640

View in Genome Browser
Species Human (GRCh38)
Location 3:12301055-12301077
Sequence AATGATATGAAACTAATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950346639_950346640 7 Left 950346639 3:12301025-12301047 CCTATTTTATGTATTGTTTTTGT 0: 1
1: 0
2: 9
3: 250
4: 1956
Right 950346640 3:12301055-12301077 AATGATATGAAACTAATGCCAGG 0: 1
1: 0
2: 1
3: 27
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950346640 Original CRISPR AATGATATGAAACTAATGCC AGG Intronic
904361747 1:29979246-29979268 AATTAAATGAAACTTGTGCCAGG - Intergenic
905005721 1:34708664-34708686 AATGATATGAAGCCAATGAAGGG + Intergenic
910544197 1:88395726-88395748 AATGATATAAAACCAATGCCTGG - Intergenic
911479245 1:98416679-98416701 CATGATATGAAACTCATGTTAGG - Intergenic
913416986 1:118619525-118619547 AGTGATATGAAATTAAAACCAGG + Intergenic
914809502 1:151016397-151016419 AAAAATATGAGAATAATGCCTGG + Intronic
916461667 1:165031086-165031108 AATTATATCAAACTGCTGCCTGG - Intergenic
917558725 1:176121482-176121504 AAAGAAATGAAAATAATGTCTGG - Intronic
919338025 1:196265362-196265384 AATTAAATGAACTTAATGCCTGG + Intronic
919684390 1:200469546-200469568 AATGATATAAAATTTATGCTGGG - Intergenic
920264039 1:204708617-204708639 CATGAAAAGAAACTAATACCTGG + Intergenic
923158886 1:231300826-231300848 AATGACAGGAAACTAATACTAGG - Intergenic
923934094 1:238741946-238741968 TATGATTTGAAACTTATGCAGGG - Intergenic
1063982353 10:11464330-11464352 AATGATGTGACACTAATGGCTGG + Intronic
1064864452 10:19863651-19863673 AATGATATGAAATTAAGCCACGG - Intronic
1068601995 10:58966408-58966430 CATGAGAAGAAACTACTGCCAGG - Intergenic
1068619483 10:59164428-59164450 AATAATATGAAACAAAAACCAGG + Intergenic
1071109857 10:82143127-82143149 AATGATATGAACTTAGTGCTAGG + Intronic
1071266182 10:83966919-83966941 AATTAAATGAAATAAATGCCTGG + Intergenic
1074665922 10:115723846-115723868 AATGATATGAAAATCAGGCCAGG - Intronic
1078039462 11:7845292-7845314 AATGATAGGAAACTATTGTAAGG + Intergenic
1078407272 11:11081312-11081334 AATTCAATGAAACAAATGCCTGG + Intergenic
1078486970 11:11732210-11732232 TATGATATCAAAGTGATGCCTGG - Intergenic
1079416317 11:20239317-20239339 AGTGATATGAAGTTAAAGCCAGG + Intergenic
1079973675 11:27066255-27066277 AATGTTATAAAACTTATTCCTGG - Intronic
1083734618 11:64672287-64672309 CAGGATATGAAACTAAGTCCTGG + Intronic
1083970955 11:66074904-66074926 AATAAAATTAAACTAATGCATGG - Intronic
1085356297 11:75840788-75840810 AATGCTTTAAAACTAGTGCCTGG - Intronic
1085819742 11:79779766-79779788 AAGGATATGAAACAAATGACAGG - Intergenic
1086331010 11:85754276-85754298 AATGATATGAAGAGAATTCCAGG - Intronic
1086338049 11:85819104-85819126 ATTGATATGAAAATTATGACAGG - Intergenic
1086353052 11:85962755-85962777 GATGATAAGAAACTTATTCCAGG - Intronic
1087691170 11:101321680-101321702 AATGATATGAAGTTAATACCAGG + Intergenic
1088068966 11:105757423-105757445 ATTGATATGAAACTAAAACAAGG + Intronic
1088967511 11:114738531-114738553 AATTATGTGAAACTCAGGCCTGG + Intergenic
1089248260 11:117138018-117138040 AATGCTATGAAACCACTGCTGGG - Intergenic
1089258451 11:117206543-117206565 AATGCTATGAAACCACTGCTGGG + Intronic
1090075673 11:123578751-123578773 AAAGGAATGAAACTAACGCCAGG - Intronic
1091094033 11:132801486-132801508 AATGAGATGGAACCAATTCCAGG + Intronic
1092503331 12:9069221-9069243 AATTTTATGAAACTTAAGCCTGG - Intronic
1092686439 12:11053450-11053472 GATGATATTAAACTAATCCAAGG - Intronic
1092692094 12:11124485-11124507 GATGATATTAAACTAATCCAAGG - Intronic
1094816159 12:34186902-34186924 AGTGATATGAAGTTAATACCAGG + Intergenic
1095150035 12:38783335-38783357 GATGATATGAAGTTAAAGCCAGG - Intronic
1095620323 12:44246724-44246746 AATGGAATGGAAATAATGCCTGG + Intronic
1095647686 12:44567724-44567746 AATGATATGAGGTGAATGCCAGG - Intronic
1098046573 12:66407402-66407424 AATGATATGAAGTTAAAACCAGG - Intronic
1098768676 12:74523795-74523817 AATGTTTTTAAACTCATGCCAGG + Intergenic
1099218920 12:79889079-79889101 ACTAATATGAAACAAATTCCTGG + Intronic
1100748487 12:97671556-97671578 AGTGAGATGAAACTAATGAGAGG - Intergenic
1101032890 12:100677440-100677462 AATGATGTGTACCAAATGCCAGG - Intergenic
1102284375 12:111643701-111643723 AATGATATGACACTATTGCTAGG + Exonic
1102788831 12:115626565-115626587 AAACATATGAAACTAATTCCAGG - Intergenic
1105375330 13:19839340-19839362 CATGACATAAAAGTAATGCCTGG + Intronic
1105453391 13:20520011-20520033 ATTGTTCTGAAACAAATGCCAGG - Intronic
1106148225 13:27070955-27070977 GATGATATGAGACAAATGTCTGG - Intronic
1106216521 13:27706725-27706747 AATGACATGCAAATAATGACTGG - Intergenic
1107714858 13:43190036-43190058 CAGGATAGAAAACTAATGCCTGG - Intergenic
1109244982 13:59943263-59943285 ATAGATATGTAACTAAGGCCTGG + Intronic
1110069611 13:71157692-71157714 TATGATGTGCATCTAATGCCTGG + Intergenic
1111279983 13:86009945-86009967 AGTCATGTGAAACTACTGCCTGG - Intergenic
1111389556 13:87575099-87575121 TATTATATGAAACTAAGACCTGG + Intergenic
1111480781 13:88823142-88823164 AATTTTATGGAAATAATGCCCGG - Intergenic
1111522205 13:89420431-89420453 AATCATATAAAACAAATTCCTGG + Intergenic
1111861901 13:93718220-93718242 AATGATATTACACTAATGGTGGG - Intronic
1111961447 13:94815054-94815076 AATTATATGAAACTAAATCCAGG + Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1112126754 13:96476785-96476807 AATGATGGGAAACCAATTCCTGG + Intronic
1114957975 14:27847196-27847218 AATGACATGAAACAAACGACCGG - Intergenic
1115458075 14:33628562-33628584 GATGATATGCAACTAATGGACGG - Intronic
1115514666 14:34173582-34173604 AATGAAATGAAAAAAATCCCTGG - Intronic
1116638690 14:47432905-47432927 AATGAAATTATATTAATGCCTGG - Intronic
1116690012 14:48093780-48093802 AATGAAATGATATTAATCCCTGG + Intergenic
1118599454 14:67461590-67461612 AAGGATATGAAACGTAAGCCAGG + Intronic
1118668481 14:68096832-68096854 ATAGATAAGAAAATAATGCCAGG - Intronic
1120465541 14:84852601-84852623 AATGATGTGATACAAAAGCCAGG + Intergenic
1120786244 14:88539724-88539746 GATGCTATACAACTAATGCCTGG - Intronic
1124180506 15:27468587-27468609 CATGATGTGAAACTACTGCCTGG + Intronic
1124715464 15:32056543-32056565 TATGATATGAAAATAATGTATGG + Intronic
1126326198 15:47480151-47480173 AATGATAAGAAAATAGGGCCAGG - Intronic
1127178159 15:56383330-56383352 AATGATATGAAGTTAAAACCAGG + Intronic
1127860669 15:62991429-62991451 AATGATATAAAAATAATCCATGG - Intergenic
1129303197 15:74638627-74638649 AAGGATCTGAAACTTAGGCCAGG - Intronic
1132064324 15:98718172-98718194 AATGAGATGAAACAGAAGCCCGG - Intronic
1133960480 16:10488410-10488432 AAGGGTATGAAAGTAAAGCCGGG + Intergenic
1134324600 16:13195654-13195676 ATTGATGTTAAACTATTGCCTGG - Intronic
1138099226 16:54238852-54238874 ACTGCTATGAAAATATTGCCAGG - Intergenic
1138890859 16:61142598-61142620 AATGATATGAAGTTAAAGCCAGG + Intergenic
1140964538 16:79952184-79952206 TAGGATATGTAACTATTGCCAGG - Intergenic
1141224670 16:82103730-82103752 AATAATTTGCAACAAATGCCTGG - Intergenic
1141397608 16:83718789-83718811 AATCATGTGAAACTACTGCCTGG + Intronic
1142894935 17:2968511-2968533 AATGAAAGGAAACTAATTGCTGG + Intronic
1144041618 17:11416190-11416212 AATGCTATGAACTCAATGCCTGG - Intronic
1144100853 17:11941074-11941096 AATGATTTGAATCTCAAGCCTGG - Intronic
1145853873 17:28133494-28133516 AATAATGTTAAAATAATGCCTGG + Intronic
1146732812 17:35210002-35210024 AATTATATGATAATAATGTCTGG - Intergenic
1147932617 17:43992283-43992305 AATAATAGGAAACTGAGGCCAGG + Intronic
1149239737 17:54635318-54635340 AGTGATATGAAGCTAAAACCAGG - Intergenic
1149355343 17:55833817-55833839 AAGGATATGAAACTAAGGAACGG - Intronic
1149803226 17:59590009-59590031 AATGAAAGGAAATTAACGCCGGG - Intronic
1149843262 17:59985480-59985502 AATGAAAGGAAATTAACGCCGGG + Intergenic
1150503345 17:65672933-65672955 AATGATAAAAAACTAATACAGGG - Intronic
1151431012 17:74063249-74063271 AAAGCTCTGAAACGAATGCCTGG + Intergenic
1153439526 18:5101232-5101254 AGTCATATGAAACTACTGCCTGG + Intergenic
1154339281 18:13489660-13489682 AGTTATATGAAACTGTTGCCTGG + Intronic
1156089260 18:33445107-33445129 AATCAGATGAAACCAACGCCAGG + Intergenic
1157699483 18:49751887-49751909 AATGAAATGTAACCAAAGCCTGG + Intergenic
1159151359 18:64527740-64527762 AATGGTATGAAACTAAGGAGTGG - Intergenic
1160235731 18:77085173-77085195 AATTATATGAAACTAAAGGAAGG - Intronic
1160459855 18:79030723-79030745 TGTGATGTGAAAATAATGCCTGG + Intergenic
1161748827 19:6079070-6079092 AATGATATGCAAGTAATGGCCGG - Intronic
1164821617 19:31255466-31255488 AGTGATTTGAAAATAAGGCCGGG - Intergenic
1165143607 19:33717801-33717823 TGTCATATGAAACTACTGCCTGG + Intronic
1165807811 19:38592277-38592299 AATGAAATAAAATTAAGGCCAGG + Intronic
924965523 2:73117-73139 AATAACACCAAACTAATGCCTGG + Intergenic
926042468 2:9684607-9684629 AATGAATTGAAAATAATGCCAGG - Intergenic
926451791 2:13012905-13012927 AATGATCAGAAACTAATATCCGG - Intergenic
928282620 2:29962230-29962252 CATGATCTGAAACTAATGGGAGG + Intergenic
929362536 2:41111129-41111151 AATGATTTGAAATTCAAGCCTGG + Intergenic
930261445 2:49151533-49151555 AATGAAATGAAACTGCTGCAAGG + Intronic
931582877 2:63796425-63796447 AATGATATGAAGTTAAAGCCAGG - Intronic
932512538 2:72308602-72308624 AAAGAAATGACAATAATGCCAGG - Intronic
932729098 2:74205201-74205223 AATGATTTGAAATACATGCCTGG + Intronic
933446490 2:82386881-82386903 AATGATATGAAGTTAAAACCAGG - Intergenic
936573166 2:113633204-113633226 AATGGTTTGGATCTAATGCCTGG + Intronic
939518203 2:143195946-143195968 AAGGATATGAAACTGATGGGTGG - Intronic
939930900 2:148231482-148231504 AGTGATATGAAGTTAAAGCCAGG + Intronic
941376382 2:164736141-164736163 ACAGATATGAAACTAATCCAGGG - Intronic
942030018 2:171950110-171950132 AATGATGTTAAAATAATGCATGG - Intronic
942566401 2:177268457-177268479 AATAAAATGAAACTTATGCATGG - Intronic
943115378 2:183663309-183663331 AATGATACTAAAATAATGTCTGG + Intergenic
944148326 2:196530304-196530326 AATGTTATGAAGCTCAGGCCTGG + Intronic
944661289 2:201923876-201923898 AATGATGTGGAATGAATGCCCGG - Intergenic
944993102 2:205260621-205260643 AATTATATGAAAGTGATCCCAGG - Intronic
945819653 2:214648303-214648325 AATGACATGAAACTTATGAAAGG + Intergenic
946084799 2:217159837-217159859 AATGATATGAGTCTAGGGCCGGG - Intergenic
948309327 2:236973208-236973230 AATGCTATGAAAATAAAGCCAGG - Intergenic
1170089637 20:12576422-12576444 ATTTATATGAAACTATTGCTTGG + Intergenic
1170721832 20:18888149-18888171 ATTCATATTAATCTAATGCCTGG - Intergenic
1171302504 20:24075966-24075988 AACAATAGGAAACTAATACCTGG + Intergenic
1171898048 20:30829058-30829080 AGTGATATGAAGTTAATACCAGG - Intergenic
1173674988 20:44825734-44825756 AATGATGGGAAATTAAGGCCTGG + Intergenic
1175773386 20:61637723-61637745 AATGACATGAAAATATGGCCGGG + Intronic
1177212749 21:18090910-18090932 AATGATATGAAGTTAAAACCAGG - Intronic
1180323773 22:11348813-11348835 AGTGATATGAAGTTAATACCAGG + Intergenic
1181511473 22:23391075-23391097 AATGTTATCAAAGAAATGCCAGG + Intergenic
1184076654 22:42183707-42183729 AATGATAGAAAACTAATACACGG + Intronic
1185427019 22:50777676-50777698 AATGGTTTGGATCTAATGCCTGG - Intronic
950346640 3:12301055-12301077 AATGATATGAAACTAATGCCAGG + Intronic
950374924 3:12563442-12563464 AATGGTATGCAAGGAATGCCAGG - Intronic
951203806 3:19904209-19904231 AACCACATGAAACTAATGCATGG - Intronic
952598549 3:35049450-35049472 AACCATTTGAAACTAATGACAGG + Intergenic
953261206 3:41340780-41340802 AATGATGTGAAAATAAGCCCAGG + Intronic
953400684 3:42612802-42612824 AACGATATGATTCTACTGCCTGG + Intronic
955624707 3:60905682-60905704 AATTATATGAAATAATTGCCAGG + Intronic
955820407 3:62890544-62890566 AATGAAATAAAACTGAAGCCAGG + Intergenic
956752151 3:72351908-72351930 TATGATAAGAAAATAACGCCAGG - Intergenic
958944501 3:100348488-100348510 AGTCATATGAAACTGCTGCCTGG + Intronic
960785130 3:121363687-121363709 AATGATATGAAGTTAAAACCAGG + Intronic
964754272 3:160079959-160079981 AATGATAGGAAACTAATACTAGG - Intergenic
964785206 3:160389087-160389109 AATAATATGAAATTAATACATGG + Intronic
966753387 3:183344212-183344234 AGTGGTATGAAATTAATCCCAGG + Intronic
972207678 4:36797908-36797930 AGTGATATGAAATTAACACCAGG - Intergenic
974309530 4:60187219-60187241 AATGATATGAAGTTAAAACCAGG - Intergenic
974772556 4:66434687-66434709 AATGATATGAAATGAAATCCAGG - Intergenic
975369617 4:73569172-73569194 AGTGATATGAAATTAAAACCAGG + Intergenic
975514345 4:75229339-75229361 AATGATTAGAAAATATTGCCTGG - Intergenic
978432505 4:108647698-108647720 AATTATATGCAAGTAATGGCTGG - Intergenic
978943201 4:114462099-114462121 AATGCTTTGAAACAATTGCCTGG - Intergenic
980021089 4:127711181-127711203 AATGAAATGAAAACAATGCTGGG - Intronic
980106633 4:128594537-128594559 AAGAATATGAAACAAATGCCAGG - Intergenic
981558651 4:146023338-146023360 AATGTCCTGAAACTAAGGCCTGG + Intergenic
981652841 4:147078649-147078671 AATGATATGAAAGTGATGTAAGG - Intergenic
981995414 4:150968818-150968840 ACAGATATGAAATCAATGCCTGG + Intronic
982698332 4:158630041-158630063 AATGTTATGAAAATAACACCAGG + Intronic
983786439 4:171736605-171736627 AATGACAATAAACAAATGCCAGG + Intergenic
984268201 4:177519686-177519708 AATCATATGAAACTGCTGCCTGG - Intergenic
984728437 4:183043210-183043232 AATAATATGTAACTGAGGCCAGG - Intergenic
985066363 4:186126120-186126142 AGTGATATGATACTAATGAAAGG - Intronic
985321163 4:188712823-188712845 AATGAAGTGCAACAAATGCCAGG - Intergenic
986505997 5:8451870-8451892 AATGGTATGAAAGAAATGCTGGG + Intergenic
987484920 5:18513475-18513497 AGTGATACAAAACTCATGCCTGG - Intergenic
987760583 5:22157663-22157685 TATGATATGCTAATAATGCCTGG + Intronic
987803048 5:22722527-22722549 AATGATATAAATCTCATGTCAGG + Intronic
988320119 5:29684336-29684358 AATGATATGTAAGCAATGTCTGG - Intergenic
990202987 5:53398441-53398463 AATGATATGAAGTTAAAACCAGG + Intergenic
990419202 5:55615141-55615163 AAGGCTATCAAACTAATGCAAGG + Intergenic
990864969 5:60369995-60370017 AAAAAAATGAAACTAATGCTAGG - Intronic
991895358 5:71391112-71391134 TATGATATGCTAATAATGCCTGG + Intergenic
994350494 5:98739867-98739889 ATAAACATGAAACTAATGCCAGG + Intergenic
995614895 5:113950999-113951021 AATGATATGAAACTAAATGTTGG - Intergenic
996244541 5:121245109-121245131 ACTGATGTGAGAATAATGCCTGG - Intergenic
996280056 5:121719530-121719552 AATCATGTGAAACTACTGCCTGG - Intergenic
996594370 5:125184620-125184642 AATGATATGAAGTTAAAACCAGG - Intergenic
997082456 5:130756299-130756321 AATAATAATAAAATAATGCCAGG - Intergenic
997900281 5:137757078-137757100 AATTATATGAATCCTATGCCTGG + Intergenic
998115164 5:139531659-139531681 AAAGAAAAGAAAATAATGCCTGG + Intronic
999561381 5:152807299-152807321 AATGATATCAAACTAGAGTCAGG - Intergenic
1001366130 5:171142065-171142087 AAAGATTTGAAACTAATGATAGG - Intronic
1002835026 6:858633-858655 AATAAAATGAAACTAACGACAGG - Intergenic
1004440926 6:15652916-15652938 AAGAATATGAAAATAAGGCCTGG - Intronic
1005208629 6:23433609-23433631 AAGGATATGAATTTAATGCATGG - Intergenic
1007468209 6:42070190-42070212 AATGAAATAAAACTAAAGGCCGG + Intronic
1008304650 6:49886580-49886602 AGTGATATGAAATTAAAACCAGG + Intergenic
1009744691 6:67797968-67797990 AGTGATATGAAATTAAAACCAGG - Intergenic
1011805522 6:91068853-91068875 AATAATATAAAAATAAGGCCAGG + Intergenic
1011823720 6:91282051-91282073 ATTGCTATGAAATTAATTCCAGG + Intergenic
1012091340 6:94902075-94902097 AGTGATATGAAATTAAAACCAGG - Intergenic
1012288535 6:97422692-97422714 AATGATATGAAGTTAAAACCAGG + Intergenic
1012310621 6:97719940-97719962 AATGGTATGTAAACAATGCCTGG + Intergenic
1013008933 6:106102571-106102593 ACTGATATGAAACTTATGATTGG - Intronic
1014372064 6:120622294-120622316 AGTGAGATGAAAATTATGCCAGG + Intergenic
1014382301 6:120757727-120757749 AATCAGATGAAACTACTGTCTGG - Intergenic
1015578958 6:134702610-134702632 AATGATATGAAGTTAAAACCAGG + Intergenic
1015588905 6:134803959-134803981 AATGATATGAAGCTTATTCAGGG + Intergenic
1016309125 6:142714419-142714441 AATGAGATGATAATAATTCCAGG + Intergenic
1016580539 6:145624756-145624778 AATGATAAGAAAGTAATGAAAGG - Intronic
1016887356 6:148970599-148970621 AAGGCTAGGAAACGAATGCCAGG + Intronic
1017961653 6:159227829-159227851 AATATTATGAGACTAATGCATGG - Intronic
1019816746 7:3206567-3206589 AATGAGATGAAACGTAGGCCTGG - Intergenic
1021380914 7:19965201-19965223 AATGATATGTAACTAAATACTGG + Intergenic
1022080077 7:27011864-27011886 AATGATATGAAGTTAAAACCAGG - Intergenic
1023599017 7:41863171-41863193 AATGATATAAAAGTAAAACCAGG - Intergenic
1023952798 7:44860217-44860239 AATGATAAGAAACTTCGGCCAGG - Intergenic
1024155094 7:46614053-46614075 AGTGAAATGGAACTAATGCTTGG + Intergenic
1024599853 7:50970725-50970747 AATTATATAAAAATAAGGCCTGG + Intergenic
1028092178 7:86716555-86716577 AATGAAAGGAACCTGATGCCAGG + Intronic
1030025173 7:105316665-105316687 AAAGATAAGAAACTAATGCAAGG + Intronic
1030509435 7:110466774-110466796 AATCATATAAAACTAATTCTAGG + Intergenic
1035896065 8:3403773-3403795 AAAGATATGATACTAATGATAGG - Intronic
1035969671 8:4233929-4233951 AATGAGGTGAGACTAATGCATGG + Intronic
1036800242 8:11785749-11785771 GATGAAATGAAACTCATGCATGG - Intronic
1037418045 8:18672395-18672417 AATGACAGGGAACAAATGCCAGG - Intronic
1038098424 8:24342793-24342815 AATGAGATGATCTTAATGCCAGG - Intronic
1038599272 8:28922663-28922685 AATAACATAAAATTAATGCCTGG - Intronic
1038985227 8:32801672-32801694 AATGATATAAAACTGATTACAGG + Intergenic
1040357860 8:46637101-46637123 AATGATATGACTCTCTTGCCTGG + Intergenic
1040359266 8:46649718-46649740 AATGATATGACTCTCTTGCCTGG + Intergenic
1040371329 8:46778760-46778782 AATGATATGACTTTCATGCCTGG + Intergenic
1040379792 8:46861341-46861363 AATGATATGACTCTCTTGCCTGG + Intergenic
1040808209 8:51419206-51419228 AATTGTATGAAAATAATGCTAGG - Intronic
1041149458 8:54916236-54916258 AATGATGTGGAGCTAATGCTGGG - Intergenic
1041744904 8:61198009-61198031 CATGATATGAAGTTAAAGCCAGG + Intronic
1041787686 8:61653465-61653487 AATGATGTGAAACAAATTCCAGG + Intronic
1041846936 8:62340215-62340237 AATGATATAAACCTAAGGCAGGG + Intronic
1043014163 8:74917651-74917673 AATTAAATGAAAATAATGACTGG - Intergenic
1043144765 8:76639324-76639346 AGTGATATGAAATTAAAACCTGG - Intergenic
1043690392 8:83143712-83143734 AATAAAATAAAACTAATGCTAGG + Intergenic
1044773799 8:95666442-95666464 AATGATATAAAAGTAGTTCCAGG - Intergenic
1044798624 8:95930368-95930390 AATCATATGATACCAAAGCCTGG - Intergenic
1045371360 8:101527044-101527066 AATGGTATAAAACTAATGTTGGG - Intronic
1047933511 8:129752697-129752719 AATGATATGAAGTTAAAACCAGG - Exonic
1048670613 8:136715094-136715116 AATGAAATGAAGCTCATCCCTGG - Intergenic
1050145076 9:2559234-2559256 AATGATATGAAGTTCAAGCCAGG - Intergenic
1050715189 9:8516423-8516445 AATGGTATGAAAATAAAGGCAGG + Intronic
1050859632 9:10410937-10410959 ATTGATAAGGAACTGATGCCTGG - Intronic
1051485910 9:17607819-17607841 AATGAAATGAAAATAATGAATGG + Intronic
1052453178 9:28659306-28659328 AATTAAAGGAAATTAATGCCTGG + Intronic
1052710397 9:32048687-32048709 AGTGTCATGAAAATAATGCCAGG - Intergenic
1053750619 9:41250853-41250875 AGTGATATGAAGTTAATACCAGG - Intergenic
1054256127 9:62815196-62815218 AGTGATATGAAGTTAATACCAGG - Intergenic
1054893828 9:70284415-70284437 AAGGATATGAAACTAATAATTGG + Intronic
1055291674 9:74788215-74788237 GATAATATGAAAATAATGCTAGG + Intronic
1055795069 9:79967276-79967298 GATCTTATAAAACTAATGCCAGG - Intergenic
1056180228 9:84075865-84075887 AATGATATGAAGTTAAAGACAGG - Intergenic
1058468282 9:105250789-105250811 AATGTTATGGAAGTGATGCCTGG + Intronic
1058568699 9:106316208-106316230 ATTGATGTGAAAGTAATGTCTGG - Intergenic
1059156425 9:111992763-111992785 AAAAATATGAAACTTTTGCCAGG + Intergenic
1059233799 9:112745248-112745270 TATGAAATGAAACTATTGGCCGG + Intergenic
1061691383 9:132334763-132334785 AATAATACTATACTAATGCCTGG + Intronic
1203371447 Un_KI270442v1:309387-309409 AGTGATATGAAGTTAATACCAGG + Intergenic
1187015649 X:15325774-15325796 ATTGATATAAATCTAATGCAAGG - Intronic
1187262195 X:17695989-17696011 AATGATCTTAAACTAATCTCTGG - Intronic
1187687257 X:21828100-21828122 AAAGAAATCAAACTAAAGCCAGG + Intergenic
1188916159 X:35913540-35913562 AACGTGATGAGACTAATGCCTGG - Intergenic
1188932179 X:36124706-36124728 AGTGATATGAATTTAAAGCCAGG + Intronic
1188968823 X:36587845-36587867 AATGGTATGAACCTAATTCCAGG - Intergenic
1189869896 X:45370776-45370798 AGTGATATGAAGTTAAAGCCAGG - Intergenic
1189901058 X:45706569-45706591 AAGGATATGAAAATAAAGCAAGG - Intergenic
1192694342 X:73398844-73398866 AGTGATATGAAGTTAAAGCCAGG - Intergenic
1193052560 X:77116396-77116418 AATGATATGAAGTTAAAACCAGG + Intergenic
1193282805 X:79673996-79674018 AGTGATATGAAGCTAAAACCAGG + Intergenic
1193907467 X:87260773-87260795 AACGATATGAATTTAATACCAGG - Intergenic
1194348160 X:92792731-92792753 AGTGATATGAAAATAAAACCAGG - Intergenic
1196232597 X:113240982-113241004 AAGGATATGAAGTTAATACCAGG + Intergenic
1196235665 X:113276758-113276780 AATAATAGGAAACTAATACTAGG - Intergenic
1196539073 X:116883516-116883538 AGTGATATGAAATTAAAACCAGG + Intergenic
1196590686 X:117483073-117483095 AGTGATATGAAGTTAAAGCCAGG - Intergenic
1196609426 X:117694944-117694966 AGTGATATGAAATTAAAACCAGG - Intergenic
1196865222 X:120065257-120065279 AGTGATATGAAATTAAAACCAGG - Intergenic
1197078312 X:122379197-122379219 AGTGATATGAAATTAATACCAGG + Intergenic
1197220647 X:123910431-123910453 TATCATGTGAAACTAATGCTGGG - Exonic
1197259470 X:124302351-124302373 AATTATATGAAAATAAAGCTGGG - Intronic
1197294940 X:124707431-124707453 AATCATGTGAAACTGCTGCCTGG - Intronic
1197882620 X:131183362-131183384 AATAATATGAAATTAATACATGG - Intergenic
1198697378 X:139355900-139355922 AAAGATATGAAGATAAAGCCAGG + Intergenic
1198870214 X:141171115-141171137 AAAGATATAAAACTGTTGCCGGG - Intergenic
1199017832 X:142839877-142839899 AAAGAGATAAAAATAATGCCTGG - Intergenic
1199081349 X:143579875-143579897 AGTGATATGAAGCTAAAACCAGG + Intergenic
1199263210 X:145799849-145799871 AATGATATAAAACTAACACAAGG + Intergenic
1199439782 X:147855021-147855043 AGTGATATGAAGTTAAAGCCAGG + Intergenic
1199542743 X:148975647-148975669 AAAAATATGAAAGTAAGGCCGGG + Intronic
1200098644 X:153676566-153676588 AAGGAGATTAAACTTATGCCGGG + Intronic
1200268004 X:154656209-154656231 AATGAAATGAAACGGATGCACGG + Intergenic
1200559962 Y:4690003-4690025 AATGATATGAAGTTAAAACCAGG - Intergenic
1200656490 Y:5909360-5909382 AGTGATATGAAAATAAAACCAGG - Intergenic
1200849785 Y:7871169-7871191 AATGTTATGACACTCTTGCCTGG - Intergenic
1200855344 Y:7931992-7932014 AATGATATGACCCTCTTGCCTGG - Intergenic
1200856311 Y:7942275-7942297 AATGATATGACTCTCTTGCCTGG - Intergenic
1200890067 Y:8313776-8313798 AATTATATGAATCTCTTGCCTGG + Intergenic
1200892301 Y:8336961-8336983 AATGATATGACTCTTCTGCCTGG + Intergenic
1200896755 Y:8383969-8383991 AATGATATGAAATTTTTGCCTGG - Intergenic
1200906890 Y:8492846-8492868 AATGATATGACCCTTGTGCCTGG + Intergenic
1200939041 Y:8763493-8763515 CATGACATGAAACTACTGCTTGG + Intergenic
1201760964 Y:17537637-17537659 AGTGATATGAAGTTAATACCAGG + Intergenic
1201840588 Y:18368353-18368375 AGTGATATGAAGTTAATACCAGG - Intergenic
1202260719 Y:22967477-22967499 AATGATATGACTCTCTTGCCTGG + Intergenic
1202263026 Y:22989606-22989628 AATGATATGACTCTCTTGCCTGG + Intronic
1202264024 Y:22999269-22999291 AATGATATGACACTCTTGCCTGG + Intronic
1202268215 Y:23043299-23043321 AATGATATAAATCTCTTGCCTGG + Intergenic
1202413706 Y:24601218-24601240 AATGATATGACTCTCTTGCCTGG + Intergenic
1202416016 Y:24623347-24623369 AATGATATGACTCTCTTGCCTGG + Intronic
1202417015 Y:24633011-24633033 AATGATATGACACTCTTGCCTGG + Intronic
1202421207 Y:24677043-24677065 AATGATATAAATCTCTTGCCTGG + Intergenic
1202449579 Y:24993039-24993061 AATGATATAAATCTCTTGCCTGG - Intergenic
1202453772 Y:25037075-25037097 AATGATATGACACTCTTGCCTGG - Intronic
1202454771 Y:25046739-25046761 AATGATATGACTCTCTTGCCTGG - Intronic
1202457079 Y:25068868-25068890 AATGATATGACTCTCTTGCCTGG - Intergenic