ID: 950352108

View in Genome Browser
Species Human (GRCh38)
Location 3:12365391-12365413
Sequence CCAGATAATCAGTTATTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950352108 Original CRISPR CCAGATAATCAGTTATTTCA TGG Intronic
903456831 1:23493319-23493341 CAAGATAATCACCCATTTCAGGG + Intergenic
906754967 1:48302966-48302988 CCATATAGTTAGTTATTTCTGGG + Intronic
907775069 1:57506261-57506283 CCAGATGATCAGTTCTTCAATGG - Intronic
908328784 1:63049973-63049995 CCAGAAAATGAATTATTTGAAGG - Intergenic
908536447 1:65082626-65082648 GCTGATCATCAGTCATTTCAGGG + Intergenic
908982875 1:69979586-69979608 CTAGATCATCAGCTATTTCAAGG + Intronic
909177894 1:72383042-72383064 GCACATAATAAATTATTTCATGG + Intergenic
910746922 1:90583998-90584020 CCAGATGATGGGTTCTTTCAGGG + Intergenic
911480415 1:98432126-98432148 CCAGCTAATCATTTATATAATGG + Intergenic
911942300 1:104062102-104062124 AAATATAATCATTTATTTCAAGG + Intergenic
912055665 1:105595776-105595798 GAAGATAAACAGGTATTTCAAGG + Intergenic
912414931 1:109501664-109501686 GCAGATACCCAGTTATCTCATGG + Intronic
918873413 1:190006791-190006813 CCAGAGAATCAGGTATATTATGG + Intergenic
919596388 1:199568655-199568677 CCAGAGAATCTCTCATTTCAAGG + Intergenic
920601857 1:207333633-207333655 CTTGTTAATCAGTTATTTTAAGG - Intronic
924045626 1:240026263-240026285 ACAGATAATCTATTATGTCATGG - Intronic
1063032622 10:2250983-2251005 TCAGCTAATCAGTCCTTTCACGG + Intergenic
1064071214 10:12229576-12229598 CCAGCTAATCAGTTCTTCCTTGG + Intronic
1064635045 10:17356935-17356957 ACAGATAATAAGTTATTAAATGG + Intronic
1065073838 10:22056610-22056632 CCAGAATTTCACTTATTTCATGG - Intergenic
1068630997 10:59297559-59297581 CCTGACATTCAGTTACTTCAAGG + Intronic
1068738019 10:60436930-60436952 GCAGAGAATCAGTTATCACATGG + Intronic
1068911543 10:62383246-62383268 CCATAAAATCAGTGAGTTCAGGG - Intronic
1068972043 10:62969205-62969227 CCAGATTACCAGTTATCTGAAGG - Intergenic
1071998463 10:91170249-91170271 CCAGCTTATCAATTCTTTCATGG - Intronic
1072938572 10:99736851-99736873 CCAGTTTTTCATTTATTTCAGGG + Intronic
1074067842 10:110034585-110034607 CCATGTAATCAGTTATTAAATGG + Intronic
1074937550 10:118199729-118199751 CCAAAAAATTAGTTATTTGAAGG - Intergenic
1077820201 11:5729942-5729964 CCAGACTATCAGTTACTTCTTGG + Intronic
1077974051 11:7227326-7227348 CCAGAGAATCAGTAATTAAAAGG + Intergenic
1078567880 11:12432622-12432644 CCAGATAAGCAGTTATTTTTTGG - Intronic
1078872728 11:15363999-15364021 CCAGATAATTTGTTATTGTAGGG - Intergenic
1081071342 11:38613696-38613718 CTAATTAATCAGTTAATTCATGG - Intergenic
1081418944 11:42849183-42849205 TCAGATCATCAGTTGTTTAAGGG + Intergenic
1086995196 11:93348039-93348061 CCAGAGATTCAGTTTTTTCCTGG + Intronic
1088146315 11:106684261-106684283 CCACATAATCAGATATTAAAAGG + Intronic
1088569641 11:111210561-111210583 ACATTTAAACAGTTATTTCATGG - Intergenic
1090279418 11:125443249-125443271 CCTGAAAATCAGTTAATTCTTGG + Intergenic
1091067961 11:132534812-132534834 CCAGGTACTCACTTATTTCCAGG - Intronic
1093811298 12:23495352-23495374 CCAAATTATCAGTTATTTCATGG + Intergenic
1094302511 12:28981260-28981282 CTAGATTATCAGATATCTCAAGG + Intergenic
1097256282 12:57677640-57677662 CCAGCTTATCAATTCTTTCATGG - Intergenic
1098923874 12:76328034-76328056 CCAAATTAGCAGTTATCTCAGGG - Intergenic
1099057449 12:77862271-77862293 GCAGTTAATCAGCTAATTCAAGG + Intronic
1099746047 12:86706639-86706661 CAATATAGTCTGTTATTTCAAGG + Intronic
1104231372 12:126887734-126887756 ACAGATAATAAAATATTTCATGG - Intergenic
1107273817 13:38654067-38654089 TCAGATAATAAGTTATTGGAAGG - Intergenic
1108073151 13:46651001-46651023 TAAGAAAATCAGTTATTTTAAGG + Intronic
1110973144 13:81792939-81792961 CCAACTAATCAATTTTTTCATGG - Intergenic
1112273358 13:97992040-97992062 CCACATGATAAGTTATTTAAAGG + Intronic
1112830388 13:103442451-103442473 CTAGAGAATCAGTCATTTCCTGG + Intergenic
1113984744 13:114304582-114304604 CCAGATAACCAGTGTTTACATGG + Intronic
1115098442 14:29668578-29668600 TAAGATAATCAGTTCTTTTATGG + Intronic
1115992952 14:39168579-39168601 TAAGATAATGAGTTATTTCGGGG - Intronic
1116352406 14:43880829-43880851 CAATATATTCAATTATTTCAAGG + Intergenic
1116713647 14:48400318-48400340 CCAGATATACAGTGCTTTCATGG - Intergenic
1117794264 14:59375848-59375870 CCAGCTTATCAATTCTTTCATGG - Intergenic
1117803450 14:59466784-59466806 CCAGATAATTCTTTATTGCAGGG + Intronic
1123538685 15:21263711-21263733 CCAAATAAACACTTATTTAAAGG + Intergenic
1123538792 15:21265447-21265469 CCAAATAAACACTTATTTAAAGG - Intergenic
1127431072 15:58908905-58908927 CAAGATAACCATTTATCTCACGG - Intronic
1128398346 15:67252171-67252193 ACAGGTAATCAGCTACTTCAAGG + Intronic
1131343668 15:91626806-91626828 ACAGAAAATCAGTTGTTTGAAGG + Intergenic
1131582624 15:93659913-93659935 CCAGATAAGAACTTATTTTAAGG + Intergenic
1135070026 16:19343787-19343809 TCAGATAATTATTTATTGCAGGG - Intergenic
1136293232 16:29288247-29288269 CCAGTTCTTCTGTTATTTCAGGG - Intergenic
1136409965 16:30070389-30070411 CCAAATAAACAGCTATTTAAGGG + Exonic
1137934423 16:52620834-52620856 CCAGAAAATCAGTTCTTGCCTGG + Intergenic
1140848798 16:78914956-78914978 ACAGAGAATCAGTTAATTCCAGG + Intronic
1141304287 16:82846701-82846723 CTAGATAATAAGTTTTTTAAGGG + Intronic
1142099116 16:88262254-88262276 CCAGTTCTTCTGTTATTTCAGGG - Intergenic
1144692654 17:17278762-17278784 CCAGATAATTAATTAGTGCAGGG + Intronic
1147011598 17:37453745-37453767 AAAAAAAATCAGTTATTTCAAGG - Intronic
1148609206 17:48952863-48952885 CCAGACAATCAGTTCTATCATGG - Intergenic
1152054665 17:78015004-78015026 CAACATAATCAGTGATTCCAAGG - Intronic
1153178598 18:2406951-2406973 TCTGCAAATCAGTTATTTCATGG + Intergenic
1153650073 18:7231689-7231711 CAAGAAAATCAGTTCCTTCAGGG - Exonic
1154930228 18:20986670-20986692 GCAGATGGTCAGTTTTTTCAGGG + Intronic
1155741485 18:29294305-29294327 CCAGATGAACAATTATTTTATGG - Intergenic
1155941093 18:31802822-31802844 CCAGATCATGTTTTATTTCAAGG + Intergenic
1156074890 18:33262546-33262568 CCAGATAATGAGTCATTTTAAGG - Intronic
1157347271 18:46850869-46850891 GAAGAGAATCATTTATTTCAAGG - Intronic
1162047438 19:8009920-8009942 CCAGAAAGTCAGTTCTTTAATGG - Intronic
1166467955 19:43050830-43050852 CCACTTTATCATTTATTTCAAGG + Intronic
1166622762 19:44317477-44317499 CCAAATAATCAGATTTTTAATGG - Intergenic
925471525 2:4166796-4166818 CCAGCTTATCAATTTTTTCATGG + Intergenic
927266218 2:21154390-21154412 ACAAATAATCAGTTATATTAAGG + Intergenic
928241455 2:29590579-29590601 CAAGATGATCAGTTATTACCTGG - Intronic
928843992 2:35646376-35646398 ATATATACTCAGTTATTTCAAGG + Intergenic
930897813 2:56465629-56465651 CTACATAATCCCTTATTTCATGG - Intergenic
931836803 2:66107796-66107818 ACAAAAACTCAGTTATTTCAAGG - Intergenic
931928965 2:67107430-67107452 AAAGATAATCTGTTATGTCAGGG + Intergenic
933523113 2:83399987-83400009 CTAGATCATCAATTATTTCAAGG - Intergenic
935375430 2:102391099-102391121 CCAGATAATTACTAATTTAAAGG + Intronic
937272734 2:120663816-120663838 CCAGTTACTCAGTTATTGAAAGG + Intergenic
939292752 2:140216919-140216941 GCAGACACTCAGTTTTTTCAGGG - Intergenic
940259178 2:151762898-151762920 CCAGATAATCTGAGTTTTCAGGG + Intergenic
941028631 2:160486504-160486526 CCAGATAAACAGTGATTTCAGGG - Intronic
941396037 2:164974106-164974128 CCAAATAAACACTTATTTAAAGG - Intergenic
943611678 2:190042212-190042234 TCAGGGAATCAGTTACTTCATGG + Intronic
1169514580 20:6301894-6301916 CCACATCTTCAGTTATTTTAAGG - Intergenic
1171329115 20:24321882-24321904 ACAGACCTTCAGTTATTTCAAGG - Intergenic
1177878636 21:26666510-26666532 CAAAATAATCAGTGAATTCAGGG - Intergenic
1178210044 21:30519862-30519884 GAAGACAATAAGTTATTTCAAGG - Intergenic
1178695429 21:34788909-34788931 CCAAAGAAACAGGTATTTCAAGG + Exonic
1181524271 22:23470285-23470307 TCAGGAAATGAGTTATTTCAGGG + Intergenic
1181657376 22:24314394-24314416 AATGATTATCAGTTATTTCAAGG - Intronic
1182182103 22:28360684-28360706 CTATACAATCAGTCATTTCATGG - Intronic
1182577143 22:31280668-31280690 CCAGATCATCAGTTTTTTTCGGG - Intergenic
1183864247 22:40691603-40691625 CCAGATCTTCTGATATTTCAAGG - Intergenic
949743925 3:7266692-7266714 CCAGAAAAACATTTATTTTATGG + Intronic
949869200 3:8572996-8573018 CCAGGTACTAAGTTATGTCATGG + Intergenic
950352108 3:12365391-12365413 CCAGATAATCAGTTATTTCATGG + Intronic
950996057 3:17497777-17497799 CCAAATAATCTTTTATATCATGG - Intronic
951383748 3:22019377-22019399 ACAGACCATCAGTTATGTCAAGG + Intronic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953094708 3:39764028-39764050 CAGGATAATCACTTATCTCAAGG - Intergenic
954238164 3:49273034-49273056 CAAGATAATCAGTTGTATGAGGG + Intronic
954341870 3:49960654-49960676 CAAGATAAGAAGTTATTTCCAGG - Intronic
959200891 3:103245384-103245406 CCAGATAAGGAGTTAATTCTGGG - Intergenic
959327237 3:104952766-104952788 CTAGTGAATCATTTATTTCATGG + Intergenic
960893721 3:122479013-122479035 TGAGCTTATCAGTTATTTCATGG - Intronic
963519479 3:146346393-146346415 CCACATAATCAAGTATTTCTTGG - Intergenic
963952643 3:151220047-151220069 CCAGATAATTATTTATTTTTGGG + Intronic
965086616 3:164107862-164107884 CCAAATAATTTCTTATTTCATGG + Intergenic
969146543 4:5129026-5129048 GCAGATAATCTATTAGTTCAAGG - Intronic
969222677 4:5771623-5771645 CCAGAAAATCAGGGTTTTCATGG - Intronic
969417697 4:7071730-7071752 CCAGATAATCTCTGATCTCAAGG - Intergenic
970857515 4:20666236-20666258 CAAGAAAATAAATTATTTCAGGG + Intergenic
973021791 4:45211652-45211674 CCAGGAAATCAGTAAATTCAAGG + Intergenic
973102763 4:46293403-46293425 GCAAATAATCAGACATTTCAGGG + Intronic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
975702943 4:77083924-77083946 CCAGGTAATAAGTGAATTCAAGG + Intergenic
976373379 4:84316010-84316032 CCAGATATACAGGTATTTAAGGG - Intergenic
977061220 4:92258942-92258964 CCAGATAATCAGAAATTAGATGG - Intergenic
977439309 4:97042214-97042236 GCAGATAATCATTTGTTACAGGG - Intergenic
978665738 4:111178893-111178915 CTAGTTAATTATTTATTTCATGG + Intergenic
979098194 4:116577277-116577299 CTAGATAGTCAGTAAATTCATGG + Intergenic
979339619 4:119506295-119506317 TCAGTTTATCATTTATTTCATGG + Intronic
982309831 4:153973475-153973497 CCATATCATGAGTTATTTAAGGG - Intergenic
983611323 4:169648492-169648514 CCAAATAATCAGTTATCTCTGGG - Intronic
985037810 4:185858925-185858947 ATAAATAATCAGTAATTTCAAGG - Intronic
985121306 4:186645232-186645254 CTAAATTATGAGTTATTTCAAGG + Intronic
986798378 5:11234445-11234467 CAGGATAATCAGGTAGTTCAAGG + Intronic
988880990 5:35502322-35502344 CCAACTAATTAGTTAGTTCATGG + Intergenic
989992504 5:50783658-50783680 CCATAAAATAAGTTATTTAAGGG - Intronic
990556988 5:56946517-56946539 CTAGATTATGAGTTATTTGAAGG + Intronic
991937453 5:71816095-71816117 TCAGGTACTCAGTCATTTCATGG + Intergenic
994360887 5:98846836-98846858 CCAGTTTATTATTTATTTCATGG - Intergenic
995168401 5:109075869-109075891 CCAGATAATTAGTTTTTAGAAGG - Intronic
995765160 5:115606631-115606653 CCAGATAACCATCCATTTCAAGG + Intronic
996262851 5:121494844-121494866 TTAAATAATCAGCTATTTCAGGG - Intergenic
999231078 5:150062124-150062146 CCAGATTATCAGAGATATCAGGG - Intronic
1002999865 6:2320800-2320822 CCAGAAAATAAGATATTGCATGG - Intergenic
1003539785 6:7008337-7008359 CCAGGAAATCACTTATTTCATGG + Intergenic
1004775813 6:18843440-18843462 CCAGATGTTCAATTATTTGAAGG + Intergenic
1004866518 6:19858243-19858265 CCTGATAATCATTTATTCCATGG + Intergenic
1006564660 6:34944928-34944950 CCAGCTTATCAGTGTTTTCATGG + Intronic
1007268909 6:40620766-40620788 CCAGATAATCAGATTTCTCAGGG - Intergenic
1010325507 6:74557957-74557979 GCAAATGATCAGATATTTCAGGG - Intergenic
1011173621 6:84535230-84535252 CCAGATTCTCTCTTATTTCAGGG + Intergenic
1011948139 6:92933441-92933463 GAAGAAAATCAGTAATTTCATGG - Intergenic
1012556432 6:100518359-100518381 CCAAATAATCAGTTTTGTTAGGG + Intronic
1012587163 6:100937582-100937604 GAAGATAATCAGATATTTTAAGG - Intergenic
1013454231 6:110315666-110315688 CTAGATAATAAGTAATCTCATGG + Intronic
1014873610 6:126628060-126628082 CCAGAGAATCAGTATTCTCATGG - Intergenic
1016650922 6:146459156-146459178 TCAGATTATCAGTTTCTTCATGG + Intergenic
1017245946 6:152224574-152224596 CAAGATAAACAGTTACCTCATGG - Exonic
1018693892 6:166374438-166374460 CCAGCTTATCAATTATTTCTGGG + Intronic
1019169029 6:170118575-170118597 CCAATTTATCAGTTATTTTATGG + Intergenic
1021121935 7:16805669-16805691 ACAGATAATCTCTTATTTAAAGG + Intronic
1021167301 7:17357040-17357062 CTAGAATATCAGTTATTTGAGGG - Intergenic
1021591618 7:22269793-22269815 CCAGAGCCTCAGTTATTTGAAGG - Intronic
1024349273 7:48347313-48347335 CACAAAAATCAGTTATTTCACGG + Intronic
1024760008 7:52584513-52584535 CCAGATATTCATTTTTTTAATGG + Intergenic
1026215677 7:68346782-68346804 CCAGGAAATCAGGTATTTCTTGG - Intergenic
1028819670 7:95192573-95192595 CCAGATACTTAGTTTTTTTAAGG + Intronic
1030224641 7:107136301-107136323 CCAGCTTATCAATTCTTTCATGG - Intronic
1030232623 7:107224118-107224140 TCAGAGAAACCGTTATTTCAAGG + Intronic
1030336043 7:108327492-108327514 TCAGATAATGAGTATTTTCAGGG + Intronic
1030841958 7:114365500-114365522 CCAGATAATTATATATTCCATGG - Intronic
1031255497 7:119442339-119442361 TCAAATAATAAGTTATTTGAAGG - Intergenic
1033409394 7:141103512-141103534 CCTGATAATGAGTTTTTTGAGGG + Intronic
1033847649 7:145453840-145453862 CAAGATCAACAGTTATTTCCCGG - Intergenic
1034211451 7:149367184-149367206 TCAGAGTATCAGTTATTCCATGG - Intergenic
1035625548 8:1068026-1068048 CCAGAACATCATTTATTTGATGG + Intergenic
1036593914 8:10195014-10195036 CCAGATACACAGTTAATTGAGGG - Intronic
1039157231 8:34574726-34574748 CCATATTATCACTTCTTTCATGG + Intergenic
1040912514 8:52534461-52534483 ACAGCTAACCAGTTATTTCTGGG + Exonic
1044962107 8:97541475-97541497 GCAGATAATAAGATATTTAAAGG + Intergenic
1045446869 8:102275652-102275674 CCTGATAAGCATGTATTTCAGGG - Intronic
1045537203 8:103042144-103042166 CAAGATAATCCTTTAATTCATGG - Intronic
1045676893 8:104617054-104617076 TCAGGTAATCTTTTATTTCAAGG + Intronic
1050482491 9:6101255-6101277 GGAAATAATCAGATATTTCATGG + Intergenic
1052809977 9:33049572-33049594 CTAGCTTATCAGTTATTTCATGG - Intronic
1053556318 9:39141234-39141256 TCAGGTATTCAGTTATTACAGGG - Intronic
1054834651 9:69664038-69664060 CCAGGTAATATGTTTTTTCATGG - Intronic
1054935577 9:70684159-70684181 CCTGATAATCTTGTATTTCAGGG - Intronic
1057953273 9:99386684-99386706 CCCGATGAACAGTTATTTCCGGG - Intergenic
1059826514 9:118035606-118035628 CCAGATATTCAGCTATTTGGGGG + Intergenic
1060337820 9:122743228-122743250 CCAGAAAATCAGTGATTCCCAGG + Intergenic
1061354399 9:130093441-130093463 CCAGAGAAAGAGGTATTTCAGGG - Intronic
1186150541 X:6670085-6670107 CCACATGATCATTTATTTCCAGG + Intergenic
1186809104 X:13169446-13169468 CCACATAATAATTTTTTTCATGG + Intergenic
1186932034 X:14404432-14404454 CCAGTTACTCCCTTATTTCAGGG - Intergenic
1188767457 X:34113194-34113216 GCAGTTAAATAGTTATTTCATGG - Intergenic
1190638612 X:52461337-52461359 TCAGATATTCAGGTATTTCAGGG - Intergenic
1190678042 X:52799090-52799112 TCAGATATTCAGGTATTTCAGGG + Intergenic
1190679911 X:52817218-52817240 TCAGATATTCAGGTATTGCAGGG - Intronic
1193278640 X:79622323-79622345 CAAGATAATCAAATATTGCATGG - Intergenic
1194011870 X:88571699-88571721 TCAGACAGTCAGTTATTACAAGG - Intergenic
1194604572 X:95963346-95963368 GGAAATAATCAGATATTTCAGGG - Intergenic
1195028630 X:100904477-100904499 CCAGCTTATCAATTATTCCATGG - Intergenic
1196018208 X:110961904-110961926 CCTGAAAATCTGTTCTTTCATGG + Intronic
1196556639 X:117092737-117092759 CTAGAAAACCAGTTATTGCATGG + Intergenic
1197404898 X:126037829-126037851 TAAAATAATCAGATATTTCAGGG + Intergenic