ID: 950348157

View in Genome Browser
Species Human (GRCh38)
Location 3:12318684-12318706
Sequence CAGACTGTAGAGCTCATAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950348157_950348158 -6 Left 950348157 3:12318684-12318706 CCAATTATGAGCTCTACAGTCTG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 950348158 3:12318701-12318723 AGTCTGAGTTATAGTATTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 140
950348157_950348159 2 Left 950348157 3:12318684-12318706 CCAATTATGAGCTCTACAGTCTG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 950348159 3:12318709-12318731 TTATAGTATTCTTGGTTCTTTGG 0: 1
1: 0
2: 2
3: 30
4: 331
950348157_950348160 3 Left 950348157 3:12318684-12318706 CCAATTATGAGCTCTACAGTCTG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 950348160 3:12318710-12318732 TATAGTATTCTTGGTTCTTTGGG 0: 1
1: 0
2: 0
3: 15
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950348157 Original CRISPR CAGACTGTAGAGCTCATAAT TGG (reversed) Intronic
901923715 1:12553073-12553095 CACATTGAAGAGCACATAATGGG - Intergenic
904105779 1:28081517-28081539 CAGACTTTAGAGAACATTATAGG - Intronic
905392828 1:37648934-37648956 CTGACTGTGGAGCCCATAACTGG + Intergenic
907313206 1:53551684-53551706 TAGACTACAGAGCTCACAATTGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907951451 1:59187708-59187730 CACACTGTACTGCTCACAATAGG - Intergenic
912277493 1:108274301-108274323 AAGACTGTAAAGCTCTTTATTGG + Intergenic
912290735 1:108420057-108420079 AAGACTGTAAAGCTCTTTATTGG - Intronic
916642274 1:166743206-166743228 GTGATTGAAGAGCTCATAATAGG + Intergenic
917777000 1:178348654-178348676 CAAACTGGAGCGCTTATAATAGG - Intronic
919362701 1:196614658-196614680 AATACTGTATAGCTCATAAATGG - Intergenic
922216914 1:223527145-223527167 CAGACTGCACAGGACATAATTGG + Intergenic
1066141677 10:32509643-32509665 CAAACTGTACATCTGATAATGGG + Intronic
1073228108 10:101941708-101941730 TAGACTGTAGAGCTCTAACTTGG - Intronic
1078841461 11:15079440-15079462 CAGAATGTAGAACTCTTTATTGG - Intronic
1078858491 11:15226027-15226049 CAGCATGTAAAGCTCATAATGGG - Intronic
1078866417 11:15302250-15302272 CAAACTGTAGAACGAATAATAGG + Intergenic
1079581788 11:22074132-22074154 CAAACTGTACATCTGATAATCGG + Intergenic
1086452753 11:86933281-86933303 CAGACTCTAGAGAACATAAATGG - Intronic
1093021760 12:14210430-14210452 CCAACTCTAGAGCTCCTAATAGG - Intergenic
1093226426 12:16489418-16489440 TAGTATGCAGAGCTCATAATGGG + Intronic
1094605250 12:31943907-31943929 CAGGCTGGGGAGCTTATAATGGG + Intergenic
1096853471 12:54459571-54459593 CAGACTTTAGAGGTCATGCTGGG - Intronic
1099474656 12:83093806-83093828 AAGAATGTATGGCTCATAATTGG - Intronic
1100453759 12:94732210-94732232 CAGACAGGAGAGCTCAAAATGGG + Intergenic
1103099342 12:118159054-118159076 CAGAATGGAGAGGTCATAAAGGG - Intronic
1104335942 12:127895430-127895452 AAGACTGCAGAGCACATACTTGG - Intergenic
1108863057 13:54886094-54886116 GAGATTGTAGATCACATAATCGG - Intergenic
1112452816 13:99527200-99527222 CAGAGGGTAGAGGGCATAATGGG + Intronic
1115895742 14:38084816-38084838 CAGACTGAAGAGCCCAAATTTGG + Intergenic
1119141057 14:72267585-72267607 CAGAAAGTATAGCTCATGATTGG + Intronic
1120951801 14:90048491-90048513 CAGACTGTGGAGCTCCTTCTAGG - Intergenic
1128346663 15:66857463-66857485 CTGACTGGAGAGTTCATGATAGG - Intergenic
1129956502 15:79641527-79641549 CAGACTTCACAGCTCATAGTAGG + Intergenic
1131080630 15:89531681-89531703 CTGACTCTAGAACTCATACTGGG + Intergenic
1131405146 15:92158324-92158346 AAGACTTTAGAGCTCTTATTGGG - Intronic
1132168493 15:99622135-99622157 AAGACAGTAGAGCCCATATTGGG + Intronic
1133902244 16:9987923-9987945 AAGACTGTACAGCTAATACTTGG + Intronic
1134857129 16:17529473-17529495 CAGAGTGTCAAACTCATAATGGG - Intergenic
1136663922 16:31791794-31791816 CAGACTCTACAGATCATAGTGGG + Intronic
1136708286 16:32209420-32209442 CAGACAGAAGACCACATAATTGG - Intergenic
1136759621 16:32719989-32720011 CAGACAGAAGACCACATAATTGG + Intergenic
1136808483 16:33150397-33150419 CAGACAGAAGACCACATAATTGG - Intergenic
1140632667 16:76872893-76872915 CCCACTGTAGATCTCCTAATAGG - Intergenic
1203061775 16_KI270728v1_random:980297-980319 CAGACAGAAGACCACATAATTGG + Intergenic
1144026682 17:11282923-11282945 TAGAGTGGAGAGCTCAAAATAGG + Intronic
1146430843 17:32792901-32792923 ATGACTCTAAAGCTCATAATTGG - Intronic
1148882999 17:50746022-50746044 AAGACTGTCCAGCTCATAATGGG + Intronic
1155576687 18:27255369-27255391 CTTACTGTAGAGCCCATATTTGG + Intergenic
1156505117 18:37585657-37585679 CAGACTGTGGAGTTTCTAATGGG + Intergenic
1157477838 18:48034819-48034841 CAGCCTGGAGAGCTCATCGTCGG + Intronic
1158941272 18:62407399-62407421 CAGCCTGTAGAGCTCAGAACTGG + Intergenic
1168492111 19:56819610-56819632 AAGGCTGCATAGCTCATAATTGG - Intronic
926891118 2:17639704-17639726 CACAGTGTTGGGCTCATAATAGG - Intronic
928015315 2:27650731-27650753 CACACTGTATAGCTCATTATAGG + Exonic
928849884 2:35733274-35733296 CAGAATGTAAAGGTCACAATGGG + Intergenic
928990326 2:37226289-37226311 CAGACTGGAGAGCTGTTAAGAGG + Intronic
935122111 2:100192096-100192118 CAGACAACAGAACTCATAATGGG + Intergenic
938171516 2:129081272-129081294 CAGTCTGTAGAGTTCATAAGCGG + Intergenic
938910309 2:135879306-135879328 CAGACTCTAGAGCTGGTAAAGGG - Intergenic
944985866 2:205175862-205175884 CAGACTGTAAAAATCAAAATAGG + Intronic
946904285 2:224401412-224401434 CAGGCTGTAGAACTCCTGATTGG + Exonic
947362292 2:229358862-229358884 CAAAATGTAGAGCTCAAAGTTGG + Intronic
949034776 2:241811426-241811448 AAGGCTGCAGAGCTCATCATGGG - Exonic
1169981523 20:11390232-11390254 CAGAATTTGGAGCTAATAATGGG + Intergenic
1171289249 20:23971619-23971641 CATACTGTAGAGTTCTTTATAGG - Intergenic
1174943694 20:54960820-54960842 CAGACTGTTGGGCTCATCCTCGG - Intergenic
1181789702 22:25255427-25255449 CTGACTGTACAGCCCATGATAGG + Intergenic
1184574825 22:45355103-45355125 CAGACTGTAGAGCCTATTATGGG + Exonic
950348157 3:12318684-12318706 CAGACTGTAGAGCTCATAATTGG - Intronic
951078285 3:18424059-18424081 CACAGTGTACAGCTCATAACGGG - Exonic
952715383 3:36474653-36474675 CAGACTGCTGAGATCATAAGAGG + Intronic
953130141 3:40130186-40130208 CAGACTGTAGACATCATTCTTGG - Intronic
954329388 3:49881429-49881451 CCAGCTGTAGAGCTCCTAATAGG - Intergenic
957746749 3:84353716-84353738 CTGATTGTAGAGCTCTTAAGTGG - Intergenic
961800207 3:129441923-129441945 CAAACTGCAGAGCTCATGCTCGG + Intronic
962627290 3:137238616-137238638 CAGGATGGAGACCTCATAATGGG + Intergenic
962700456 3:137993618-137993640 CAGACAGTATAGCTGATAAGGGG - Intergenic
963607395 3:147422978-147423000 CAGACTTTGGAGCTCAGAAAGGG + Intronic
963871630 3:150421713-150421735 CAGACTTTAAGGCTCTTAATAGG + Intronic
964481675 3:157144931-157144953 CAGACTGTGGTGTTAATAATGGG + Intergenic
966394108 3:179483979-179484001 CAGAATCTAGAGCTCAAAAAAGG + Intergenic
966954132 3:184856150-184856172 CACAGTGTAGAGGACATAATAGG - Intronic
967243283 3:187462482-187462504 CAGTCTCTTGAGCACATAATGGG - Intergenic
971130297 4:23801674-23801696 CATAATGTAGAGCTCAAGATGGG - Intronic
976755763 4:88496466-88496488 CAGACGATAGAGCTCAGAAATGG + Intronic
978870142 4:113565841-113565863 CAGACTGTTGAGTTCAGAAAAGG - Intronic
979806802 4:124983578-124983600 CAGGCTATAGAGCTCCTGATTGG + Intergenic
981191560 4:141871027-141871049 CAGACTGAACAACCCATAATAGG + Intergenic
984294781 4:177840596-177840618 CAGGCTTTATAGATCATAATTGG - Intronic
985785628 5:1892460-1892482 CAGACTGTGGAGTTCCTAGTGGG + Intergenic
992852660 5:80826473-80826495 CACACTGTATAGCACATAGTGGG - Intronic
994179811 5:96751825-96751847 CTGACTGTAGAGCTGAGCATTGG + Intronic
995297353 5:110537320-110537342 CAGGCTGGGCAGCTCATAATTGG - Intronic
999107174 5:149084071-149084093 GAGAGTGTAGAGGTCATACTTGG - Intergenic
1000500313 5:162040173-162040195 AAGACTTTAGAGCACATATTTGG - Intergenic
1008299527 6:49818135-49818157 CAGACTGTAGAGCTGCTTCTGGG - Intergenic
1015223777 6:130833338-130833360 CAGATTGTAGAGCTGAAAATGGG - Intronic
1015232049 6:130925685-130925707 CAAACAGAAGAGCACATAATTGG + Intronic
1020712446 7:11624693-11624715 CATAATGTAGAGTTCATACTTGG - Intronic
1029912983 7:104174616-104174638 CACACTGTATCGCTAATAATTGG + Intronic
1030718719 7:112843616-112843638 TCAACTGTAGAGCTCATTATTGG - Intronic
1030850124 7:114473392-114473414 CAAACTGTAGAGGCCATAGTAGG + Intronic
1042622977 8:70726393-70726415 CACACTGTAGACCTCTTACTTGG + Intronic
1043652660 8:82616586-82616608 CAGGCTTTACAGCTCAGAATAGG + Intergenic
1045943863 8:107772069-107772091 CAGACTGCCTAGCTCATTATAGG + Intergenic
1045985445 8:108244988-108245010 CATACCTTAGAGCTAATAATGGG - Intronic
1047790537 8:128199148-128199170 TAGATTGTCTAGCTCATAATAGG + Intergenic
1054815804 9:69474328-69474350 GAGATTGTAGAGCTCACAAGTGG - Intronic
1054946427 9:70800988-70801010 CAGACTGTAGATTTCCTAACAGG - Intronic
1061272137 9:129549767-129549789 CAGAATGTAGAGGTGGTAATAGG + Intergenic
1187238254 X:17488319-17488341 CTGACTGGAGGGCTCAGAATGGG - Intronic
1190383229 X:49859765-49859787 CAGACTTTATTGCTCATCATGGG + Intergenic
1191999568 X:67134343-67134365 CAGAATGTTTAGCTCATGATGGG - Intergenic
1195110091 X:101639712-101639734 CAGACTGCACTGCTCATGATAGG + Intergenic
1196564249 X:117186356-117186378 CAGAGTGTATGGCACATAATGGG - Intergenic
1200291036 X:154874079-154874101 CAAACTGTATATCTGATAATGGG + Intronic